TALE Homeodomain Proteins Regulate Gonadotropin-releasing Hormone Gene Expression Independently and via Interactions with Oct-1
2004; Elsevier BV; Volume: 279; Issue: 29 Linguagem: Inglês
10.1074/jbc.m402960200
ISSN1083-351X
AutoresNaama Rave-Harel, Marjory L. Givens, Shelley B. Nelson, Hao A. Duong, Djurdjica Coss, Melody E. Clark, Sara B. Hall, Mark P. Kamps, Pamela L. Mellon,
Tópico(s)Genetic and Clinical Aspects of Sex Determination and Chromosomal Abnormalities
ResumoGonadotropin-releasing hormone (GnRH) is the central regulator of reproductive function. Expression of the GnRH gene is confined to a rare population of neurons scattered throughout the hypothalamus. Restricted expression of the rat GnRH gene is driven by a multicomponent enhancer and an evolutionarily conserved promoter. Oct-1, a ubiquitous POU homeodomain transcription factor, was identified as an essential factor regulating GnRH transcription in the GT1-7 hypothalamic neuronal cell line. In this study, we conducted a two-hybrid interaction screen in yeast using a GT1-7 cDNA library to search for specific Oct-1 cofactors. Using this approach, we isolated Pbx1b, a TALE homeodomain transcription factor that specifically associates with Oct-1. We show that heterodimers containing Pbx/Prep1 or Pbx/Meis1 TALE homeodomain proteins bind to four functional elements within the GnRH regulatory region, each in close proximity to an Oct-1-binding site. Cotransfection experiments indicate that TALE proteins are essential for GnRH promoter activity in the GT1-7 cells. Moreover, Pbx1 and Oct-1, as well as Prep1 and Oct-1, form functional complexes that enhance GnRH gene expression. Finally, Pbx1 is expressed in GnRH neurons in embryonic as well as mature mice, suggesting that the associations between TALE homeodomain proteins and Oct-1 regulate neuron-specific expression of the GnRH gene in vivo. Gonadotropin-releasing hormone (GnRH) is the central regulator of reproductive function. Expression of the GnRH gene is confined to a rare population of neurons scattered throughout the hypothalamus. Restricted expression of the rat GnRH gene is driven by a multicomponent enhancer and an evolutionarily conserved promoter. Oct-1, a ubiquitous POU homeodomain transcription factor, was identified as an essential factor regulating GnRH transcription in the GT1-7 hypothalamic neuronal cell line. In this study, we conducted a two-hybrid interaction screen in yeast using a GT1-7 cDNA library to search for specific Oct-1 cofactors. Using this approach, we isolated Pbx1b, a TALE homeodomain transcription factor that specifically associates with Oct-1. We show that heterodimers containing Pbx/Prep1 or Pbx/Meis1 TALE homeodomain proteins bind to four functional elements within the GnRH regulatory region, each in close proximity to an Oct-1-binding site. Cotransfection experiments indicate that TALE proteins are essential for GnRH promoter activity in the GT1-7 cells. Moreover, Pbx1 and Oct-1, as well as Prep1 and Oct-1, form functional complexes that enhance GnRH gene expression. Finally, Pbx1 is expressed in GnRH neurons in embryonic as well as mature mice, suggesting that the associations between TALE homeodomain proteins and Oct-1 regulate neuron-specific expression of the GnRH gene in vivo. Tissue-specific gene expression can be mediated, in the simplest case, by a transcription factor restricted to a particular cell type. Usually, however, tissue-specific expression is achieved through unique combinations of DNA elements binding more broadly expressed proteins. This type of transcriptional regulation, termed combinatorial control, provides an efficient mechanism integrating responses to a variety of signals using a relatively limited number of proteins (1Wolberger