Artigo Acesso aberto Revisado por pares

Structural and Genetic Analyses Reveal a Key Role in Prophage Excision for the TorI Response Regulator Inhibitor

2005; Elsevier BV; Volume: 280; Issue: 44 Linguagem: Inglês

10.1074/jbc.m507409200

ISSN

1083-351X

Autores

Latifa Elantak, Mireille Ansaldi, Françoise Guerlesquin, Vincent Méjean, Xavier Morelli,

Tópico(s)

Antibiotic Resistance in Bacteria

Resumo

TorI (Tor inhibition protein) has been identified in Escherichia coli as a protein inhibitor acting through protein-protein interaction with the TorR response regulator. This interaction, which does not interfere with TorR DNA binding activity, probably prevents the recruitment of RNA polymerase to the torC promoter. In this study we have solved the solution structure of TorI, which adopts a prokaryotic winged-helix arrangement. Despite no primary sequence similarity, the three-dimensional structure of TorI is highly homologous to the λXis, Mu bacteriophage repressor (MuR-DBD), and transposase (MuA-DBD) structures. We propose that the TorI protein is the structural missing link between the λXis and MuR proteins. Moreover, in vivo assays demonstrated that TorI plays an essential role in prophage excision. Heteronuclear NMR experiments and site-directed mutagenesis studies have pinpointed out key residues involved in the DNA binding activity of TorI. Our findings suggest that TorI-related proteins identified in various pathogenic bacterial genomes define a new family of atypical excisionases. TorI (Tor inhibition protein) has been identified in Escherichia coli as a protein inhibitor acting through protein-protein interaction with the TorR response regulator. This interaction, which does not interfere with TorR DNA binding activity, probably prevents the recruitment of RNA polymerase to the torC promoter. In this study we have solved the solution structure of TorI, which adopts a prokaryotic winged-helix arrangement. Despite no primary sequence similarity, the three-dimensional structure of TorI is highly homologous to the λXis, Mu bacteriophage repressor (MuR-DBD), and transposase (MuA-DBD) structures. We propose that the TorI protein is the structural missing link between the λXis and MuR proteins. Moreover, in vivo assays demonstrated that TorI plays an essential role in prophage excision. Heteronuclear NMR experiments and site-directed mutagenesis studies have pinpointed out key residues involved in the DNA binding activity of TorI. Our findings suggest that TorI-related proteins identified in various pathogenic bacterial genomes define a new family of atypical excisionases. Lambdoid phages, exemplified by λ itself, constitute a wide family of temperate phages, which genomes are found either as a circular double-stranded DNA, or as a prophage integrated into the host chromosome. The phage-encoded integrase (λInt) catalyzes both integration and excision reactions helped in these functions by several accessory proteins (1Friedman D.I. Curr. Opin. Genet. Dev. 1992; 2: 727-738Crossref PubMed Scopus (45) Google Scholar). Among them two are absolutely required, the host-encoded integration host factor (IHF) 3The abbreviations used are: IHF, integration host factor; RDF, recombination directionality factor; TMAO, trimethylamine-N-oxide; IPTG, isopropyl β-d-thiogalactopyrano-side; HSQC, heteronuclear single quantum correlation; NOE, nuclear Overhauser effect; CSI, chemical shift index; r.m.s.d., root mean square deviation. 