Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Genetic Interactions with the Yeast Q-SNARE VTI1Reveal Novel Functions for the R-SNARE YKT6

2001; Elsevier BV; Volume: 276; Issue: 37 Linguagem: Inglês

10.1074/jbc.m101551200

ISSN

1083-351X

Autores

Meik Dilcher, Beate Köhler, Gabriele Fischer von Mollard,

Tópico(s)

Lysosomal Storage Disorders Research

Resumo

SNARE proteins are required for fusion of transport vesicles with target membranes. Previously, we found that the yeast Q-SNARE Vti1p is involved in transport to the cis-Golgi, to the prevacuole/late endosome, and to the vacuole. Here we identified a previously uncharacterized gene, VTS1, and the R-SNAREYKT6 both as multicopy and as low copy suppressors of the growth and vacuolar transport defect in vti1–2 cells. Ykt6p was known to function in retrograde traffic to the cis-Golgi and homotypic vacuolar fusion. We found that VTI1 andYKT6 also interacted in traffic to the prevacuole and vacuole, indicating that these SNARE complexes contain Ykt6p, Vti1p, plus Pep12p and Ykt6p, Vti1p, Vam3p, plus Vam7p, respectively. As Ykt6p was required for several transport steps, R-SNAREs cannot be the sole determinants of specificity. To study the role of the 0 layer in the SNARE motif, we introduced the mutations vti1-Q158R andykt6-R165Q. SNARE complexes to which Ykt6p contributed a fourth glutamine residue in the 0 layer were nonfunctional, suggesting an essential function for arginine in the 0 layer of these complexes.vti1-Q158R cells had severe defects in several transport steps, indicating that the second arginine in the 0 layer interfered with function. SNARE proteins are required for fusion of transport vesicles with target membranes. Previously, we found that the yeast Q-SNARE Vti1p is involved in transport to the cis-Golgi, to the prevacuole/late endosome, and to the vacuole. Here we identified a previously uncharacterized gene, VTS1, and the R-SNAREYKT6 both as multicopy and as low copy suppressors of the growth and vacuolar transport defect in vti1–2 cells. Ykt6p was known to function in retrograde traffic to the cis-Golgi and homotypic vacuolar fusion. We found that VTI1 andYKT6 also interacted in traffic to the prevacuole and vacuole, indicating that these SNARE complexes contain Ykt6p, Vti1p, plus Pep12p and Ykt6p, Vti1p, Vam3p, plus Vam7p, respectively. As Ykt6p was required for several transport steps, R-SNAREs cannot be the sole determinants of specificity. To study the role of the 0 layer in the SNARE motif, we introduced the mutations vti1-Q158R andykt6-R165Q. SNARE complexes to which Ykt6p contributed a fourth glutamine residue in the 0 layer were nonfunctional, suggesting an essential function for arginine in the 0 layer of these complexes.vti1-Q158R cells had severe defects in several transport steps, indicating that the second arginine in the 0 layer interfered with function. solubleN-ethylmaleimide-sensitive factor attachment protein receptor SNARE with glutamine in the 0 layer SNARE with arginine in the 0 layer carboxypeptidase Y alkaline phosphatase aminopeptidase I kilobase pair(s) sterile α motif endoplasmic reticulum cytosol to vacuole transport open reading frame polymerase chain reaction hemagglutinin polyacrylamide gel electrophoresis Transport between different organelles is mediated by transport vesicles, which bud from the donor compartment (1Rothman J. Nature. 1994; 372: 55-63Crossref PubMed Scopus (2011) Google Scholar). Recognition of the correct target requires interactions between specific members of the Rab/YPT family of small GTPases, tether proteins and SNARE1 proteins (2Waters M.G. Hughson F.M. Traffic. 