C. Curr. Opin. Genet. Dev. 1998; 8: 552-559Crossref PubMed Scopus (47) Google Scholar). We investigated the mechanisms underlying neuron-specific transcription of the gonadotropin-releasing hormone (GnRH) 1The abbreviations used are: GnRH, gonadotropin-releasing hormone; EMSA, electrophoretic mobility shift assay; GST, glutathione S-transferase; dnPrep1, dominant-negative Prep1; GnRHe, GnRH enhancer; RSVp, Rous sarcoma virus promoter; DAB, 3,3′-diaminobenzidine; dpc, days postcoitus; GnRHp, GnRH promoter; X-gal, 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside. gene. GnRH is the decapeptide hormone that regulates secretion of the pituitary gonadotropins, luteinizing hormone, and follicle-stimulating hormone, thereby mediating central nervous system control of reproductive function (2Vale W. Rivier C. Brown M. Annu. Rev. Physiol. 1977; 39: 473-527Crossref PubMed Scopus (270) Google Scholar). The GnRH-secreting neurons are a small population of highly specialized cells dispersed throughout the hypothalamus that release GnRH in a pulsatile manner. We have previously developed an immortalized cultured cell model system for GnRH neurons, the GT1-7 cell line, by targeted oncogenesis (3Mellon P.L. Windle J.J. Goldsmith P. Pedula C. Roberts J. Weiner R.I. Neuron. 1990; 5: 1-10Abstract Full Text PDF PubMed Scopus (898) Google Scholar). These cells are hypothalamic neurons that secrete GnRH and therefore provide an appropriate model for defining the molecular mechanisms for neuron-specific gene expression. Previously, we established that neuron-specific activation of the rat GnRH gene is conferred, in culture and in vivo, by two upstream regulatory elements: an enhancer (–1863 to –1571) and an evolutionarily conserved promoter (–173 to +1) (4Eraly S.A. Mellon P.L. Mol. Endocrinol. 1995; 9: 848-859Crossref PubMed Google Scholar, 5Whyte D.B. Lawson M.A. Belsham D.D. Eraly S.A. Bond C.T. Adelman J.P. Mellon P.L. Mol. Endocrinol. 1995; 9: 467-477Crossref PubMed Google Scholar, 6Lawson M.A. MacConell L.A. Kim J. Powl B.T. Nelson S.B. Mellon P.L. Endocrinology. 2002; 143: 1404-1412Crossref PubMed Scopus (40) Google Scholar). Within these sequences is a complex arrangement of binding sites for trans-acting factors that potentiate transcription. However, single binding elements are not sufficient to confer GT1-7 cell-specific expression to reporter genes in transient transfection assays, demonstrating that coordinate action from multiple elements is required for GnRH transcription. Several factors have been shown to regulate GnRH cell-specific transcription, including the homeodomain proteins Oct-1 (7Clark M.E. Mellon P.L. Mol. Cell. Biol. 1995; 15: 6169-6177Crossref PubMed Scopus (122) Google Scholar), SCIP/Oct-6 (8Wierman M.E. Xiong X. Kepa J.K. Spaulding A.J. Jacobsen B.M. Fang Z. Nilaver G. Ojeda S.R. Mol. Cell. Biol. 1997; 17: 1652-1665Crossref PubMed Scopus (46) Google Scholar), Brn2 (9Wolfe A. Kim H.H. Tobet S. Stafford D.E. Radovick S. Mol. Endocrinol. 2002; 16: 435-449Crossref PubMed Scopus (39) Google Scholar), Dlx2 and Msx1, 2M. L. Givens, N. Rave-Harel, V. O. Goonewardena, R. Kurotani, C. H. Swan, J. L. R. Rubenstein, B. Robert, and P. L. Mellon, submitted for publication. and Otx2 (10Kelley C.G. Lavorgna G. Clark M.E. Boncinelli E. Mellon P.L. Mol. Endocrinol. 2000; 14: 1246-1256Crossref PubMed Scopus (64) Google Scholar); the zinc finger protein GATA-4 (11Lawson M.A. Whyte D.B. Mellon P.L. Mol. Cell. Biol. 1996; 16: 3596-3605Crossref PubMed Scopus (73) Google Scholar); nuclear factor-1 3M. L. Givens, R. Kurotani, N. Rave-Harel, N. L. G. Miller, and P. L. Mellon, submitted for publication.; and CCAAT/enhancer-binding protein-β (12Belsham D.D. Mellon P.L. Mol. Endocrinol. 