3The abbreviations used are: IHF, integration host factor; RDF, recombination directionality factor; TMAO, trimethylamine-N-oxide; IPTG, isopropyl β-d-thiogalactopyrano-side; HSQC, heteronuclear single quantum correlation; NOE, nuclear Overhauser effect; CSI, chemical shift index; r.m.s.d., root mean square deviation. is required for integration and excision, whereas the phage-encoded excisionase (λXis) is necessary for excision only. Excisionase proteins are also called recombination directionality factors (RDFs), (2Lewis J.A. Hatfull G.F. Nucleic Acids Res. 2001; 29: 2205-2216Crossref PubMed Scopus (141) Google Scholar) since their role is to control the activity of the integrase and to direct the reaction toward excision. λXis plays a critical role during excision by allowing the formation of a specific complex called intasome together with the integrase, IHF, and a third accessory protein Fis (3Cho E.H. Gumport R.I. Gardner J.F. J. Bacteriol. 2002; 184: 5200-5203Crossref PubMed Scopus (39) Google Scholar). Simultaneously to the excision of the prophage genome, λXis also inhibits reintegration by converting the phage attachment site (attP) into a catalytically inactive structure (4de Vargas L.M. Landy A. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 588-592Crossref PubMed Scopus (47) Google Scholar). λXis functions require binding to the integrase as well as to DNA in the attR region at two tandemly arranged binding sites (X1 and X2). Binding to these sites promotes sharp bending of DNA and assist the integrase DNA binding to allow intasome formation (5Thompson J.F. de Vargas L.M. Skinner S.E. Landy A. J. Mol. Biol. 1987; 195: 481-493Crossref PubMed Scopus (55) Google Scholar, 6Numrych T.E. Gumport R.I. Gardner J.F. J. Bacteriol. 1991; 173: 5954-5963Crossref PubMed Google Scholar). The TorI protein was first identified as a TorR response regulator inhibitor (7Ansaldi M. Théraulaz L. Méjean V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9423-9428Crossref PubMed Scopus (26) Google Scholar). TorR is part of the two-component system TorS/TorR required for torCAD operon expression in Escherichia coli (8Simon G. Méjean V. Jourlin C. Chippaux M. Pascal M.C. J. Bacteriol. 1994; 176: 5601-5606Crossref PubMed Scopus (68) Google Scholar, 9Simon G. Jourlin C. Ansaldi M. Pascal M.C. Chippaux M. Méjean V. Mol. Microbiol. 1995; 17: 971-980Crossref PubMed Scopus (49) Google Scholar). In response to the presence of trimethylamine-N-oxide (TMAO) in the environment, the TorS sensor kinase autophosphorylates and transfers a phosphoryl group to TorR through a four-step phosphorelay leading to the induction of the torCAD operon, which encodes the TMAO reductase respiratory system (10Jourlin C. Ansaldi M. Méjean V. J. Mol. Biol. 1997; 267: 770-777Crossref PubMed Scopus (64) Google Scholar). The complex phosphorelay occurring between TorS and TorR led us to suspect the presence of intermediate checkpoints in the TMAO signal transduction pathway. Indeed, the torI gene has been identified as a negative regulator of the torCAD operon using a genetic multicopy approach. The negative effect was due to a previously unidentified small open reading frame (66 amino acids) that we called torI for Tor inhibition. Further studies showed that TorI does not interfere with the phosphorelay but rather acts at the level of the TorR response regulator. Interestingly, we showed that TorI binds to the C-terminal domain of TorR without affecting its DNA binding capacity, and we proposed that TorI prevents the recruitment of RNA polymerase to the torC promoter (7Ansaldi M. Théraulaz L. Méjean V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9423-9428Crossref PubMed Scopus (26) Google Scholar). So far, TorI is a unique case of response regulator inhibitor acting through protein-protein interaction with the DNA binding domain of a response regulator without interfering with its DNA binding activity. A look for TorI homologues on finished and unfinished bacterial genomes led us to find two categories of homologous proteins. The first one contained proteins that show 100% identity