2000; 1: 588-597Crossref PubMed Scopus (91) Google Scholar). These SNARE proteins constitute a large, evolutionary conserved family (3Jahn R. Sudhof T. Annu. Rev. Biochem. 1999; 68: 863-911Crossref PubMed Scopus (1025) Google Scholar). Vesicle-associated SNAREs are found on transport vesicles, target membrane-associated SNAREs on target membranes. In most cases SNAREs are attached to the membrane by a C-terminal transmembrane domain or by hydrophobic posttranslational modifications. The SNARE motif, a highly conserved domain of 60 amino acid residues, is found next to the membrane anchor. Four different SNARE motifs form a parallel helical bundle with 16 layers (numbered from −7 to +8) of interacting amino acid side chains pointing toward the center of the bundle in the neuronal SNARE complex (4Sutton R.B. Fasshauer D. Jahn R. Brunger A.T. Nature. 1998; 395: 347-353Crossref PubMed Scopus (1932) Google Scholar). Most layers consist of four hydrophobic amino acid residues. However, in the central 0 layer, an arginine (R) from synaptobrevin interacts with three glutamines (Q) from syntaxin 1 and both SNAP-25 helices. These residues are very conserved, leading to a reclassification of SNAREs into R- and Q-SNAREs (5Fasshauer D. Sutton R.B. Brunger A.T. Jahn R. Proc. Natl. Acad Sci. U. S. A. 1998; 95 (14786): 15781Crossref PubMed Scopus (756) Google Scholar). It has been suggested that a parallel four-helix bundle with one R- and three Q-SNARE helices is a common feature of SNARE complexes. The yeast Saccharomyces cerevisiae has proven a powerful model system to study membrane traffic and to test the SNARE hypothesis (6Bryant N.J. Stevens T.H. Microbiol. Mol. Biol. Rev. 1998; 62: 230-247Crossref PubMed Google Scholar). Twenty-one SNAREs, among them 5 R-SNAREs, have been identified in yeast (7Götte M. Fischer von Mollard G. Trends Cell Biol. 1998; 8: 215-218Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 8Pelham H.R. Exp. Cell Res. 1999; 247: 1-8Crossref PubMed Scopus (133) Google Scholar). All of them have been assigned to one or more traffic steps. However, the exact compositions of the SNARE complexes are not clear for many transport steps. Earlier, we described the Q-SNARE Vti1p, which is required for several transport steps in yeast. Vti1p interacts with the syntaxin-related cis-Golgi Q-SNARE Sed5p in a retrograde traffic step to the cis-Golgi (9Fischer von Mollard G. Nothwehr S.F. Stevens T.H. J. Cell Biol. 1997; 137: 1511-1524Crossref PubMed Scopus (175) Google Scholar, 10Lupashin V.V. Pokrovskaya I.D. McNew J.A. Waters M.G. Mol. Biol. Cell. 1997; 8: 2659-2676Crossref PubMed Scopus (92) Google Scholar). The R-SNARE Ykt6p and the Q-SNARE Sft1p have been implicated in this transport step as well (11McNew J.A. Søgaard M. Lampen N.M. Machida S. Ye R.R. Lacomis L. Tempst P. Rothman J.E. Söllner T.H. J. Biol. Chem. 1997; 272: 17776-17783Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 12Banfield D.K. Lewis M.J. Pelham H.R. Nature. 1995; 375: 806-809Crossref PubMed Scopus (129) Google Scholar). Vti1p and the syntaxin-related endosomal Q-SNARE Pep12p are the only SNAREs identified so far in transport from the Golgi to the prevacuolar/late endosomal compartment (9Fischer von Mollard G. Nothwehr S.F. Stevens T.H. J. Cell Biol. 1997; 137: 1511-1524Crossref PubMed Scopus (175) Google Scholar, 13Becherer K.A. Rieder S.E. Emr S.D. Jones E.W. Mol. Biol. Cell. 1996; 7: 579-594Crossref PubMed Scopus (253) Google Scholar). This transport pathway is used by many vacuolar proteins, for example by carboxypeptidase Y (CPY). These proteins are transported in a second step from the prevacuole to the vacuole (14Conibear E. Stevens T.H. Biochim. Biophys. Acta. 1998; 1404: 211-230Crossref PubMed Scopus (152) Google Scholar). A different