2000; 14: 212-228PubMed Google Scholar). In particular, the POU homeodomain protein Oct-1 was identified as an essential factor regulating basal and hormone-induced transcription of the GnRH gene (7Clark M.E. Mellon P.L. Mol. Cell. Biol. 1995; 15: 6169-6177Crossref PubMed Scopus (122) Google Scholar, 9Wolfe A. Kim H.H. Tobet S. Stafford D.E. Radovick S. Mol. Endocrinol. 2002; 16: 435-449Crossref PubMed Scopus (39) Google Scholar, 12Belsham D.D. Mellon P.L. Mol. Endocrinol. 2000; 14: 212-228PubMed Google Scholar, 13Chandran U.R. Warren B.S. Baumann C.T. Hager G.L. DeFranco D.B. J. Biol. Chem. 1999; 274: 2372-2378Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Oct-1 binds to five elements within the rat GnRH regulatory region and is necessary for enhancer activity in GT1-7 cells (7Clark M.E. Mellon P.L. Mol. Cell. Biol. 1995; 15: 6169-6177Crossref PubMed Scopus (122) Google Scholar). Mutation of the Oct-1 site at –1781 to –1774, within the enhancer, decreases basal transcription to 5% (5Whyte D.B. Lawson M.A. Belsham D.D. Eraly S.A. Bond C.T. Adelman J.P. Mellon P.L. Mol. Endocrinol. 1995; 9: 467-477Crossref PubMed Google Scholar). Thus, Oct-1 plays a critical role in GnRH gene expression. A paradox that remains to be explained, however, is that Oct-1 and the other GnRH regulatory proteins identified thus far have been detected in a variety of cell types, whereas the GnRH gene is expressed only in hypothalamic GnRH neurons and the cell line representing them, GT1-7. A possible explanation is that GT1-7 cells may contain a neuron-specific Oct-1 coactivator. Oct-1 is not known to be a strong transcriptional activator by itself; however, in conjunction with coactivators, it can promote potent tissue-specific transactivation of target genes (14Strubin M. Newell J.W. Matthias P. Cell. 1995; 80: 497-506Abstract Full Text PDF PubMed Scopus (351) Google Scholar, 15Gstaiger M. Knoepfel L. Georgiev O. Schaffner W. Hovens C.M. Nature. 1995; 373: 360-362Crossref PubMed Scopus (285) Google Scholar). Alternatively, Oct-1 may interact with other DNA-binding proteins that are neuron-specific (16Voss J.W. Wilson L. Rosenfeld M.G. Genes Dev. 1991; 5: 1309-1320Crossref PubMed Scopus (172) Google Scholar). In this study, we used a two-hybrid interaction screen in yeast to search for Oct-1 cofactors in GT1-7 cells. This approach led us to the isolation of the TALE homeodomain transcription factor Pbx1b. We show that TALE homeodomain proteins specifically associate with Oct-1. Furthermore, we demonstrate a role for this interaction in the activation of GnRH gene expression. The findings in GT1-7 cells are likely relevant to the regulation of GnRH expression in vivo since Pbx1 is expressed in embryonic as well as mature GnRH neurons in mice. Two-hybrid Interaction Screen in Yeast—To isolate cDNAs encoding GT1-7 proteins that associate with Oct-1, we first created a randomly primed GT1-7 cDNA library (using poly(A+) mRNA) fused C-terminally to the transactivation domain of the VP16 protein. The yeast strains and expression vectors were the generous gifts of Dr. Michel Strubin and have been described previously (14Strubin M. Newell J.W. Matthias P. Cell. 1995; 80: 497-506Abstract Full Text PDF PubMed Scopus (351) Google Scholar). In this library vector, the hybrid proteins are expressed in yeast from a centromeric TRP1 plasmid under the control of a galactose-inducible promoter. The yeast tester strain also contains a centromeric bait plasmid carrying the URA3 gene and the human Oct-1 cDNA. A chromosomal copy of the selectable marker, the HIS3 gene, under the control of six copies of the octamer motif serves as the genomic target for Oct-1. The GT1-7 cDNA library (3 × 106 primary transformants) was introduced into the reporter strain using the method of Schiestl and Gietz (17Schiestl R.H. Gietz R.D. Curr. Genet. 