with TorI. These proteins are the products of gene hkaC in the coliphage HK620 genome and gene 18 in the genome of the Shigella flexneri phage Sf6 (11Clark A.J. Inwood W. Cloutier T. Dhillon T.S. J. Mol. Biol. 2001; 311: 657-679Crossref PubMed Scopus (91) Google Scholar, 12Casjens S. Winn-Stapley D.A. Gilcrease E.B. Morona R. Kuhlewein C. Chua J.E. Manning P.A. Inwood W. Clark A.J. J. Mol. Biol. 2004; 339: 379-394Crossref PubMed Scopus (102) Google Scholar). To date, no biological function has been assigned to these predicted proteins. In the second category of homologous proteins were found several proteins with 25–35% identity to TorI, present in various pathogenic bacteria such as uropathogenic E. coli O157:H7, Yersinia pseudotuberculosis, Vibrio cholerae, and S. flexneri. Analysis of the DNA sequences surrounding the genes of the TorI homologues revealed that most of these genes are located near a phage integrase encoding gene, in a pathogenic island, or in a characterized prophage region. The analysis of the genetic context of torI indicated that it also belonged to the defective prophage KplE1 genome sequence (7Ansaldi M. Théraulaz L. Méjean V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9423-9428Crossref PubMed Scopus (26) Google Scholar, 13Rudd K.E. Res. Microbiol. 1999; 150: 653-664Crossref PubMed Scopus (47) Google Scholar). All of these proteins share a small size (less than 80 residues) and a high proportion of basic residues, which are typical characteristics of RDF proteins (2Lewis J.A. Hatfull G.F. Nucleic Acids Res. 2001; 29: 2205-2216Crossref PubMed Scopus (141) Google Scholar). Indeed, two homologues of TorI have been recently described as pathogenic island excisionases, namely Hef and Rox in Y. pseudotuberculosis, and S. flexneri, respectively (14Luck S.N. Turner S.A. Rajakumar K. Adler B. Sakellaris H. J. Bacteriol. 2004; 186: 5551-5554Crossref PubMed Scopus (16) Google Scholar, 15Lesic B. Bach S. Ghigo J.M. Dobrindt U. Hacker J. Carniel E. Mol. Microbiol. 2004; 52: 1337-1348Crossref PubMed Scopus (68) Google Scholar). All of these data led us to suspect a role for TorI in the excision of the KplE1 cryptic prophage in E. coli. In this study, we show that TorI is capable of excisionase activity in vivo and presents a three-dimensional fold highly similar to that of both λXis and Mu repressor proteins. We also define the structural features of a new family of atypical excisionases. DNA Manipulations—Small-scale plasmid extractions were carried out by using the Miniprep plasmid kit (Promega), and DNA fragments were purified with the Qiagen PCR purification kit (Qiagen Inc.). DNA sequencing was performed on purified plasmids and PCR products at MWG Biotech. Strain Construction—Strain LCB970 is a derivative of strain MC4100 (Casadaban) and was constructed by insertion of the chloramphenicol acetyl transferase (cat) gene in the KplE1 prophage between yfdO and yfdP according to the method of Datsenko and Wanner (16Datsenko K.A. Wanner B.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6640-6645Crossref PubMed Scopus (10836) Google Scholar). Briefly, the cat gene was PCR-amplified using pKD3 as a template with the following primers: KplE1-Cm1 (5′-CAGGCGAATTTCGTTTGCCCAGGCTGTCCAGTTCGGTTCTGTGTAGGCTGGAGCTGCTTC) and KplE1-Cm2 (5′-AGCAGGCCGCCGAATGTGACGGCGAGGTGGTTCGTCCCAACATATGAATATCCTCCTTAG), where the underlined sequences are homologous to the DNA sequence within the KplE1 prophage to allow site-specific recombination by the λ-Red recombination system. The resulting PCR product was then transformed into a strain containing pKD20, which encodes the Red recombinase under an arabinose inducible promoter. The presence of the cat gene was then verified by PCR amplification of the chromosomal region (the sequence of