pathway to the vacuole is used by alkaline phosphatase (ALP), which travels in vesicles from the Golgi to the vacuole without passage through the prevacuole. A third vacuolar pathway is taken by aminopeptidase I (API) and autophagosomes. API is synthesized in the cytosol, packaged into cytosol to vacuole transport (CVT) vesicles enclosed by double membranes in a process similar to autophagocytosis (15Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-32Crossref PubMed Scopus (391) Google Scholar). The outer membrane of CVT vesicles and autophagosomes fuses with the vacuole. The same Q-SNAREs Vam3p, Vam7p, and Vti1p are required for these three biosynthetic pathways to the vacuole (16Sato T.K. Darsow T. Emr S.D. Mol. Cell. Biol. 1998; 18: 5308-5319Crossref PubMed Scopus (166) Google Scholar, 17Darsow T. Rieder S.E. Emr S.D. J. Cell Biol. 1997; 138: 517-529Crossref PubMed Scopus (298) Google Scholar, 18Wada Y. Nakamura N. Ohsumi Y. Hirata A. J. Cell Sci. 1997; 110: 1299-1306Crossref PubMed Google Scholar, 19Piper R.C. Bryant N.J. Stevens T.H. J. Cell Biol. 1997; 138: 531-546Crossref PubMed Scopus (134) Google Scholar, 20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar), whereas an R-SNARE has not yet been identified. The vacuolar R-SNARE Nyv1p has been excluded as the missing R-SNARE because these transport pathways are not affected by deletion of NYV1 and a genetic interaction between the vti1–2 mutant and NYV1was not observed (20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar). Vacuoles can also undergo homotypic fusion. The Q-SNAREs Vam3p, Vam7p, and Vti1p together with the R-SNAREs Nyv1p and Ykt6p have been implicated in homotypic vacuolar fusion (21Nichols B.J. Ungermann C. Pelham H.R.B. Wickner W.T. Haas A. Nature. 1997; 387: 199-202Crossref PubMed Scopus (381) Google Scholar, 22Ungermann C. Wickner W. EMBO J. 1998; 17: 3269-3276Crossref PubMed Scopus (97) Google Scholar, 23Ungermann C. Fischer von Mollard G. Jensen O.N. Margolis N. Stevens T.H. Wickner W. J. Cell Biol. 1999; 145: 1435-1442Crossref PubMed Scopus (134) Google Scholar). We set out to identify proteins that are required together with Vti1p for transport to the vacuole. Genetic interactions have proven a valuable tool for this purpose. vti1–2 is a useful mutant allele for such studies because transport from the Golgi to the prevacuole and all transport steps to the vacuole are blocked at nonpermissive temperature but transport to the cis-Golgi is not affected. vti1–2 has the amino acid exchanges S130P in the −8 layer and I151T in the −2 layer of the SNARE motif (24Fischer von Mollard G. Stevens T.H. J. Biol. Chem. 1998; 273: 2624-2630Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Two genes were identified as suppressors for vti1–2. One was an uncharacterized ORF, the other was the R-SNARE YKT6, which we identified here as the R-SNARE in transport to the prevacuole and to the vacuole. We investigated the role of the amino acid residues in the 0 layer of Ykt6p and Vti1p. These SNARE complexes are nonfunctional with four glutamine residues and defective with two arginine and two glutamine residues in the 0 layer. Reagents were used from the following sources: enzymes for DNA manipulation from New England Biolabs (Beverly, MA), [35S]methionine from Amersham Pharmacia Biotech(Braunschweig, Germany), fixed Staphylococcus aureus cells (Pansorbin) from Calbiochem (San Diego, CA), and Zymolyase from Seikagaku (Tokyo, Japan). All other reagents were purchased from Sigma. Plasmid manipulations were performed in the Escherichia colistrains MC1061 or XL1Blue using standard media. Yeast strains (Table I) were grown in rich media (1% yeast extract, 1% peptone, 2% dextrose, YEPD) or