1989; 16: 339-346Crossref PubMed Scopus (1773) Google Scholar), except that the lithium acetate solution contained 1 m sorbitol and that sheared herring testis DNA (10 mg/ml) (Clontech) was used as carrier DNA. After induction of the library proteins, cells were plated on synthetic galactose medium lacking histidine and containing 10 mm 3-aminotriazole and incubated for 10 days. Eighty-nine URA+/TRP+ 3-aminotriazole-resistant colonies were plated on medium containing 5-fluoroorotic acid to select against cells expressing Oct-1 from the URA3 plasmid. Seven URA–/TRP+ colonies that lost their ability to grow on 3-aminotriazole when their Oct-1 plasmid was removed were recovered from the yeast using the method of Robzyk and Kassir (18Robzyk K. Kassir Y. Nucleic Acids Res. 1992; 20: 3790Crossref PubMed Scopus (173) Google Scholar). The DNA sequences of the 22 library plasmids recovered from these colonies were determined by the chain termination method (19Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52653) Google Scholar). Oligonucleotides—The double-stranded consensus oligonucleotides used in the electrophoretic mobility shift assay (EMSA) analysis included the Oct-1 consensus oligonucleotide (TGTCGAATGCAAATCACTAGAA, top strand) (7Clark M.E. Mellon P.L. Mol. Cell. Biol. 1995; 15: 6169-6177Crossref PubMed Scopus (122) Google Scholar), the PBX oligonucleotide (AGCGCGGGGCGCATCAATCAATTTCG, top strand), and the PBX-mut oligonucleotide (AGCGCGGGGCGCATCAATTAATTTCG, top strand) (20Lu Q. Knoepfler P.S. Scheele J. Wright D.D. Kamps M.P. Mol. Cell. Biol. 1995; 15: 3786-3795Crossref PubMed Scopus (136) Google Scholar). The sequences of the GnRH oligonucleotides are shown in Fig. 3. The top and bottom strands of the –75 oligonucleotide correspond to GnRH sequences –109 to –94 and –104 to –89, respectively. All oligonucleotides were synthesized by Operon Technologies, Inc. EMSA—Nuclear extracts were prepared according to the method described by Schreiber et al. (21Schreiber E. Merchant R.E. Wiestler O.D. Fontana A. Neurosurgery (Baltimore). 1994; 34: 129-135Crossref PubMed Scopus (25) Google Scholar). Annealed wild-type and mutant oligonucleotides (20 ng or 1 pmol) containing sequences of the GnRH enhancer or promoter or consensus sequences were phosphorylated with [γ-32P]dATP (6000 Ci/mmol; PerkinElmer Life Sciences) and polynucleotide kinase or filled in with [α-32P]dATP (3000 Ci/mmol; PerkinElmer Life Sciences) and Klenow fragment using standard procedures (22Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1987Google Scholar). Probes were phenol/chloroform-extracted and passed over Sephadex G-25 micro-columns (Amersham Biosciences), and radioactivity was counted with a scintillation counter. Probes were diluted in 50 mm NaCl. Binding reactions were carried out under conditions described previously (7Clark M.E. Mellon P.L. Mol. Cell. Biol. 1995; 15: 6169-6177Crossref PubMed Scopus (122) Google Scholar). Each probe (1 fmol) was incubated with 2 μg of GT1-7 crude nuclear extract in 20-μl reactions. Reactions were incubated at room temperature for 5 min and separated on 5% polyacrylamide gel in 0.25× Tris borate/EDTA as described previously (7Clark M.E. Mellon P.L. Mol. Cell. Biol. 1995; 15: 6169-6177Crossref PubMed Scopus (122) Google Scholar). Competitions were performed by preincubating the reactions with a 100–200-fold excess of unlabeled oligonucleotide for 5 min on ice prior to adding the probe. Supershift assays were performed by adding 1 μl of antibody or rabbit IgG control to the complete reaction and then incubating as described above. The antibodies used were from Santa Cruz Biotechnology, Inc., except anti-Meis1 antibody (a generous gift of Dr. Michael L. Cleary) and the antibody directed against all Pbx forms (21Schreiber E. Merchant R.E. Wiestler O.D. Fontana A. Neurosurgery (Baltimore). 