the primers is available upon request to the authors). Excision Test—Strain LCB970 carrying torI encoding plasmids pJFi (7Ansaldi M. Théraulaz L. Méjean V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9423-9428Crossref PubMed Scopus (26) Google Scholar) was grown in LB medium until the OD600 reached 0.5 units, and IPTG (1 mm) was added for 2 h at 37°C under agitation. Culture dilutions were prepared and plated onto rich medium containing either 50 μg/ml ampicillin or 5 μg/ml chloramphenicol. Numeration of the colonies plated on both antibiotics was performed and the ratio of ampicillin-resistant/chloramphenicol-resistant colonies was calculated. Values represent the average of at least three independent determinations. To confirm prophage DNA excision, a PCR test was performed on randomly chosen colonies plated onto ampicillin. A control colony containing the empty vector was included in the PCR assay. A basic PCR amplification was performed (30 s denaturation at 94 °C, 30 s annealing at 55 °C, 30 s elongation at 72 °C) using the GoTaq® DNA polymerase (Promega) and the following primers: ptorI1 (5′-GAGCCATACAGCCTCACACTCGATGAGG) inside KplE1 prophage and Ext3′KplE1 (5′-CTTATTCGGCCTGCTAGTTCG) outside of the prophage. Site-directed Mutagenesis—Mutagenesis of residues Tyr28 and Arg45 was performed as described previously (17Ansaldi M. Lepelletier M. Méjean V. Anal. Biochem. 1996; 234: 110-111Crossref PubMed Scopus (86) Google Scholar). Briefly, the entire pJFi plasmid (pJF119EHtorI) was PCR-amplified with divergent overlapping primer pairs, one primer of each pair carrying the desired mutation, and a high fidelity thermostable DNA polymerase (Expand High Fidelity DNA, Roche Diagnostic). Mutations of Tyr28 into Phe or Ser and Arg45 into Gln or Lys were performed by introducing degenerate codons TYC and MAA (where Y indicates A or C, and M indicates C or T), respectively, at the desired positions in one primer per pair. PCR reaction was conducted with 200 ng of template plasmid, 200 μm concentration of each dNTPs, and 5 units of DNA polymerase, in the presence of 5% Me2SO, and only 10 amplification cycles were performed to avoid non-desired mutation. The template plasmid was then hydrolyzed by addition of 20 units of the DpnI enzyme (Biolabs), and the purified PCR products were directly transformed into a recA strain (JM109) to allow homologous recombination on both sides of the PCR product to generate a mutated circular plasmid. The resultant plasmids were then purified and sequenced (MWG Biotech) to check for the presence of the desired mutations and the absence of additional mutation in the rest of the torI gene and transformed into the test strain LCB970. To check that TorI mutants were produced and stable in strain LCB970, crude extracts of LCB970 overproducing TorI wild type and mutants were prepared and submitted to Western blot analysis using a TorI antiserum. TorI Labeling and Purification—TorI protein was produced in BL21(DE3) cells harboring plasmid pETsI (7Ansaldi M. Théraulaz L. Méjean V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9423-9428Crossref PubMed Scopus (26) Google Scholar). To obtain the double-labeled protein, cells were grown in M9 minimal medium supplemented with 2 g/liter [13C]glucose (Eurisotop) and/or 1 g/liter [15N]NH4Cl until the OD600 reached 0.8 units, and IPTG (1 mm) was added for 2 h at 37 °C. French-pressed cell lysate extract was equilibrated with 40 mm Tris buffer (pH 7.4) and loaded onto a HiTrap SP column (Amersham Biosciences). The protein was eluted with a step gradient of KCl and was found in the 0.3 m KCl-containing fraction. NMR Measurements, Assignment, and Interaction with DNA—The HSQC spectra were first compared at 278, 283, 288, and 298 K to pick up the best stability/intensity ratio. The NMR experiments were then carried out at 278K on a 500 MHz Bruker DRX spectrometer and on a 800 MHz Varian Inova spectrometer equipped with a triple resonance (1H, 15N, 13C) probe including shielded z-gradients. For the backbone and side chain resonance assignments, three-dimensional HNCO, CBCA(CO)NH, HNCA, HN(CO)CA, HN(CA)CO, (H)CCH-TOCSY, NOESY-(15N,1H)-HSQC, and TOCSY-(15N,1H)-HSQC spectra were recorded (18Bax A. Clore G.M. Driscoll P.C. Gronenborn A.M. Ikura M. Kay L.E. J. Magn. Reson. 