Differential Regulation of Two Alternatively Spliced Isoforms of Hypoxia-inducible Factor-1α in Activated T Lymphocytes
2001; Elsevier BV; Volume: 276; Issue: 52 Linguagem: Inglês
10.1074/jbc.m104782200
ISSN1083-351X
AutoresDmitriy Lukashev, Charles C. Caldwell, Akio Ohta, Pearl Chen, Michail V. Sitkovsky,
Tópico(s)Immune Cell Function and Interaction
ResumoCell adaptation to hypoxia is partially accomplished by hypoxia-inducible transcription factor-1 (HIF-1). Here we report the hypoxia-independent up-regulation of HIF-1α subunit in antigen receptor-activated T cells. This is explained by a selective up-regulation of alternatively spliced mRNA isoform I.1 that encodes the HIF-1α protein without the first 12 N-terminal amino acids. We show that both short (I.1) and long (I.2) HIF-1α isoforms display similar DNA binding and transcriptional activities. Major differences were observed between these two HIF-1α isoforms in their expression patterns with respect to the resting and activated T lymphocytes in hypoxic and normoxic conditions. The T cell antigen receptor (TCR)-triggered activation of normal ex vivo T cells and differentiated T cells results in up-regulation of expression of I.1 isoform of HIF-1α mRNA without an effect on constitutive I.2 HIF-1α mRNA expression. The accumulation of I.1 HIF-1α mRNA isoform in T lymphocytes is also demonstrated during cytokine-mediated inflammation in vivo, suggesting a physiological role of short HIF-1α isoform in activated lymphocytes. The TCR-triggered, protein kinase C and Ca2+/calcineurin-mediated HIF-1α I.1 mRNA induction is protein synthesis-independent, suggesting that the HIF-1α I.1 gene is expressed as an immediate early response gene. Therefore, these data predict a different physiological role of short and long isoforms of HIF-1α in resting and activated cells. Cell adaptation to hypoxia is partially accomplished by hypoxia-inducible transcription factor-1 (HIF-1). Here we report the hypoxia-independent up-regulation of HIF-1α subunit in antigen receptor-activated T cells. This is explained by a selective up-regulation of alternatively spliced mRNA isoform I.1 that encodes the HIF-1α protein without the first 12 N-terminal amino acids. We show that both short (I.1) and long (I.2) HIF-1α isoforms display similar DNA binding and transcriptional activities. Major differences were observed between these two HIF-1α isoforms in their expression patterns with respect to the resting and activated T lymphocytes in hypoxic and normoxic conditions. The T cell antigen receptor (TCR)-triggered activation of normal ex vivo T cells and differentiated T cells results in up-regulation of expression of I.1 isoform of HIF-1α mRNA without an effect on constitutive I.2 HIF-1α mRNA expression. The accumulation of I.1 HIF-1α mRNA isoform in T lymphocytes is also demonstrated during cytokine-mediated inflammation in vivo, suggesting a physiological role of short HIF-1α isoform in activated lymphocytes. The TCR-triggered, protein kinase C and Ca2+/calcineurin-mediated HIF-1α I.1 mRNA induction is protein synthesis-independent, suggesting that the HIF-1α I.1 gene is expressed as an immediate early response gene. Therefore, these data predict a different physiological role of short and long isoforms of HIF-1α in resting and activated cells. hypoxia-inducible factor vascular endothelial growth factor inducible nitric-oxide synthase hypoxia response element pVHL, von Hippel-Lindau protein reverse transcription T cell antigen receptor concanavalin A monoclonal antibody 4-morpholineethanesulfonic acid 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol Immune cells are exposed to different oxygen tensions, including hypoxia, as they develop, migrate, and function in primary, secondary, and tertiary lymphoid organs with different infrastructure, vasculature, and oxygen supply (1Picker L.J. Siegelman M.H. Paul W.E. Fundamental Immunology. Lippincott-Raven Publishers, Philadelphia1999: 479-533Google Scholar, 2Westermann J. Bode U. Immunol. Today. 