1994; 34: 129-135Crossref PubMed Scopus (25) Google Scholar). Gels were run at 250 V for 2 h and then dried under a vacuum and exposed to film for 1–3 days. Chromatin Immunoprecipitation—Chromatin immunoprecipitation assays were performed as described previously (23Coss D. Jacobs S.B. Bender C.E. Mellon P.L. J. Biol. Chem. 2004; 279: 152-162Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar), with a few modifications. Chromatin from GT1-7 or LβT2 cells was cross-linked for 10 min using formaldehyde. The resulting chromatin solution was precipitated with Pbx1, Prep1, and Oct-1 polyclonal antibodies. The following day, chromatin·antibody complexes were isolated from the solution by incubation with 50 μl of protein A-Sepharose beads (50% slurry, pre-blocked with 100 μg/ml sonicated Escherichia coli DNA and 1 mg/ml bovine serum albumin) while being rocked at 4 °C for 2 h. The beads were harvested and washed as described previously (23Coss D. Jacobs S.B. Bender C.E. Mellon P.L. J. Biol. Chem. 2004; 279: 152-162Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). Cross-linking was reversed by addition of NaCl to a final concentration of 300 mm and incubation overnight at 65 °C. Chromatin·antibody complexes were eluted from the Sepharose beads by addition of 10% SDS and proteinase K and subsequent incubation at 37 °C. The DNA was extracted with phenol/chloroform, precipitated with ethanol, and dissolved in Tris/EDTA. Immunoprecipitated DNA was analyzed for the GnRH promoter sequence by PCR. Protein Production and GST Retention Assay—Expression vectors used for protein production included full-length human Oct-1 and the POU domain of Oct-1 in the pCR2.1 vector and the human Prep1, Meis1, and Pbx cDNAs (including various deletions) in pGEM vectors. In vitro transcription and translation were performed with the Promega TnT coupled reticulocyte lysate system following the manufacturer's protocol, employing SP6, T7, or T3 polymerase. [35S]Methionine was used for labeling the protein products. Translation mixture without DNA was used as a control for unprogrammed translation in the reticulocyte lysate. GST-Oct-1 was created by cloning the human Oct-1 cDNA into the pGEX-4T1 vector. Bacteria transformed with the pGEX vectors were grown to an absorbance of 0.5 and then induced overnight with 0.2 mm isopropyl-β-d-thiogalactopyranoside. Bacterial pellets were sonicated in 0.1% Triton X-100 and 5 mm EDTA in 1× phosphate-buffered saline and centrifuged, and the supernatant was bound to glutathione-Sepharose 4B resin (Amersham Biosciences). The interaction assay was performed as described previously (24González-Crespo S. Morata G. Development (Camb.). 1995; 121: 2117-2125PubMed Google Scholar). Samples were separated using a 10% SDS gel, after which the gel was fixed, soaked in Amplify (Amersham Biosciences), dried, and exposed to Eastman Kodak X-BioMax film at –80 °C or to a PhosphorImager (Bio-Rad) at room temperature. Cell Culture and Transfection—All cells were grown in monolayer culture in Dulbecco's modified Eagle's medium containing 10% fetal calf serum, 100 units/ml penicillin, 0.1 mg/ml streptomycin, and 4.5 mg/ml glucose in a 5% CO2 atmosphere. Cells were transfected with FuGENE 6 (Roche Applied Science) in 24-well multidishes. GT1-7 cells from only passages 5–10 were used for the transactivation experiments. The expression plasmids used for cotransfections included human dominant-negative Prep1 (dnPrep1) in a pCMV vector; human Oct-1 Prep1, Pbx1b, and Meis1 in pcDNA1.1 vectors; and the negative control vectors pCMV and pcDNA1.1. The reporter plasmids contained the GnRH enhancer (GnRHe; –1863 to –1571) fused to the Rous