1990; 87: 620-627Google Scholar, 19Bax A. Ikura M. J. Biomol. NMR. 1991; 1: 99-104Crossref PubMed Scopus (347) Google Scholar, 20Grzesiek S. Bax A. J. Magn. Reson. 1992; 96: 432-440Google Scholar, 21Grzesiek S. Bax A. J. Am. Chem. Soc. 1992; 114: 6291-6293Crossref Scopus (918) Google Scholar). 3JHNα coupling constants were measured using three-dimensional HNHA experiments (22Vuister G.W. Bax A. J. Biomol. NMR. 1994; 4: 193-200Crossref PubMed Scopus (54) Google Scholar). NOE distance constraints were obtained from a two-dimensinoal NOESY, three-dimensional NOESY (15N,1H)-HSQC spectra with mixing times of 100 and 120 ms. All NMR spectra were processed using XWin-NMR (Bruker) and analyzed using Felix (Accelrys). The DNA sequence used for the titration experiments corresponds to 5′-GGGTAAAATA (Fig. 3). Two 10-base complementary oligonucleotides (MWG Biotech) were annealed in 10 mm Tris-HCl, 300 mm NaCl, and ethanol-precipitated. The double strand DNA was then resuspended in 40 mm phosphate (pH 5.9), 100 mm NaCl at a concentration of 0.1 m. The TorI-DNA complex formation was monitored by recording a series of two-dimensional 1H-15N HSQC spectra of a 125 mm15N-labeled TorI solution (40 mm phosphate (pH 5.9), 50 mm NaCl) with final DNA concentrations of 15 and 30 mm (0.1 and 0.2 equivalents). Chemical Shift-derived Restraints—The Cα, Cβ, Co, Hα, and N chemical shifts of 36 residues served as input for the TALOS program (23Cornilescu G. Delaglio F. Bax A. J. Biomol. NMR. 1999; 13: 289-302Crossref PubMed Scopus (2727) Google Scholar). TALOS derives information on the ϕ and Ψ backbone dihedral angles from a comparison of secondary chemical shift corresponding to known conformations. A conservative approach was chosen requiring that all 10 best matches agree for a prediction to be accepted. The TALOS predictions were converted into dihedral angle restraints as the average ϕ and Ψ angles ± 2 S.D. or a minimum of ± 10°. Structure Calculations—Distance restraints were obtained from two-dimensional NOESY and three-dimensional 15N-edited NOESY experiments (with mixing times of 100 and 120 ms). ϕ angle dihedral restraints were estimated from 3JHN-Hα coupling constants and use of the Karplus equation. TALOS-derived dihedral angle constraints were used as described above. Structure calculations were performed with CNS/ARIA (default parameter with the Amersham Bioscience steps parameter *8 to increase convergence). The best 17 structures were selected based on the lowest total restraint energy and analyzed using Procheck and Procheck_NMR (24Laskowski R.A. Rullmannn J.A. MacArthur M.W. Kaptein R. Thornton J.M. J. Biomol. NMR. 1996; 8: 477-486Crossref PubMed Scopus (4281) Google Scholar). Coordinates—The Protein Data Bank accession number for the coordinates is 1Z4H. The TorI Response Regulator Inhibitor Is a Winged Helix Protein—To solve the three-dimensional structure of TorI we produced the recombinant protein in the presence of either [13C]glucose or [15N]NH4Cl or both labeled substrates. After recording a series of HSQC spectra at different temperatures, we finally picked up 278 K as the best stability/intensity ratio. The structure of TorI was then solved at 278 K (40 mm NaPO4 (pH 5.9)) using conventional homonuclear two- and multidimensional heteronuclear NMR spectroscopy on a 500 MHz Bruker DRX spectrometer and at high resolution field (800 MHz Varian Inova spectrometer), making use of uniformly 15N- and 13C-labeled protein. The NMR assignment of 1H, 15N, and 13C resonances was accomplished using a combination of 1H-1H TOCSY, 1H-1H NOESY, 1H-15N TOCSY-HSQC, 1H-15N NOESY-HSQC, and 1H-15N HNHA experiments and the standard multidimensional heteronuclear experiments HNCO, HNCA, HN(CO)CA, HN(CA)CO, and CBCA(CO)NH (18Bax A. Clore G.M. Driscoll P.C. Gronenborn A.M. Ikura M. Kay L.E. J. Magn. Reson. 