standard minimal medium (SD) with appropriate supplements.Table IYeast strains used in this studyStrainGenotypeReferenceSEY6210MATα leu2–3,112 ura3–52 his3-Δ200 trp1-Δ901 lys2–801 suc2-Δ9 mel-(56Robinson J.S. Klionsky D.J. Banta L.M. Emr S.D. Mol. Cell. Biol. 1988; 8: 4936-4948Crossref PubMed Scopus (739) Google Scholar)SEY6211MATa leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 suc2-Δ9 mel-(56Robinson J.S. Klionsky D.J. Banta L.M. Emr S.D. Mol. Cell. Biol. 1988; 8: 4936-4948Crossref PubMed Scopus (739) Google Scholar)RPY10MATα ura3–52 leu2–3,112 his4–519 ade6 gal2(57Piper R.C. Whitters E.A. Stevens T.H. Eur. J. Cell Biol. 1994; 65: 305-318PubMed Google Scholar)FvMY7MATa leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 suc2-Δ9 mel- vti1–1(9Fischer von Mollard G. Nothwehr S.F. Stevens T.H. J. Cell Biol. 1997; 137: 1511-1524Crossref PubMed Scopus (175) Google Scholar)FvMY21MATa leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 suc2-Δ9 mel- vti1–11(24Fischer von Mollard G. Stevens T.H. J. Biol. Chem. 1998; 273: 2624-2630Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar)FvMY24MATa leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 suc2-Δ9 mel- vti1–2(20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar)FvMY22MATα ura3–52 leu2–3,112 his4–519 ade6 gal2 vti1–2(20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar)MDY1MATα leu2–3,112 ura3–52 his3-Δ200 trp1-Δ901 lys2–801 suc2-Δ9 mel- vts1Δ::HIS3This studyMDY4MATa leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 suc2-Δ9 mel- vti1–1 vts1Δ::HIS3This studyMDY5MATa leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 suc2-Δ9 mel- vti1–2 vts1Δ::HIS3This studyFvMY38MATa leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 suc2-Δ9 mel- vti1Q158RThis studyBKY6MATa/α leu2–3,112 ura3–52 his3-Δ200 ade2–101 trp1-Δ901 LYS2/lys2–801 suc2-Δ9 mel- VTI1/vti1Δ::HIS3 YKT6/ykt6Δ::URA3This study Open table in a new tab The growth defect of vti1–2cells at 37 °C was more pronounced in the genetic background of 9Dα cells than SEY6210 cells. To identify multicopy suppressors that allowed vti1–2 cells to grow faster at 37 °C, we transformed FvMY22 cells with a YEp24 2-μm library (25Carlson M. Botstein D. Cell. 1982; 28: 145-154Abstract Full Text PDF PubMed Scopus (926) Google Scholar). Plasmids were isolated from colonies that showed improved growth at 37 °C and retransformed into FvMY22 cells to confirm suppressor activity. To compare growth rates, cells were grown in YEPD to anA600 between 0.2 and 1.0. After dilution to 0.01 and 0.05 A600/ml, 10 μl were spotted onto YEPD plates and grown at the indicated temperature. Precise deletions of theVTS1 ORF were generated by PCR (amplification of HIS3 with oligonucleotides annealing to 40 nucleotides of the VTS1flanking region) in SEY6210, FvMY7, and FvMY24, resulting in the strains MDY1, MDY4, and MDY5 (Table I), respectively (26Baudin A. Ozier-Kalogeropoulos O. Denouel A. Lacroute F. Cullin C. Nucleic Acids Res. 1993; 21: 3329-3330Crossref PubMed Scopus (1127) Google Scholar). The same method was used to introduce theykt6Δ::URA3 mutation into SEY6211×FvMY6 diploid cells carrying a heterocygotevti1Δ::HIS3 mutation yielding BKY6. A 1.1-kb fragment coding for the YKT6 ORF was PCR-amplified using the oligonucleotides cgggatcctacttccagttggtaattg and ggaattcactgaagaaacaaatcaattct and cloned via BamHI andEcoRI sites into YEp352 (Ref. 27Hill J.E. Myers A.M. Koerner T.J. Tzagologg A. Yeast. 