sarcoma virus promoter (RSVp) (GnRHe-RSVp) and GnRHe-RSVp containing a TGAATGATAG → TGAATctTAG mutation in the –1749 Pbx/Prep1-binding site, each in a pGL3 vector driving luciferase expression. GT1-7 cells were transfected with 100 ng of expression plasmid, 400 ng of reporter plasmid, and 200 ng of internal control (herpes simplex virus thymidine kinase –109 promoter on β-galactosidase). Cells were harvested 48 h after transfection, lysed, and assayed for luciferase and β-galactosidase expression as described previously (25Delegeane A.M. Ferland L.H. Mellon P.L. Mol. Cell. Biol. 1987; 7: 3994-4002Crossref PubMed Scopus (283) Google Scholar). In Situ Hybridization and Immunohistochemistry—Adult mice were perfused with Zamboni's fixative (4% paraformaldehyde and 0.1 m sodium phosphate (pH 7.4)) as described in detail previously (26Simmons D.M. Voss J.W. Ingraham H.A. Holloway J.M. Broide R.S. Rosenfeld M.G. Swanson L.W. Genes Dev. 1990; 4: 695-711Crossref PubMed Scopus (566) Google Scholar). Their brains were removed and post-fixed overnight. The forebrains and midbrains were then sliced coronally on a microtome in 30-μm sections and stored in potassium phosphate-buffered saline. One series of sections was incubated with anti-Pbx1 antibody at 1:1000 dilution and subsequently underwent a nickel reaction. Next, the sections were incubated with anti-GnRH antibody (LR1; a gift of R. Benoit) and subsequently underwent a 3,3′-diaminobenzidine (DAB) reaction (peroxidase substrate kit, Vector Laboratories). Sections were mounted, dried, cover-slipped with synthetic distyrene plasticizer xylene resin (DPX; Electron Microscopy Sciences), and visualized by light microscopy. These sections identify Pbx1 by black staining and GnRH by brown staining. Mouse embryos were removed at 13.5 days postcoitus (dpc) and embedded in optimal cutting temperature medium (OCT; VWR Scientific) or paraffin-embedded and sectioned at 7–10 μm thickness. The series of frozen sliced embryo sections carrying rat GnRHe-GnRHp driving the β-galactosidase transgene (6Lawson M.A. MacConell L.A. Kim J. Powl B.T. Nelson S.B. Mellon P.L. Endocrinology. 2002; 143: 1404-1412Crossref PubMed Scopus (40) Google Scholar) was subjected to X-gal reaction (1 mg/ml X-gal dissolved in Me2SO, 1× phosphate-buffered saline, 4 mm ferrocyanide, 4 mm ferricyanide, and 2 mm MgCl2) and incubated with anti-Pbx1 antibody and DAB as described above. These sections identify Pbx1 by brown staining and β-galactosidase by blue staining. Paraffin-embedded wild-type embryos were deparaffinized with xylene washes, hydrated in ethanol/water solutions, and digested with proteinase K for 7 min at 37 °C, followed by post-fixation in 10% neutral buffered formalin for 20 min at room temperature. The sections were washed with 1× phosphate-buffered saline and 2× SSC for 5 min and then hybridized with digoxigenin-labeled sense and antisense probes for Pbx1 or Oct-1. The digoxigenin-labeled probes were added to a slide at a dilution of 1:1000 in hybridization buffer (150 μl/section; 50% formamide, 10% dextran sulfate, 1 mg/ml yeast RNA, 50 × Denhardt's, 200 mm sodium chloride, 1 mm Tris base, 9 mm Tris hydrochloride, 5 mm sodium phosphate, 2.5 mm EDTA, in diethyl pyrocarbonate-treated water) and incubated overnight at 65 °C. Sections were washed four times at 65 °C with 50% formamide, 1× SSC, and 0.1% Tween 20 and then twice at room temperature with 100 mm maleic acid, 150 mm NaCl, and 0.1% Tween. The slides were blocked with 5% normal goat serum and 0.1% Tween 20 for 3–4 h. The hybridized digoxigenin-labeled probe was detected using alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche Applied Science) at a dilution of 1:2000 and visualized with the chromogen combination 