1990; 87: 620-627Google Scholar, 19Bax A. Ikura M. J. Biomol. NMR. 1991; 1: 99-104Crossref PubMed Scopus (347) Google Scholar, 20Grzesiek S. Bax A. J. Magn. Reson. 1992; 96: 432-440Google Scholar, 21Grzesiek S. Bax A. J. Am. Chem. Soc. 1992; 114: 6291-6293Crossref Scopus (918) Google Scholar). The global fold was established using unambiguous assigned long range NOEs. Several long range NOEs between the helices and the β-strands were obtained from a three-dimensional NOESY (1H-15N)-HSQC spectrum. The unassigned NOEs with multiple possible assignments were used in ARIA (25Linge J.P. Nilges M. J. Biomol. NMR. 1999; 13: 51-59Crossref PubMed Scopus (239) Google Scholar) as ambiguous restraints. The final ensemble of structures was calculated using non-bonded interaction for simulated annealing and refinement of the final structures in an explicit water box. A total of 1341 restraints have been used to calculate the structures. 1173 distance restraints were identified from the two-dimensional and three-dimensional NOESY; 68 dihedral angle constraints were obtained from TALOS (23Cornilescu G. Delaglio F. Bax A. J. Biomol. NMR. 1999; 13: 289-302Crossref PubMed Scopus (2727) Google Scholar) on the basis of backbone chemical shift values; 100 dihedral angle constraints were estimated from the chemical shift index (CSI), 3JHN-Hα coupling constant, and from the use of the Karplus equation (26Wishart D.S. Sykes B.D. J. Biomol. NMR. 1994; 4: 171-180Crossref PubMed Scopus (1893) Google Scholar). TABLE ONE summarizes the experimental restraints and the structural statistics of the 17 best structures. A superimposition of the final ensemble of 17 simulated annealing structures is shown in Fig. 1A; a view of the representative (closest to average) structure is shown in Fig. 1B, and the electrostatic surface potential of the TorI protein overlaid with the ribbon diagram is presented in Fig. 1C.TABLE ONEStructural statistics based on the 17 best structures calculated with ARIAr.m.s.d. (Å) with respect to the mean Backbone, 2° structures0.30 (±5.85E-02) Heavy atoms, 2° structures0.67 (±8.26E-02) Backbone, all residues (6–63)0.69 (±0.25) Heavy atoms, all residues (6–63)1.18 (±0.24)No. of experimental restraints Total number of meaningful distance restraints1173Intraresidual (i = j)505Sequential (|i–j| = 1)296Medium range (1 < |i–j| ≤ 4)184Long range (|i–j| > 4)188 Average number of restraints per residues17.8 Dihedral angle restraints from TALOS68 ϕ angles from 3JHN-Hα26 CSI-derived angles74Restraint violations NOE distances with violations >0.50 Dihedral with violations >5°0r.m.s.d for experimental restraints All distances restraints (1173)0.027 (±1E-03)) Dihedral restraints (TALOS)0.470 (±0.22) Dihedral restraints (CSI)0.645 (±0.102)r.m.s.d (Å) from idealized geometry Bonds0.00400 (±1E-04) Angles0.557406 (±1.08E-02) Improper1.39144 (±0.08416)Ramachandran analysis (residues 1–66) Residues in favored regions (%)81.9 Residues in additional allowed regions (%)14.5 Residues in generously allowed regions (%)2.6 Residues in disallowed regions (%)1.0 Open table in a new tab The conformers within the ensemble do not exhibit any NOE, dihedral angle, or scalar coupling constant violations greater than 0.4 Å, 5°, or 2 