1986; 2: 163-167Crossref PubMed Scopus (1083) Google Scholar; pMD1, TableII) and pRS316 (Ref. 28Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar; pMD21). A 2.3-kbClaI-SpeI fragment encoding VTS1 was isolated from the suppressor plasmid pBK24 and subcloned into pBluescript. The fragment was cut out withKpnI-SpeI and cloned into YEp352 (pMD3) and pRS316 (pMD9). To introduce a N-terminal triple HA tag intoVTS1, a BamHI site was generated after the start codon by PCR-based site-directed mutagenesis (Ref. 29Weiner M.P. Felts K.A. Simcox T.G. Braman J.C. Gene (Amst.). 1993; 126: 35-41Crossref PubMed Scopus (20) Google Scholar; oligonucleotides ccaaaacatccgtatgaggaattc and atccatgatttctttgctgacaattac) and a 126-base pair BglII fragment encoding three copies of the HA epitope was ligated into the BamHI site (pMD8). pBK65 was constructed by PCR-based site-directed mutagenesis with the oligonucleotides cagaacattctcaatcgttttgtg and cagcaaggtgaaaagttggataatttg to generate the mutationykt6-R165Q and a silent PstI site in pMD1. The inserts of pMD1 and pBK65 were subcloned into YEp351 and pRS315 to obtain pBK99 (YKT6 in YEp351), pBK86 (ykt6-R165Q in YEp351), and pBK87 (ykt6-R165Q in pRS315). The mutation Q158R and a silent NruI site were introduced into theVTI1 encoding plasmid pFvM28 by PCR-based site-directed mutagenesis, using the oligonucleotides cgaccttaaatccatcattatttg and cgaagagaaactttggaaaatgcaag (pBK77). vti1-Q158R was subcloned into the integration vector pRS306, linearized, and integrated into SEY6211, and the wild-type VTI1 was looped out on 5-fluorourotic acid plates (30Boeke J.D. LaCroute F. Fink G.R. Mol. Gen. Genet. 1984; 197: 345-346Crossref PubMed Scopus (1712) Google Scholar) to construct FvMY38.Table IIPlasmids used in this studyPlasmidDescriptionReferencepBK244.4-kb Chrom XV (nt 1009767–1014198) containing VTS1 in YEp24This studypBK2511-kb Chrom XI (nt 69529–80400) containingYKT6 in YEp24This studypMD11.1-kbYKT6 in YEp352 (2μ-URA3)This studypMD211.1-kb YKT6 in pRS316 (CEN6-URA3)This studypMD32.3-kbClaI-SpeI with VTS1 in YEp352 (2μ-URA3)This studypMD8VTS1 with N-terminal 3×HA tag in pRS316 (CEN6-URA3)This studypMD92.3-kb ClaI-SpeI with VTS1in pRS316 (CEN6-URA3)This studypBK651.1-kbykt6-R165Q in YEp352 (2μ-URA3)This studypBK77vti1-Q158R in pRS314 (CEN6-TRP1)This studypBK861.1-kbykt6-R165Q in YEp351 (2μ-LEU2)This studypBK871.1-kb ykt6-R165Q in pRS315 (CEN6-LEU2)This studypBK991.1-kbYKT6 in YEp351 (2μ-LEU2)This study2μ-SLY2SEC22 in YEp13 (2μ-LEU2)(58Dascher C. Ossig R. Gallwitz D. Schmitt H.D. Mol. Cell. Biol. 1991; 11: 872-885Crossref PubMed Scopus (280) Google Scholar)2μ-SNC2myc-SNC2under control of CYC1 promoter in pRS323 (2μ-HIS3)(54Ossig R. Schmitt H.D. de Groot B. Riedel D. Keranen S. Ronne H. Grubmuller H. Jahn R. EMBO J. 2000; 19: 6000-6010Crossref PubMed Scopus (62) Google Scholar)Chrom, chromosome; nt, nucleotide(s). Open table in a new tab Chrom, chromosome; nt, nucleotide(s). CPY, ALP, and API were immunoprecipitated as described previously (20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar, 31Klionsky D.J. Cueva R. Yaver D.S. J. Cell Biol. 1992; 119: 287-299Crossref PubMed Scopus (307) Google Scholar, 32Vater C.A. Raymond C.K. Ekena K. Howald S., I. Stevens T.H. J. Cell Biol. 1992; 119: 773-786Crossref PubMed Scopus (170) Google Scholar, 33Nothwehr S.F. Roberts C.J. Stevens T.H. J. Cell Biol. 1993; 121: 1197-1209Crossref PubMed Scopus (117) Google Scholar). The CPY and ALP antisera were a generous gift from T. H. Stevens. The API antiserum was kindly provided by D. Klionsky. Immunoprecipitates were analyzed by SDS-PAGE and autoradiography. A BAS1000 (Fuji) was used for quantification. Subcellular fractionation was performed by differential centrifugation as described (34Paravicini G. Horazdovsky B.F. Emr S.D. Mol. Biol. Cell. 1992; 3: 415-427Crossref PubMed Scopus (83) Google Scholar).vts1Δ cells expressing HA-VTS1 from aCEN6 plasmid were spheroplasted, osmotically lysed, and