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium chloride. Antisense and sense probes were created by incubating 1 μg of linearized plasmid DNA with 10× digoxigenin RNA labeling mixture (Roche Applied Science) as well as 5× transcription buffer (Promega) and T7, T3, or SP6 RNA polymerase for 2 h at 37 °C. The Homeodomain Protein Pbx1b Interacts with Oct-1 in a Yeast Two-hybrid Screen—To understand the mechanism by which the ubiquitous transcription factor Oct-1 specifies GnRH expression, we searched for Oct-1 cofactors expressed in the GT1-7 cell line. For this purpose, we created a GT1-7 cDNA library with a C-terminal fusion to the VP16 transactivation domain for use in a yeast two-hybrid system developed especially to screen for Oct-1-interacting proteins, which led to the isolation of the B-cell-specific transcriptional coactivator OBF-1/Bob-1 (14Strubin M. Newell J.W. Matthias P. Cell. 1995; 80: 497-506Abstract Full Text PDF PubMed Scopus (351) Google Scholar). One of the cDNAs, isolated by this method, encoded a known transcription factor, mouse Pbx1b. Pbx1b belongs to the PBC subclass of the TALE (three-amino acid loop extension) homeodomain proteins. The mammalian Pbx family is composed of Pbx1a, Pbx1b, Pbx2, Pbx3a, and Pbx3b (Pbx1b and Pbx3b are alternatively spliced short forms) (27Mann R.S. Chan S.K. Trends Genet. 1996; 12: 258-262Abstract Full Text PDF PubMed Scopus (394) Google Scholar). These proteins have been shown to regulate gene expression through cooperative interaction with other DNA-binding proteins such as Hox (27Mann R.S. Chan S.K. Trends Genet. 1996; 12: 258-262Abstract Full Text PDF PubMed Scopus (394) Google Scholar) and with the TALE homeodomain proteins Meis (28Chang C.P. Jacobs Y. Nakamura T. Jenkins N.A. Copeland N.G. Cleary M.L. Mol. Cell. Biol. 1997; 17: 5679-5687Crossref PubMed Scopus (211) Google Scholar) and Prep (29Berthelsen J. Zappavigna V. Mavilio F. Blasi F. EMBO J. 1998; 17: 1423-1433Crossref PubMed Scopus (150) Google Scholar). Therefore, we considered Pbx1b a suitable candidate for an Oct-1-interacting protein. Multiple TALE Homeodomain Proteins Are Expressed in GT1-7 Cells—The Pbx proteins are expressed in many tissues and cell lines (30Monica K. Galili N. Nourse J. Saltman D. Cleary M.L. Mol. Cell. Biol. 1991; 11: 6149-6157Crossref PubMed Scopus (260) Google Scholar). Having identified Pbx1b in our yeast two-hybrid screen, we next examined which Pbx family members are expressed in our model cell line, the GT1-7 cells. The presence of Pbx mRNAs and proteins was determined in several cell lines and tissues by Northern and Western blot analyses. These analyses revealed that both variants of Pbx1 mRNAs were expressed in GT1-7 cells (data not shown). We further observed, using a series of Pbx-specific antibodies, that the Pbx1b protein was abundant in GT1-7 nuclear extracts compared with the other Pbx family members (Pbx1a, Pbx2, and Pbx3a) and with Pbx1b expression in mouse hypothalamus and the mouse fibroblast cell line NIH3T3 (Fig. 1A). The EL4 cell line served as a negative control for Pbx1b expression (30Monica K. Galili N. Nourse J. Saltman D. Cleary M.L. Mol. Cell. Biol. 1991; 11: 6149-6157Crossref PubMed Scopus (260) Google Scholar). Since Pbx transcriptional activity has been shown to be dependent on cooperative interaction with other TALE homeodomain proteins, Meis (28Chang C.P. Jacobs Y. Nakamura T. Jenkins N.A. Copeland N.G. Cleary M.L. Mol. Cell. Biol. 1997; 17: 5679-5687Crossref PubMed Scopus (211) Google Scholar, 31Knoepfler P.S. Calvo K.R. Chen H. Antonarakis S.E. Kamps M.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14553-14558Crossref PubMed Scopus (168) Google Scholar) and Prep (Pknox) (29Berthelsen J. Zappavigna V. Mavilio F. Blasi F. EMBO J. 1998; 17: 1423-1433Crossref PubMed Scopus (150) Google Scholar, 31Knoepfler P.S. Calvo K.R. Chen H. Antonarakis S.E. Kamps M.