Portal de Periódicos da CAPES

Structural Basis of Calcification Inhibition by α2-HS Glycoprotein/Fetuin-A

2003; Elsevier BV; Volume: 278; Issue: 15 Linguagem: Inglês

10.1074/jbc.m210868200

1083-351X

Alexander Heiss, Alexander DuChesne, Bernd Denecke, Joachim Grötzinger, Kazuhiko Yamamoto, Thomas Renné, Willi Jahnen‐Dechent,

Blood properties and coagulation

Genetic evidence from mutant mice suggests that α2-HS glycoprotein/fetuin-A (Ahsg) is a systemic inhibitor of precipitation of basic calcium phosphate preventing unwanted calcification. Using electron microscopy and dynamic light scattering, we demonstrate that precipitation inhibition by Ahsg is caused by the transient formation of soluble, colloidal spheres, containing Ahsg, calcium, and phosphate. These “calciprotein particles” of 30–150 nm in diameter are initially amorphous and soluble but turn progressively more crystalline and insoluble in a time- and temperature-dependent fashion. Solubilization in Ahsg-containing calciprotein particles provides a novel conceptual framework to explain how insoluble calcium precipitates may be transported and removed in the bodies of mammals. Mutational analysis showed that the basic calcium phosphate precipitation inhibition activity resides in the amino-terminal cystatin-like domain D1 of Ahsg. A structure-function analysis of wild type and mutant forms of cystatin-like domains from Ahsg, full-length fetuin-B, histidine-rich glycoprotein, and kininogen demonstrated that Ahsg domain D1 is most efficient in inhibiting basic calcium phosphate precipitation. The computer-modeled domain structures suggest that a dense array of acidic residues on an extended β-sheet of the cystatin-like domain Ahsg-D1 mediates efficient inhibition. Genetic evidence from mutant mice suggests that α2-HS glycoprotein/fetuin-A (Ahsg) is a systemic inhibitor of precipitation of basic calcium phosphate preventing unwanted calcification. Using electron microscopy and dynamic light scattering, we demonstrate that precipitation inhibition by Ahsg is caused by the transient formation of soluble, colloidal spheres, containing Ahsg, calcium, and phosphate. These “calciprotein particles” of 30–150 nm in diameter are initially amorphous and soluble but turn progressively more crystalline and insoluble in a time- and temperature-dependent fashion. Solubilization in Ahsg-containing calciprotein particles provides a novel conceptual framework to explain how insoluble calcium precipitates may be transported and removed in the bodies of mammals. Mutational analysis showed that the basic calcium phosphate precipitation inhibition activity resides in the amino-terminal cystatin-like domain D1 of Ahsg. A structure-function analysis of wild type and mutant forms of cystatin-like domains from Ahsg, full-length fetuin-B, histidine-rich glycoprotein, and kininogen demonstrated that Ahsg domain D1 is most efficient in inhibiting basic calcium phosphate precipitation. The computer-modeled domain structures suggest that a dense array of acidic residues on an extended β-sheet of the cystatin-like domain Ahsg-D1 mediates efficient inhibition. γ-carboxyl glutamic acid matrix GLA-containing protein α2-HS glycoprotein/fetuin-A basic calcium phosphate bovine and mouse Ahsg, respectively bovine serum albumin transmission electron microscopy fetuin-B human and mouse FETUB, respectively histidine-rich glycoprotein human HRG kininogen human KNG maltose-binding protein glutathione S-transferase α2-Heremans-Schmid The combination of mineral with an organic matrix called “biomineral” is commonplace in biology. Biominerals studied in detail include magnetic crystals in bacteria (1Kirschvink J.L. Walker M.M. Diebel C.E. Curr. Opin. Neurobiol. 