1999; 20: 302-306Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Hypoxic extracellular environments were demonstrated in some normal tissues (3Loeffler D.A. Keng P.C. Baggs R.B. Lord E.M. Int. J. Cancer. 1990; 45: 462-467Crossref PubMed Scopus (36) Google Scholar, 4Dewhirst M.W. Semin. Radiat. Oncol. 1998; 8: 143-150Crossref PubMed Scopus (146) Google Scholar) and during chronic inflammatory and malignant diseases (5Jelkmann W. J. Interferon Cytokine Res. 1998; 18: 555-557Crossref PubMed Scopus (335) Google Scholar, 6Van Belle H. Goossens F. Wynants J. Am. J. Pathol. 1987; 252: H886-H893Google Scholar, 7Matherne G.P. Headrick J.P. Coleman S.D. Berne R.M. Pediatr. Res. 1990; 28: 348-353Crossref PubMed Scopus (54) Google Scholar, 8Vaupel P.W. Frinak S. Bicher H.I. Cancer Res. 1981; 41: 2008-2013PubMed Google Scholar, 9Vaupel P. Kalinowski F. Okunieff P. Cancer Res. 1989; 49: 6449-6465PubMed Google Scholar, 10Hoskin D.W. Reynolds T. Blay J. Int. J. Cancer. 1994; 59: 854-855Crossref PubMed Scopus (70) Google Scholar). The mechanisms of lymphocyte adaptation to hypoxia are likely to exist under such conditions. Cell adaptation to hypoxia is partially accomplished by the transcriptional activity of hypoxia-inducible factor-1 (HIF-1).1 HIF-1 is a basic helix-loop-helix/Per-ARNT-Sim protein consisting of HIF-1α and HIF-1β subunits (11Wang G.L. Semenza G.L. J. Biol. Chem. 1995; 270: 1230-1237Abstract Full Text Full Text PDF PubMed Scopus (1765) Google Scholar, 12Wang G.L. Jiang B.H. Rue E.A. Semenza G.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5510-5514Crossref PubMed Scopus (5208) Google Scholar). The HIF-1β subunit is also known as aryl hydrocarbon receptor nuclear translocator (ARNT) and serves as a heterodimerization partner for other transcription factors (13Rowlands J.C. Gustafsson J.A. Crit. Rev. Toxicol. 1997; 27: 109-134Crossref PubMed Scopus (442) Google Scholar, 14Sogawa K. Fujii-Kuriyama Y. J. Biochem. (Tokyo). 1997; 122: 1075-1079Crossref PubMed Scopus (181) Google Scholar, 15Ema M. Morita M. Ikawa S. Tanaka M. Matsuda Y. Gotoh O. Saijoh Y. Fujii H. Hamada H. Kikuchi Y. Fujii-Kuriyama Y. Mol. Cell. Biol. 1996; 16: 5865-5875Crossref PubMed Scopus (138) Google Scholar, 16Whitmore D. Sassone-Corsi P. Foulkes N.S. Curr. Opin. Neurobiol. 1998; 8: 635-641Crossref PubMed Scopus (25) Google Scholar, 17Zheng B. Larkin D.W. Albrecht U. Sun Z.S. Sage M. Eichele G. Lee C.C. Bradley A. Nature. 1999; 400: 169-173Crossref PubMed Scopus (21) Google Scholar). HIF-1 activates the transcription of genes required for glucose metabolism, erythropoiesis, vascularization, and cell proliferation by binding to cis-acting hypoxia response element (HRE) (18Semenza G.L. Agani F. Booth G. Forsythe J. Iyer N.V. Jiang B.-H. Leung S. Roe R. Wiener C. Yu A. Kidney Int. 1997; 51: 553-555Abstract Full Text PDF PubMed Scopus (271) Google Scholar, 19Wenger R.H. Gassmann M. Biol. Chem. 1997; 378: 609-616PubMed Google Scholar, 20Semenza G.L. Genes Dev. 2000; 14: 1983-1991Crossref PubMed Google Scholar, 21Semenza G.L. Curr. Opin. Gene Dev. 1998; 8: 588-594Crossref PubMed Scopus (946) Google Scholar, 22Iyer N.V. Kotch L.E. Agani F. Leung S.W. Laughner E. Wenger R.H. Gassmann M. Gearhart J.D. Lawler A.M. Yu A.Y. Semenza G.L. Genes Dev. 1998; 12: 149-162Crossref PubMed Scopus (2103) Google Scholar). The HIF-1α subunit may also affect cell metabolism and signaling by its ability to directly interact with other proteins such as p53 (23An W.G. Kanekal M. Simon M.C. Maltepe E. Blagosklonny M.V. Neckers L.M. Nature. 1998; 392: 405-408Crossref PubMed Scopus (660) Google Scholar). Multiple roles of HIF-1α as transcriptional factor and in protein-protein interactions complicate the understanding of its role in vivo. Possible clues are expected to be provided by studies of regulation of HIF-1α mRNA and protein expression. Oxygen-sensing mechanisms and the subsequent regulation of HIF-1 expression are the subject of intensive investigations. It was shown that HIF-1α, but not HIF-1β, expression is significantly enhanced by hypoxia (12Wang G.L. Jiang B.H. Rue E.A. Semenza G.