centrifuged. Fractions were separated by SDS-PAGE, immunoblotted, and detected with horseradish peroxidase-conjugated secondary antibodies via ECL. The goal of this study was to identify genes that interact with VTI1 in transport from the Golgi to the prevacuolar compartment/late endosome or in transport to the vacuole. These transport steps are blocked invti1–2 cells at the non-permissive temperature, whereas transport to the Golgi is not affected (9Fischer von Mollard G. Nothwehr S.F. Stevens T.H. J. Cell Biol. 1997; 137: 1511-1524Crossref PubMed Scopus (175) Google Scholar, 20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar). vti1–2cells also display a growth defect at 37 °C, which we utilized for a multicopy (2 μm) suppressor screen. As expected, plasmids encoding for VTI1 or the endosomal Q-SNARE PEP12 (20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar) restored growth of vti1–2 cells at 37 °C. Two additional plasmids enhanced growth rates of vti1–2 cells at 37 °C (Fig. 1). One plasmid contained an 11-kb fragment of chromosome XI between nucleotides 69,529 and 80,400. The R-SNARE Ykt6p is encoded by this DNA fragment. YKT6interacts genetically with VTI1 in retrograde traffic to the cis-Golgi (10Lupashin V.V. Pokrovskaya I.D. McNew J.A. Waters M.G. Mol. Biol. Cell. 1997; 8: 2659-2676Crossref PubMed Scopus (92) Google Scholar). Ykt6p is also required for homotypic vacuolar fusion and can be immunoprecipitated with Vti1p (23Ungermann C. Fischer von Mollard G. Jensen O.N. Margolis N. Stevens T.H. Wickner W. J. Cell Biol. 1999; 145: 1435-1442Crossref PubMed Scopus (134) Google Scholar). A 1.1-kb fragment encoding only YKT6 was subcloned into a 2-μm and a centromeric vector to determine whether YKT6 is the suppressor. The growth defect of vti1–2 cells at 37 °C was suppressed by overexpression of YKT6 alone from either a centromeric plasmid (1–3 copies) or a 2-μm plasmid (10–20 copies/yeast cell; Fig. 1, top). These data indicate that a slight overexpression of YKT6 is sufficient for suppression of the growth defect. The second suppressing plasmid consisted of chromosome XV nucleotides 1,009,767 to 1,014,198. Two complete reading frames were identified within this fragment: HAP5, a component of a transcription factor; and the hypothetical open reading frame YOR359w. A 2.3-kb fragment encoding only YOR359w was subcloned into a 2-μm and a centromeric plasmid. Both plasmids improved growth ofvti1–2 cells at 37 °C (Fig. 1, bottom). YOR359w was also overexpressed in vti1–11 cells, which show a severe growth defect at 37 °C in addition to defects in transport to the cis-Golgi, to the prevacuole, and to the vacuole (9Fischer von Mollard G. Nothwehr S.F. Stevens T.H. J. Cell Biol. 1997; 137: 1511-1524Crossref PubMed Scopus (175) Google Scholar). The growth defect in vti1–11 cells was not suppressed by overexpression of YOR359w (data not shown), suggesting that the suppression by YOR359w is allele-specific and not due to a general bypass of VTI1 function. Therefore, YOR359w was namedVTS1 (vt i1–2 suppressor). VTS1 encodes a predicted protein of 523 amino acid residues without hydrophobic stretches typical for transmembrane domains. Data bank searches revealed only two proteins of similar length with an overall sequence homology in the yeastCandida albicans (28% amino acid identity, GenBank™ accession no. AL033497) and in the fission yeastSchizosaccharomyces pombe (24% amino acid identity, GenBank™ accession no. CAB89878). These proteins share a SAM (sterile α motif) at their C termini (see “Discussion”). To determine what trafficking step is suppressed, we examined the effect of overexpression ofVTS1 on protein traffic to the vacuole in vti1–2cells. CPY is