Hz, respectively. Residues Gln6–Arg63 are well structured in solution and the coordinates of their backbone and heavy atoms can be superimposed to the average structure with a root mean square deviation (r.m.s.d.) of 0.69 (±0.25) Å and 1.18 (±0.24) Å, respectively. The TorI protein adopts an overall structure classified as an unusual "winged" helix structure that is formed by three α-helices (α1, residues Lys14–Asp19; α2, Lys24–Lys32; α3, Arg51–Arg63), which are packed against three extended strands (Fig. 1B). The first two helices are separated by an ordered 5-residue turn (T1, Asp19–Gly23) and are positioned approximately orthogonal to one another to generate a L-shaped structure. Immediately following helix α2, the peptide chain adopts an extended strand conformation (S1, residues Ser33–Lys38), before leading into a two-stranded anti-parallel β-sheet (β2, residues Ala39–Val41; β3, residues Ala46–Tryp48) whose strands are connected by a 4-residue reverse turn ("wing") (W, residues Ile42–Arg45). Strand S2 (S2, residues Leu49–Asp52) then follows strand β2 and is situated directly adjacent to strand S1. The structure is completed by the first β-strand (β1, residues Asp8–Val11), which packs against β2, limiting the potential mobility of the wing. Finally, the well defined third helix is parallel to α-helix 1 (opposite orientation) and positioned approximately orthogonal to α-helix 2 generating a final C-shaped structure between the three α-helices. The winged helix structural motif is a derivative of the usual helix-turn-helix DNA binding motif (27Rogov V.V. Lucke C. Muresanu L. Wienk H. Kleinhaus I. Werner K. Lohr F. Pristovsek P. Ruterjans H. Eur. J. Biochem. 2003; 270: 4846-4858Crossref PubMed Scopus (12) Google Scholar, 28Sam M.D. Cascio D. Johnson R.C. Clubb R.T. J. Mol. Biol. 2004; 338: 229-240Crossref PubMed Scopus (43) Google Scholar, 29Gajiwala K.S. Burley S.K. Curr. Opin. Struct. Biol. 2000; 10: 110-116Crossref PubMed Scopus (444) Google Scholar, 30Ilangovan U. Wojciak J.M. Connolly K.M. Clubb R.T. Biochemistry. 1999; 38: 8367-8376Crossref PubMed Scopus (21) Google Scholar). It is known for some winged helix proteins that DNA binding occurs through two kinds of interactions: one α-helix interacts with the major groove of the DNA target, while the wing penetrates the minor groove of the DNA target. This wing can be seen as an anchor that increases the specificity of the interaction. In the TorI structure the winged helix is composed of helix α2 and of the wing in between β2 and β3. This motif thus constitutes a potential DNA binding site on the TorI protein. Structural Similarity of TorI with Other Proteins—Interestingly a search for homologous structure using the programs DALI (www.ebi.ac.uk/dali/) and SSM (www.ebi.ac.uk/msd-srv/ssm) allowed us to identify prophage excisionase-type molecules of the λXis family (r.m.s.d. of 2.63 Å with a Qscore of 0.26 with the structure of full-length excisionase from bacteriophage HK022, Protein Data Bank code 1pm6 and r.m.s.d. of 2.7 Å with a Z-score of 2.5 with the structure of the λXis protein, Protein Data Bank code 1lx8) (27Rogov V.V. Lucke C. Muresanu L. Wienk H. Kleinhaus I. Werner K. Lohr F. Pristovsek P. Ruterjans H. Eur. J. Biochem. 2003; 270: 4846-4858Crossref PubMed Scopus (12) Google Scholar, 28Sam M.D. Cascio D. Johnson R.C. Clubb R.T. J. Mol. Biol. 2004; 338: 229-240Crossref PubMed Scopus (43) Google Scholar) (Fig. 2). These proteins belong to the RDF family of proteins that comprises a diverse group of proteins involved in controlling the directionality of integrase-mediated site-specific recombination (2Lewis J.A. Hatfull G.F. Nucleic Acids Res. 2001; 29: 2205-2216Crossref PubMed Scopus (141) Google Scholar). In lambdoid phages the λXis proteins are the essential partners of the tyrosine family of site-specific recombinases (Int) for the excision of the prophage DNA during the lytic cycle. Indeed, the integrase plays a key role in both integration and excision reactions together with the host factor IHF, but the directionality of recombination is driven by the excisionase that interacts with the integrase and DNA during prophage excision (3Cho E.H. Gumport R.I. Gardner J.F. J. Bacteriol. 