2001; 11: 462-467Crossref PubMed Scopus (310) Google Scholar), silica skeletons in diatomeous algae (2Kröger N. Lehmann G. Rachel R. Sumper M. Eur. J. Biochem. 1997; 250: 99-105Crossref PubMed Scopus (133) Google Scholar, 3Cha J.N. Shimizu K. Zhou Y. Christiansen S.C. Chmelka B.F. Stucky G.D. Morse D.E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 361-365Crossref PubMed Scopus (721) Google Scholar), shells of marine molluscs (4Addadi L. Weiner S. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4110-4114Crossref PubMed Scopus (921) Google Scholar, 5Shen X. Belcher A.M. Hansma P.K. Stucky G.D. Morse D.E. J. Biol. Chem. 1997; 272: 32472-32481Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar), and skeletons of vertebrate animals (6Termine J.D. Ciba Found. Symp. 1988; 136: 178-202PubMed Google Scholar). Generally, biominerals form in close proximity with biomacromolecules. Ultrastructural analyses suggest that a protein scaffold provides the ordered and spatially restrained framework for crystal deposition. In mammals, collagen is an excellent scaffold for calcification. Noncollagenous proteins control nucleation, growth, shape, and orientation of crystals in the mineral phase (7Glimcher M.J. Biomaterials. 1990; 11: 7-10PubMed Google Scholar, 8Busch S. Dolhaine H. Du Chesne A. Heinz S. Hochrein O. Laeri F. Podebrad O. Vietze U. Weiland T. Kniep R. Eur. J. Inorg. Chem. 1999; : 1643-1653Crossref Google Scholar). Major mineral ions are equally distributed in the extracellular space of most living organisms. Extracellular fluids are especially supersaturated with regard to calcium and phosphate ions. Therefore, it is surprising that mineralization is restricted to collagenous matrix of the vertebrate skeleton and that once started mineralization does not proceed throughout the organism (9Neuman W.F. Urist M.R. Fundamental and Clinical Bone Physiology. Lippincott Co., Philadelphia1980: 83-107Google Scholar). This suggests that the inhibition of unwanted mineralization is at least as important as the initiation of mineralization. Genetic experimentation with mutant mice indeed suggests that mineralization is the default pathway, which must be actively prevented, not started (10Schinke T. McKee M.D. Karsenty G. Nat. Genet. 1999; 21: 150-151Crossref PubMed Scopus (124) Google Scholar). Unwanted mineralization resulted from the genetic ablation of mineralization inhibitors, pyrophosphate (11Ho A.M. Johnson M.D. Kingsley D.M. Science. 2000; 289: 265-270Crossref PubMed Scopus (542) Google Scholar, 12Nakamura I. Ikegawa S. Okawa A. Okuda S. Koshizuka Y. Kawaguchi H. Nakamura K. Koyama T. Goto S. Toguchida J. Matsushita M. Ochi T. Takaoka K. Nakamura Y. Hum. Genet. 1999; 104: 492-497Crossref PubMed Scopus (147) Google Scholar) and matrix γ-carboxyl glutamic acid (GLA)1-containing protein (MGP) (13Luo G. Ducy P. McKee M.D. Pinero G.J. Loyer E. Behringer R.R. Karsenty G. Nature. 1997; 386: 78-81Crossref PubMed Scopus (1739) Google Scholar). We showed that the lack of α2-HS glycoprotein/fetuin-A (Ahsg) results in severe systemic calcification in mice and humans (15Ketteler M. Bongartz P. Westenfeld R. Wildberger J. Mahnken A. Böhm R. Metzger T. Wanner C. Jahnen-Dechent W. Floege J. Lancet. 2003; (in press)PubMed Google Scholar). 2C. Schäfer, A. Heiss, A. Schwarz, R. Westenfeld, M. Ketteler, J. Floege, W. Müller-Esterl, T. Schinke, and W. Jahnen-Dechent, submitted for publication. 2C. Schäfer, A. Heiss, A. Schwarz, R. Westenfeld, M. Ketteler, J. Floege, W. Müller-Esterl, T. Schinke, and W. Jahnen-Dechent, submitted for publication. Of note, Ahsg is the only protein inhibitor of calcification known so far that is systemic and present throughout the extracellular space in mammals. Due to its high affinity for the mineral phase of bone, Ahsg accumulates about 100-fold over other serum proteins in bones and teeth (16Triffitt J.T. Gebauer U. Ashton B.A. Owen M.E. Reynolds J.J. Nature. 