transported from the Golgi first to the prevacuolar compartment and in a second transport step from there to the vacuole (6Bryant N.J. Stevens T.H. Microbiol. Mol. Biol. Rev. 1998; 62: 230-247Crossref PubMed Google Scholar, 14Conibear E. Stevens T.H. Biochim. Biophys. Acta. 1998; 1404: 211-230Crossref PubMed Scopus (152) Google Scholar). vti1–2 cells are blocked in both trafficking steps. vti1–2 cells and vti1–2 cells overexpressing VTS1 were grown at 24 °C, shifted to 32 °C for 15 min, pulsed with [35S]cysteine/methionine for 10 min, and chased in the presence of unlabeled cysteine/methionine for 30 min. Cells were spheroplasted, and CPY was immunoprecipitated. In vti1–2 cells as well as in vti1–2 cells overexpressing VTS1, CPY did not reach the vacuole, as indicated by the lack of mCPY within the cells (Fig.2 A, I fractions). Almost all CPY was secreted as the Golgi-modified form p2CPY (E). As CPY transport from the Golgi to the prevacuole is blocked in vti1–1 cells whereas traffic to the vacuole is not affected, vti1–1 cells were used to distinguish between these steps (9Fischer von Mollard G. Nothwehr S.F. Stevens T.H. J. Cell Biol. 1997; 137: 1511-1524Crossref PubMed Scopus (175) Google Scholar, 20Fischer von Mollard G. Stevens T.H. Mol. Biol. Cell. 1999; 10: 1719-1732Crossref PubMed Scopus (135) Google Scholar). Overexpression ofVTS1 in vti1–1 cells did not suppress the defect in CPY transport from the Golgi to the prevacuole (data not shown). ALP is transported from the Golgi to the vacuole without passing through the prevacuole (6Bryant N.J. Stevens T.H. Microbiol. Mol. Biol. Rev. 1998; 62: 230-247Crossref PubMed Google Scholar, 14Conibear E. Stevens T.H. Biochim. Biophys. Acta. 1998; 1404: 211-230Crossref PubMed Scopus (152) Google Scholar). ALP traffic was investigated invti1–2 cells using similar pulse-chase experiments at 36 °C (Fig. 2 C). In wild-type cells, 95% mALP are typical after a 30-min chase (data not shown), whereas, invti1–2 cells, an average of 47% mALP (S.D. 4.1) was detected. Overexpression of VTS1 either from the 2-μm library plasmid or from the 2-μm VTS1 plasmid improved ALP traffic to the vacuole considerably, as indicated by the rise in vacuolar mALP to an average of 76.8% (S.D. 3.1) and 70.5% (S.D. 1.8;n = 3), respectively. A slight overexpression ofVTS1 due to the presence of a centromeric plasmid in addition to the genomic copy of VTS1 suppressed the ALP sorting defect slightly (average of 62%, S.D. 8). API does not enter the secretory pathway but is synthesized in the cytosol and packaged into CVT vesicles surrounded by double membranes in a trafficking pathway related to autophagy (15Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-32Crossref PubMed Scopus (391) Google Scholar). API was immunoprecipitated after a 10-min pulse and a 120-min chase at 37 °C (Fig. 2 B). Overexpression of VTS1 from either a 2-μm or a centromeric plasmid partially suppressed the API sorting defect invti1–2 cells (vti1–2 25.5% mAPI, S.D. 9.3;vti1–2 2-μm VTS1 54.8%, S.D. 8.8;vti1–2 CEN VTS1 52.9%, S.D. 7.4; n = 3). These data indicate that VTS1 genetically interacts withVTI1 in traffic to the vacuole but not in traffic from the Golgi to the prevacuole. Next we wanted to determine the consequences of a lack of Vts1p.VTS1 was deleted in wild type, vti1–1, andvti1–2 cells. vts1Δ cells did not display defects in traffic of CPY, ALP, or API to the vacuole (data not shown). Defects in CPY, ALP, and API transport were identical invti1–2 and vti1–2 vts1Δ and invti1–1 and vti1–1 vts1Δ cells, respectively, indicating a lack of a synthetic defect in protein transport (data not shown). Neither vts1Δ nor vti1–1 vts1Δ cells displayed a growth defect at 24 °C or 