2002; 184: 5200-5203Crossref PubMed Scopus (39) Google Scholar, 31Abremski K. Gottesman S. J. Biol. Chem. 1982; 257: 9658-9662Abstract Full Text PDF PubMed Google Scholar). The three-dimensional conformation of λXis has been described to be similar to the DNA binding domain of the Mu bacteriophage repressor (MuR-DBD), to the DNA binding domain of the Mu transposase (MuA-DBD) protein and recently to the excisionase protein from the conjugative transposon Tn916 (32Abbani M. Iwahara M. Clubb R.T. J. Mol. Biol. 2005; 347: 11-25Crossref PubMed Scopus (21) Google Scholar, 33Clubb R.T. Omichinski J.G. Savilahti H. Mizuuchi K. Gronenborn A.M. Clore G.M. Structure (Camb.). 1994; 2: 1041-1048Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar) (see below for discussion). Identification of TorI DNA Target and in Vivo Excisionase Activity—We previously found that the torI gene was actually part of a cryptic prophage genome, the prophage KplE1 (or CPS53) that extends from the argW tRNA gene to the dsdC gene (around 2475 kb on the E. coli MG1655 chromosome) (7Ansaldi M. Théraulaz L. Méjean V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9423-9428Crossref PubMed Scopus (26) Google Scholar, 13Rudd K.E. Res. Microbiol. 1999; 150: 653-664Crossref PubMed Scopus (47) Google Scholar). The torI gene is located at the 3′ end of this prophage, whereas the intS gene, encoding a putative tyrosine integrase, is located at the other extremity (Fig. 3). The KplE1 cryptic prophage was identified by DNA sequence homology to S. flexneri bacteriophages Sf6 and V and coliphage HK620, all of them being λ-type temperate phages. We thus looked for the characteristic sequences involved in prophage excision at the 3′ end of the KplE1 prophage (attR). As expected, we could predict all of the sequences necessary for the intasome structure formation (Fig. 3). This region indeed comprises the integrase binding sites, composed of a core sequence and two arm-type sequences (O, P1 and P2, respectively), two IHF binding sites (H1, H2), and two perfect repeats of a 10-bp motif that are good candidates for being TorI binding sites (I1, I2). To demonstrate the in vivo activity of TorI as a prophage excisionase we constructed a test strain in which the chloramphenicol acetyltransferase encoding gene was inserted in a non-coding region of the prophage KplE1. We then checked for the effect of TorI overexpression on KplE1 excision by estimating the number of bacteria (colony-forming units) that lost the ability to grow on chloramphenicol. Upon IPTG induction of the torI gene, most of the colonies proved to be chloramphenicol sensitive compared with the control condition in the presence of the vector alone (TABLE TWO). PCR amplifications of the 3′ end of the KplE1 DNA were then performed on a sample of randomly chosen colonies plated on rich medium to confirm the disappearance of the KplE1 prophage DNA from the bacterial chromosome upon TorI overexpression. As expected, no amplification product could be obtained in cells overproducing TorI (Fig. 4, lanes 1–15), whereas a PCR product at the expected size (490 bp) was obtained in control cells containing the vector alone (Fig. 4, lane C). These results show (i) that the KplE1-defective prophage can be excised and (ii) that TorI overexpression promotes KplE1 prophage excision and allows the in vivo validati

Referência(s)