1976; 262: 226-227Crossref PubMed Scopus (182) Google Scholar). This seems paradoxical, considering that Ahsg is an efficient inhibitor of calcification both in vitro and in vivo. Here we studied how Ahsg inhibits the formation of basic calcium phosphate (BCP). Using electron microscopy and dynamic light scattering, we determined that the inhibition is effected by a transient formation of colloidal spheres containing Ahsg, calcium, and phosphate, which we call “calciprotein particles.” Further, the structure-function relationship of recombinant forms of Ahsg-like proteins from the cystatin superfamily, fetuin-B (FETUB), histidine-rich glycoprotein (HRG), and kininogen (KNG) suggests that the inhibition of unwanted calcification by Ahsg involves binding of BCP nuclei to an array of acidic amino acid residues on an extended β-sheet of the cystatin-like Ahsg domain D1. We suggest that the resulting diffusion barrier limits further growth of the crystal nuclei and thus delays their precipitation. This proposed mechanism of the transient inhibition of BCP precipitation by Ahsg is fundamentally different from previous concepts, namely sequestration of calcium ions by negatively charged proteins like serum albumin or calcium binding through an EF-hand motif. The precipitation inhibition assay was performed as described (17Schinke T. Amendt C. Trindl A. Pöschke O. Müller-Esterl W. Jahnen-Dechent W. J. Biol. Chem. 1996; 271: 20789-20796Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar). Briefly, a buffered salt solution (50 mm Tris/HCl, pH 7.4, 4.8 mmCaCl2, 2 × 106 cpm of [45Ca]Cl2, 1.6 mmNa2HPO4) containing test proteins as indicated in the figure legends was incubated at 37 °C for 90 min. Precipitates were collected by centrifugation (15,000 ×g, 5 min at room temperature), dissolved in 1% acetic acid, and quantified by liquid scintillation counting. All incubations were done in triplicates. Bovine serum albumin (BSA; Roth, Karlsruhe, Germany) and bovine fetuin/bAhsg (Sigma) were used as negative and positive control proteins, respectively. For scanning electron microscopy, a supersaturated solution of calcium (2.5 mm CaCl2) and phosphate (1.8 mmKH2PO4) was prepared (18Walsh D. Hopwood J.D. Mann S. Science. 1994; 264: 1576-1578Crossref PubMed Scopus (177) Google Scholar) with and without 200 nm bAhsg added. After a 90-min incubation at 22 °C, precipitate was spun down, air-dried, and viewed in a Leo series 1400 scanning electron microscope (Leo Electron Microscopy Ltd., Cambridge, UK). For transmission electron microscopy (TEM) analysis, bAhsg and BSA were purified by gel filtration (Superdex 200; Amersham Biosciences, Freiburg, Germany) in 50 mm Tris/HCl, pH 7.4. Monomer-containing fractions were collected, and the protein concentration was determined using a dye assay (Roti-Nanoquant, Roth, Karlsruhe, Germany). All solutions were microfiltered (0.22 μm) before mixing. Following the precipitation reaction in buffer (5 mm CaCl2, 3 mm Na2HPO4, 50 mmTris/HCl) at pH 7.4 and 22 and 37 °C, respectively, samples were dialyzed against water (MilliQ; Millipore Corp.) using micro dialysis cartridges. This step was essential for electron microscopy of the precipitation mixture, which would otherwise have been obscured by dried salt. The dialyzed samples were cleared by centrifugation for 1 min at 1000 × g. The supernatant and, if formed, the precipitate were transferred to carbon-coated grids. Excess liquid was blotted from the side. The samples were viewed directly in TEM without staining. Supporting films of 7-nm thickness were coated onto freshly cleaved mica using a