37 °C (Fig.3). vti1–2 and vti1–2 vts1Δ cells grew with similar rates at 24 °C. At 37 °Cvti1–2 cells grew slowly, whereas vti1–2 vts1Δ cells did not grow at all. These data indicate thatvti1–2 and vts1Δ have a synthetic growth defect at high temperature as an additional genetic interaction. To study the subcellular localization of Vts1p, three copies of the influenza HA tag were introduced at the N terminus of theVTS1 open reading frame. HA-Vts1p was functional because production of HA-Vts1p in vti1–2 vts1Δ cells restored slow growth at 37 °C (data not shown). HA-Vts1p was found exclusively in the supernatant of a 200,000 × gcentrifugation during subcellular fractionation and was not found on membranes in immunofluorescence experiments (data not shown). These data indicate Vts1p is not associated with membranes under normal conditions. Next we investigated whether Vti1p and HA-Vts1p interact physically. As Vti1p is a membrane protein, binding between both proteins could be transient at most or involve only a small amount of Vts1p. HA-Vts1p and Vti1p did not co-immunoprecipitate. Furthermore, they could not be chemically cross-linked (data not shown). In vitro binding assays using recombinant GST-Vti1p and 6-His-Vts1p fusion proteins and vice versa did not reveal a specific interaction between both proteins (data not shown). In conclusion, we found genetic interactions between VTS1and vti1–2. This suppression affected transport to the vacuole, was specific for a certain allele of vti1, and therefore was not due to a general effect of VTS1overexpression. We could not detect biochemical interactions between Vts1p and Vti1p. The mechanism of the genetic interaction betweenVTI1 and VTS1 remains to be elucidated. After identifyingYKT6 as a multicopy suppressor of the growth defect invti1–2 cells, we investigated whether YKT6overexpression affected different trafficking steps. API transport was followed in vti1–2 cells and vti1–2 cells in which YKT6 was overexpressed from either a centromeric or a 2-μm plasmid (Fig. 4 A). Overexpression of YKT6 increased the proportion of vacuolar mAPI from 20.9% (S.D. 6.4) to 54.1% (S.D. 0.8) for vti1–2cells with the 2-μm plasmid encoding only YKT6 and to 65.1% (S.D. 0.9) with the 11-kb genomic 2-μm plasmid encodingYKT6 (data not shown). A slight overexpression ofYKT6 from a centromeric plasmid resulting in intermediate amounts of mAPI. ALP transport was investigated in the same strains (Fig. 4 B). Overproduction of Ykt6p from the 2-μm plasmid resulted reproducibly in an improved delivery of ALP to the vacuole, as indicated by increased amounts of mALP after a 30-min chase period. The amount of mALP detected in vti1–2 cells varied between experiments with an average of 38.6%. In vti1–2 2-μmYKT6 cells, an average of 57.9% mALP was found, an increase by 21.3 percentage points (S.D. 4.1; n = 6). The ALP transport defect was also suppressed by the 11-kb genomic 2-μm plasmid encoding YKT6 (increase by 23.1 percentage points, S.D. 4.9, data not shown). A slight overexpression of YKT6using a centromeric plasmid improved ALP transport to the vacuole somewhat. Next we determined whether this effect is specific for Ykt6p or whether other R-SNAREs can function in this transport step. Snc2p (required for exocytosis and endocytosis; Refs. 36Rossi G. Salminen A. Rice L. Brunger A. Brennwald P. J. Biol. Chem. 1997; 272: 16610-16617Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar and 49Gurunathan S. Chapman-Shimshoni D. Trajkovic S. Gerst J.E. Mol. Biol. Cell. 2000; 11: 3629-3643Crossref PubMed Scopus (57) Google Scholar) and Sec22p (involved in traffic between ER and Golgi; Ref. 43Søgaard M. Tani K. Ye R.R. Geromanos S. Temp

Referência(s)