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14553-14558Crossref PubMed Scopus (168) Google Scholar), we investigated the presence of these Pbx partners in GT1-7 cells. Western blot analysis with specific antibodies showed that the Prep1 and Meis1 proteins were highly expressed in GT1-7 nuclear extracts compared with their expression in other cell lines (Fig. 1B). Thus, in addition to confirming the presence of Pbx proteins, two other TALE homeodomain proteins, Meis and Prep, were also detected in our cell model for GnRH neurons. These data suggest that TALE proteins (in particular, Pbx1b) are available for complex formation with Oct-1 in GT1-7 cells. Pbx1 and Prep1 Proteins Form Complexes with Oct-1 in Vitro —The isolation of Pbx1b in a yeast two-hybrid screen for Oct-1-interacting protein suggests that Pbx1 forms a protein complex with Oct-1 independent of DNA binding. To verify this interaction, as well as to explore a potential interaction between Oct-1 and the Pbx1 partner Prep1, a pull-down approach was utilized with GST fusion proteins (Fig. 1C). Bacterial extracts expressing GST-Oct-1 or GST were mixed with glutathione-Sepharose beads. The beads with absorbed fusion protein were subsequently incubated with in vitro translated 35S-labeled proteins. As expected, according to the demonstrated interactions between POU domain proteins (16Voss J.W. Wilson L. Rosenfeld M.G. Genes Dev. 1991; 5: 1309-1320Crossref PubMed Scopus (172) Google Scholar), GST-Oct-1 specifically bound to the Oct-1 protein. It also bound to the Pbx1b protein, but not to the green fluorescent protein, which was used as a negative control. Intriguingly, GST-Oct-1 also specifically interacted with Prep1 (Fig. 1C). No binding was observed when proteins were incubated with GST alone. These data confirm that the Pbx1b and Prep1 proteins interact with Oct-1 in vitro. To ascertain the domains of Pbx1 and Prep1 that serve for the interaction with Oct-1, the pull-down experiments were repeated with various domains of Pbx1b and Prep1. Two Pbx1 mutant proteins were used to map the interface between Pbx1 and Oct-1. To test the contribution of the N-terminal domain of Pbx1b, the naturally occurring Pbx mutant E2A-Pbx1b (32Kamps M.P. Murre C. Sun X.H. Baltimore D. Cell. 1990; 60: 547-555Abstract Full Text PDF PubMed Scopus (578) Google Scholar) was used. This oncogenic fusion protein contains the transactivation domain of the E2A protein substituting for the first 88 residues of Pbx1 (Fig. 1D). In addition, we used a Pbx1b mutant protein lacking 75 N-terminal amino acids (PbxΔNT3). Fig. 1C shows that both Pbx1 mutant proteins specifically bound GST-Oct-1. These data indicate that the N-terminal region of Pbx1b is not essential for the interaction with Oct-1. To determine which region of the Prep1 protein provides the major contribution to the protein-protein interaction with Oct-1, two deletions were made. The deletion in the N-terminal region removed the Meis homologous regions 1 and 2 (Prep1ΔHR), which were previously shown to be important for protein-protein interactions with Pbx proteins (37Berthelsen J. Zappavigna V. Ferretti E. Mavilio F. Blasi F. EMBO J. 1998; 17: 1434-1445Crossref PubMed Scopus (182) Google Scholar). The deletion in the C-terminal region removed the Prep1 homeodomain (Prep1ΔHD) (Fig. 1D). Fig. 1C indicates that GST-Oct-1 specifically bound Prep1 lacking the N-terminal domain, but not the Prep1 lacking the homeodomain. These data suggest that sequences located in the DNA-binding domain of Prep1 serve for the interaction with Oct-1. TALE Homeodomain Proteins Bind Functional Sites within the GnRH Regulatory Region—Pbx
Referência(s)