Balzers BAE 250 vacuum evaporator (Bingen, Germany), floated onto water, and transferred to 300-mesh copper grids. For elemental mapping of carbon, supporting films were made of boron. Energy-filtering transmission electron microscopy was performed on a Leo 912 Omega instrument (tungsten filament) operated at 120 kV using an objective aperture of 16.5 millirads. The width of the energy window controlled by the opening of the energy selector slit was 10 eV. All images were recorded using a slow scan CCD camera (lateral resolution 1024 × 1024 pixels, 14-bit gray) and processed using a SIS-AnalySIS® image processing system. Elemental distribution images where all obtained by three window potential background extrapolation (19Du Chesne A. Macromol. Chem. Phys. 1999; 200: 1813-1830Crossref Scopus (38) Google Scholar). Dynamic light scattering was measured using a laser (Spectra Physics 165, λ = 514 nm, 300 milliwatts). The scattered intensity was recorded at Q= 90° (VV geometry) and analyzed by an ALV 5000 autocorrelator. The square light scattering cell was equilibrated to T = 20 °C. Two-exponential fitting gave the best accuracy for all autocorrelation functions. The intensities given are the absolute intensities due to scattering of the corresponding component. The scattering intensity caused by pure water and the cell was approximately 7 kHz (toluene standard 55 kHz). A total of nine cystatin-like protein domains of fetuin-A/Ahsg, fetuin-B (FETUB), kininogen (KNG), and histidine-rich glycoprotein (HRG) were modeled comparatively. The models were generated with Modeler4 software (20Sali A. Blundell T.L. J. Mol. Biol. 1993; 234: 779-815Crossref PubMed Scopus (10448) Google Scholar) using chicken egg white cystatin (Protein Data Bank accession code 1CEW) (21Bode W. Engh R. Musil D. Thiele U. Huber R. Karshikov A. Brzin J. Kos J. Turk V. EMBO J. 1988; 7: 2593-2599Crossref PubMed Scopus (544) Google Scholar) as a template structure. During iterative refinement steps, the generated models were evaluated with Procheck and Prosa II (20Sali A. Blundell T.L. J. Mol. Biol. 1993; 234: 779-815Crossref PubMed Scopus (10448) Google Scholar, 22Laskowski R.A. MacArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar, 23Sippl M.J. Proteins. 1993; 17: 355-362Crossref PubMed Scopus (1756) Google Scholar). Additionally, models were scrutinized for structural clashes by Ramachandran plotting. No ψ and φ angles that are located in the forbidden areas of the Ramachandran plot and no unnatural bond lengths were observed. All structures proposed formed a compact core. Energetically intolerable interactions between C-β atoms did not occur. The cloning, expression, and purification of fusion proteins with maltose-binding protein (MBP) has been described (17Schinke T. Amendt C. Trindl A. Pöschke O. Müller-Esterl W. Jahnen-Dechent W. J. Biol. Chem. 1996; 271: 20789-20796Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar). Full-length mAhsg cDNA and deletion mutants thereof were PCR-amplified and ligated into pRSET-5c vector containing a Myc tag sequence and an additional EcoRI site downstream of the cloning sequence. The Myc tag oligonucleotides used for vector modification are listed in Table I. Using PCR and the primers listed in Table I, Myc-tagged deletion mutants of mAhsg cDNA were generated and subcloned by BamHI/EcoRI restriction/ligation into the vector pGEX-2T (Amersham Biosciences) for the expression of GST fusion proteins and by BamHI/HindIII restriction/ligation into the vector pMAL-c2 (New England Biolabs, Schwalbach, Germany) for MBP fusion protein expression. Fetuin-B cDNA was cloned by reverse transcription-PCR from rat, mouse, and human liver mRNA using murine leukemia virus reverse transcriptase (PerkinElmer Life Sciences) and Pwo polymerase (PeqLab, Erlangen, Germany) into the vector pGEMT (Promega, Madison, WI). For fusion protein expression, the cDNA inserts were excised by BamHI/EcoRI restriction and ligated into the vectors pGEX-2T and pMAL-c2. Using primer mutagenesis, serine residues Ser120, Ser291, Ser294, and Ser296 of the mature mouse Ahsg protein chain were mutated to glutamic acid in order to mimic Ser phosphorylation at these sites (24Jahnen-Dechent W. Trindl A. Godovac-Zimmermann J. Müller-Esterl W. Eur. J. Biochem. 1994; 226: 59-69Crossref PubMed Scopus (41) Google Scholar, 25Haglund A.C. Ek B. Ek P. Biochem. J. 2001; 357: 437-445Crossref PubMed Scopus (57) Google Scholar). Mutations were achieved by a three-step overlapping PCR using the primer pairs detailed in Table I. The mutated mAhsg was ligated into the vector pGEX-2T for subsequent expression as GST fusion protein (GST-mAhsg/4S>E). Table I lists the mutated mAhsg constructs and the PCR primers used for their construction.Table IOligonucleotide primers used for cloning of cystatin domain-containing fusion proteins of GST or MBP and mouse Ahsg, mouse, rat, and human FETUB, and human KNGConstruct5′-primer3′-primerMyc tag blunt/EcoR1GGGGAGCAGAAGCTGATCTCGGAGGAGGACCTGAACTAGMyc tag EcoR1/bluntAATTCTAGTTCAGGTCCTCCTCCGAGATCAGCTTCTGCTCCCCpRSET mAhsg-MycGGGCTGCCATATGGCTCCACAAGGTACAGGGATTTTGAAGTGTCTGATCCpMAL mAhsg-MycGGAGATATAGGATCCGCTCCACAAGGTACAGGGCCAACTCAGCTTCCTTTCGpGEX mAhsg-MycGGAGATATAGGATCCGCTCCACAAGGTACAGGGCCAACTCAGCTTCCTTTCGpGEX-mAhsg/4S>E-MycGAGTTTCTCCCTCGGCCTCCTCCACCTCGGCCACGTAATACGACTCACTATAGGGCAATTAACCCTCACTAAAGGGCCAGACGAGGCAGAGGACGTAATACGACTCACTATAGGGCAATTAACCCTCACTAAAGGGpRSET mAhsg 15–70-MycGAGAATTGCATATGGATGATCCAGAAGCAGTGGTCTCCAGTGTGTCpGEX-mAhsg 15–70-MycGGAGATATAGGATCCGATGATCCAGAAGCGCCAACTCAGCTTCCTTTCGpRSET mAhsg 1–81-MycGGGCTGCCATATGGCTCCACAAGGTACAGGGTTTGGCAGCGGGGTGGGpGEX mAhsg 1–81-MycGGAGATATAGGATCCGCTCCACAAGGTACAGGGCCAACTCAGCTTCCTTTCGpRSET mAhsg 42–81-MycGGATTCAAACATATGTTGAATCAGATCGGTTTGGCAGCGGGGTGGGpGEX mAhsg 42–81-MycGGAGATATAGGATCCTTGAATCAGATCGGCCAACTCAGCTTCCTTTCGpRSET mAhsg 42–70-MycGGATTCAAACATATGTTGAATCAGATCGAGTGGTCTCCAGTGTGTCMBP-mAhsg 42–70-MycGGAGATATAGGATCCTTGAATCAGATCGGCCAACTCAGCTTCCTTTCGGST-mFETUBCCCTCTCACCTCTGCATCCGGGATGGAATTCTCAGGGTGGGACCAGMBP-mFETUBCCCTCTCACCTCTGCATCCGGGATGGAATTCTCAGGGTGGGACCAGGST-rFETUBCGGGATCCTTCGCACCTCTGCGTCCGGAATTCAGGGGGTTCTTTGCTTTTCGST-hFETUBCGGGATCCCTCAACCCCTCGGCTCGGAATTCTCATGGCGGAAGGACAAGMBP-hKNG-domain D1GTGGATCCCAGGAATCACAGTCCGCAAGCTTCTAGGCTGGAGTAATCTGMBP-hKNG-domain D2GTCTAGACCAGCCGAGGGCCCTGTGAAAGCTTCCTACCCTGGATAAATGMBP-hKNG-domain D3CATTTCTAGAGGGAAGGATTTTGTACTCTGCAGCTATGAGATCATTCCCAGTGGTTG Open table in a new tab To clone the cDNA sequences encoding cystatin-domains D1, D2, and D3 of human kininogen, total RNA was prepared from HepG2 cells following established protocols. The cystatin domains were cloned by reverse transcription-PCR using murine leukemia virus reverse transcriptase (New England Biolabs), Taq polymerase (Amersham Biosciences), and the primer pairs listed in TableI. Primers contained additional restriction sites and stop codons. The amplicons were ligated into vector pMAL-c2 using BamHI/HindIII (hKNG-D1),XbaI/HindIII (hKNG-D2), orXbaI/PstI (hKNG-D3), respectively. All cloning steps were verified by DNA sequencing. Expressed proteins were probed on the protein level using species-specific antisera and immunoblotting. Specific antisera at our disposal were originally raised against human, rat, mouse, and bovine Ahsg and recombinant human, rat, and mouse FETUB (data not shown). Bacterial cultures were inoculated from an overnight preculture 1:500. At anA600 of 0.5, isopropyl-1-thio-β-d-galactopyranoside was added to a final concentration of 300 μm. After a 2-h incubation at 37 °C, the bacteria were harvested by centrifugation for 10 min at 2500 × g. The bacterial pellet was resuspended in buffer containing 20 mm Tris, pH 7.4, 1 mm EDTA, and 200 mm NaCl (MBP fusion protein, amylose column buffer) or in PBS (GST fusion protein, glutathione-Sepharose column buffer). In the case of small MBP-fused fragments of Ahsg D1, the salt concentration was adjusted to 300 mm to improve amylose binding. The suspension was frozen overnight at −20 °C. The thawed ice-cold suspension was pulse-sonicated three times for 20 s. Then 1% Triton-X100, a protease inhibitor mixture, DNase, and RNase to a final concentration 10 μg/ml were added, and the suspension was mixed for 10 min at 4 °C. Nuclease digestion of crude protein preparations was critically important for the reproducibility of precipitation assays, because DNA and RNA are potent inhibitors of BCP precipitation (26Blumenthal N.C. Clin. Orthop. Relat. Res. 1989; 247: 279-289PubMed Google Scholar). Protein preparations, which proved active in the BCP precipitation inhibition assay, were routinely treated with proteinase K to ensure that the inhibitory activity indeed resided with the protein fraction of each preparation and not with residual contaminating nucleic acids or low molecular weight inhibitors. After centrifugation for 15 min at 4 °C and 30,000 ×g, the supernatant was loaded onto an amylose column. After washing the column with 3 column volumes of amylose column buffer for MBP fusion proteins and with 3 column volumes of PBS for GST fusion proteins, the MBP-fused proteins were eluted with amylose column buffer containing 10 mm maltose, and the GST-fused protein was eluted with buffer containing 20 mm Tris, pH 8, and 10 mm reduced glutathione. Recombinant protein isolated from the bacteria without a denaturation/refolding cycle was generally inactive in the BCP precipitation inhibition assay. Therefore, every recombinant protein had to be denatured and refolded (17Schinke T. Amendt C. Trindl A. Pöschke O. Müller-Esterl W. Jahnen-Dechent W. J. Biol. Chem. 1996; 271: 20789-20796Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar). The stability and activity of the fusion proteins depended on the refolding procedure. Following is an optimized refolding procedure yielding active protein for both GST and MBP fusion proteins. All recombinant proteins were solubilized for 2 h at room temperature in a buffer containing 50 mm Tris/HCl adjusted to pH 8, 6 m urea, and 50 mm dithiothreitol. The denatured protein solution was concentrated to 5 mg/ml using the same buffer with dithiothreitol content reduced to 5 mm. Refolding was initiated by slow dilution of protein solution (final concentration less than 50 μg/ml) into a vigorously stirred redox-refolding buffer (50 mm Tris, pH 8, 2 mmGSH, 0.2 mm GSSG, 1 m 3–(1-pyridino)-1-propane sulfonate, NDSB 201). The final yield of functional protein and its stability was greatly improved by adding NDSB 201 to the redox-refolding buffer. This solution was incubated for at least 1 day at room temperature to allow air oxidation of reduced protein. Using ultrafiltration, the initial buffer was replaced by 50 mmTris/HCl, pH 7.4. The formation of aggregates during the refolding procedure was routinely analyzed by gel filtration chromatography using Superdex 200 and 75 gel filtration columns (Amersham Biosciences). Our previous work has shown that Ahsg is highly effectivein vitro to inhibit de novo formation of BCP (17Schinke T. Amendt C. Trindl A. Pöschke O. Müller-Esterl W. Jahnen-Dechent W. J. Biol. Chem. 1996; 271: 20789-20796Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar). This inhibition was transient and lasted about 5–6 h at the conditions of our assay. The precipitation delay seems, however, sufficient to prevent generalized calcification in vivo. Our recent finding of severe systemic calcification of most soft tissues2 in Ahsg-deficient mice validates the biological relevance of this concept. Here we asked how Ahsg interacts with the calcium and phosphate ions or the mineral nuclei to achieve inhibition. Using scanning electron microscopy, we studied the influence of Ahsg on the morphology of the mineral precipitate. First, we analyzed the precipitate formed from a metastable calcium phosphate solution with or without added native bAhsg (Fig. 1). The exact nature of this precipitate is uncertain because of phase transitions. Therefore, we collectively address the precipitate formed as BCP, regardless of its exact chemical and crystallographic composition of variable proportions of amorphous calcium phosphate, octacalcium phosphate, and apatite. In the absence of bAhsg, copious amounts of BCP formed and appeared as a compact pellet (Fig.1A). The addition of 200 nm bAhsg to the precipitation mixture barely reduced the amount of precipitate formed. However, the morphology of the BCP precipitate formed at this low concentration of bAhsg was changed into a loose, fluffy precipitate comprising small, 2–15-μm-sized aggregates (Fig. 1B). A precipitation mix containing 10 μm bAhsg, the nominal serum concentration, was stable for many hours at 37 °C without any precipitate formation. Control incubations containing 10 μm BSA or no protein formed a clearly visible precipitate within 2 h under otherwise identical conditions. The precipitates of both controls were indistinguishable and were microcrystalline as judged by TEM (not shown). Next, the dialyzed supernatants were subjected to TEM analysis. Supernatants of precipitation mixtures, which had been incubated for 2 h at 22 or at 37 °C, respectively in the presence of 10 μm bAhsg contained spherical aggregates with a diameter of 30–150 nm (Fig.2, A and F). The size and shape of the aggregates were independent of the order of CaCl2 and Na2HPO4 addition. The precipitates were amorphous as judged by the lack of discrete diffraction patterns in TEM (Fig. 2F, inset). We termed these soluble, colloidal spheres “calciprotein particles” in analogy to the well established lipoprotein particles. The supernatant of both controls (with BSA and protein-free, respectively) did not contain any similar particles (not shown). After 4 h of incubation at 37 °C, small crystalline needles started to grow on the surface of the calciprotein particles (Fig.2G), but not at 22 °C (Fig. 2B). The fact that a diffraction pattern was obtained from samples incubated for 6 h at 37 °C indicated that crystallization had started (Fig.2H, inset). A reduced temperature of 22 °C resulted in a delayed transformation of morphology (Fig. 2,A–E). After 23 h at 22 °C, crystallization of needles on the surface of spheres started to appear (Fig.2C), similar in appearance to the samples harvested at 4 h and 37 °C (Fig. 2G). After 30 h at 37 °C, a solid BCP precipitate had formed. Small crystalline needles were present in the supernatant (Fig. 2I), whereas the precipitate consisted of large clusters of radially oriented needles with a diameter of about 450 nm (Fig. 2J). In summary, the transient inhibition of BCP precipitation by Ahsg relies on the formation of soluble colloidal spheres, “calciprotein particles,” which progressively turn into an insoluble crystalline precipitate. Next, we obtained information on the composition of the calciprotein particles by elemental mapping (Fig. 3). This procedure visualizes the electron energy loss at absorption edges characteristic of each element. Imaging of electrons with an energy loss corresponding to, for example, a calcium absorption edge will image the calcium-enriched regions of the specimen (19Du Chesne A. Macromol. Chem. Phys. 1999; 200: 1813-1830Crossref Scopus (38) Google Scholar). Fig. 3represents the elemental mapping of densely packed calciprotein particles harvested 2 h after the start of a precipitation reaction performed with 10 μm bAhsg at 37 °C. We show the elastically filtered image (mass density, Fig. 3A) and the phosphorus (Fig. 3B), the carbon (Fig. 3C), and the calcium (Fig. 3D) net distribution image of the same region. The elemental mapping indicates that all three elements were evenly distributed within the calciprotein particles. We analyzed by dynamic light scattering (DLS) the speed of calciprotein particle formation in solution. First, we studied a solution of bAhsg without calcium and phosphate. We detected a major fraction (∼99.5%) with a hydrodynamic radius (rh) of 4.2 nm corresponding to the Ahsg monomer and a small fraction (∼0.5%) withrh = 55.4 nm, which we tentatively assigned to Ahsg aggregates (not shown). The addition of calcium resulted in an increase of the gyration radius by about 10%. Compared with the calcium phosphate- and Ahsg-containing samples (below), the scattering intensities were very low (Fig. 4). We observed a sharp rise in light scatter immediately after the addition of calcium and phosphate (Fig. 4). A slow, strongly scattering colloid matching the size of the calciprotein particles (rh = 40–50 nm) was detected in the solution, which we assigned to the emerging calciprotein particles. Within the first 1 h of incubation, a steep increase in the partial scattering intensity was measured (Fig. 4). During the following 19 h, the increase in intensity was moderate, yet continued. The hydrodynamic size still continued to grow after 1 day, but the intensity decreased (not shown). This is best explained by the complete sedimentation of the newly formed insoluble BCP precipitate. To further analyze the structural requirements for efficient inhibition of BCP precipitation by Ahsg, we conducted a structure-function analysis of Ahsg-related proteins. We produced a series of mutated Ahsg fusion proteins as well as recombinant proteins related to Ahsg and measured their ability to inhibit BCP precipitation. To this end, we employed an established assay measuring co-precipitation of 45Ca in a buffered solution containing calcium, phosphate, and test protein (17Schinke T. Amendt C. Trindl A. Pöschke O. Müller-Esterl W. Jahnen-Dechent W. J. Biol. Chem. 1996; 271: 20789-20796Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar). In this initial work, we had mapped the basal structural motif mediating the inhibition of spontaneous BCP precipitation to the amino-terminal cystatin-like Ahsg domain D1. Hence, we tested several related proteins of the cystatin superfamily containing structurally related cystatin-like protein domains. KNG contains three cystatin-like domains, HRG contains two, and Ahsg as well as its relative, the recently discovered FETUB (27Olivier E. Soury E. Ruminy P. Husson A. Parmentier F. Daveau M. Salier J.P. Biochem. J. 2000; 350: 589-597Crossref PubMed Scopus (124) Google Scholar), both contain two cystatin-like domains. We previously determined that HRG could inhibit precipitation, albeit with a 2-fold lower molar efficiency than Ahsg (28Schinke T. Koide T. Jahnen-Dechent W. FEBS Lett. 1997; 412: 559-562Crossref PubMed Scopus (19) Google Scholar). We scanned for additional structural features that might contribute to the inhibition of calcification by Ahsg. It is known that post-translational modifications of mineral binding proteins, notably phosphorylation, influence their binding properties (7Glimcher M.J. Biomaterials. 1990; 11: 7-10PubMed Google Scholar, 29Raj P.A. Johnsson M. Levine M.J.