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5510-5514Crossref PubMed Scopus (5208) Google Scholar, 24Huang L.E. Arany Z. Livingston D.M. Bunn H.F. J. Biol. Chem. 1996; 271: 32253-32259Abstract Full Text Full Text PDF PubMed Scopus (1035) Google Scholar, 25Jiang B.-H. Semenza G.L. Bauer C. Marti H.H. Am. J. Physiol. 1996; 271: C1172-C1180Crossref PubMed Google Scholar). It is believed that the regulation of HIF-1α expression occurs mostly on post-translational level (19Wenger R.H. Gassmann M. Biol. Chem. 1997; 378: 609-616PubMed Google Scholar). HIF-1α mRNA is constitutively expressed in tissue culture cells independent of oxygen tensions (26Wenger R.H. Kvietikova I. Rolfs A. Gassmann M. Marti H.H. Kidney Int. 1997; 51: 560-563Abstract Full Text PDF PubMed Scopus (125) Google Scholar,27Wenger R.H. Rolfs A. Marti H.H. Guenet J.-L. Gassmann M. Biochem. Biophys. Res. Commun. 1996; 223: 54-59Crossref PubMed Scopus (108) Google Scholar), but its expression is induced by hypoxia or ischemia in vivo (28Bergeron M. Yu A.Y. Solway K.E. Semenza G.L. Sharp F.R. Eur. J. Neurosci. 1999; 11: 4159-4170Crossref PubMed Scopus (375) Google Scholar, 29Wiener C.M. Booth G. Semenza G.L. Biochem. Biophys. Res. Commun. 1996; 225: 485-488Crossref PubMed Scopus (364) Google Scholar, 30Yu A.Y. Frid M.G. Shimoda L.A. Wiener C.M. Stenmark K. Semenza G.L. Am. J. Physiol. 1998; 275: L818-L826Crossref PubMed Google Scholar). Protein stability plays most important role in control of HIF-1α expression. At high oxygen tensions, HIF-1α is targeted for destruction by an E3 ubiquitin ligase containing the von Hippel-Lindau tumor suppressor protein (pVHL) (31Cockman M.E. Masson N. Mole D.R. Jaakola P. Chang G.W. Clifford S.C. Maher E.R. Pugh C.W. Ratcliffe P.J. Maxwell P.H. J. Biol. Chem. 2000; 275: 25733-25741Abstract Full Text Full Text PDF PubMed Scopus (931) Google Scholar, 32Ohh M. Park C.W. Ivan M. Hoffman M.A. Kim T.Y. Huang L.E. Pavletich N. Chau V. Kaelin W.G. Nat. Cell Biol. 2000; 2: 423-427Crossref PubMed Scopus (1289) Google Scholar). According to a current model, pVHL binds to the oxygen-dependent degradation domain located in the central region of HIF-1α (33Srinivas V. Zhang L.P. Zhu X.H. Caro J. Biochem. Biophys. Res. Commun. 1999; 260: 557-561Crossref PubMed Scopus (127) Google Scholar) that results in a subsequent degradation of HIF-1α through the ubiquitin-proteasome pathway (34Salceda S. Caro J. J. Biol. Chem. 1997; 272: 22642-22647Abstract Full Text Full Text PDF PubMed Scopus (1433) Google Scholar, 35Huang L.E. Gu J. Schau M. Bunn H.F. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7987-7992Crossref PubMed Scopus (1870) Google Scholar). We were prompted to revisit this model by recent demonstrations of oxygen tension-independent induction of HIF-1α by hormones (36Richard D.E. Berra E. Pouyssegur J. J. Biol. Chem. 2000; 275: 26765-26771Abstract Full Text Full Text PDF PubMed Google Scholar) and proinflammatory cytokines (37Thornton R.D. Lane P. Borghaei R.C. Pease E.A. Caro J. Mochan E. Biochem. J. 2000; 350: 307-312Crossref PubMed Scopus (193) Google Scholar) as well as by our own studies of HIF-1α expression in activated T lymphocytes. 2C. Caldwell and M. Sitkovsky, manuscript in preparation. It was also important to investigate the possibility of differential expression of two mouse HIF-1α mRNA isoforms, which contain two alternative first exons named I.1 and I.2 (38Wenger R.H. Rolfs A. Kvietikova P. Spielmann P. Zimmermann D.R. Gassmann M. Eur. J. Biochem. 1997; 246: 155-165Crossref PubMed Scopus (45) Google Scholar, 39Wenger R.H. Rolfs A. Spielmann P. Zimmermann D.R. Gassmann M. Blood. 1998; 91: 3471-3480Crossref PubMed Google Scholar). The I.1 mRNA encodes a protein, which is expected to be 12 N-terminal amino acid residues shorter than HIF-1α I.2 mRNA-encoded protein, although no difference in functions of these HIF-1α isoforms has yet been reported (40Gorlach A. Camenisch G. Kvietikova I. Vogt L. Wenger R.H. Gassmann M. Biochim. Biophys. Acta. 2000; 1493: 125-134Crossref PubMed Scopus (74) Google Scholar). No corresponding human isoform has been found so far. The ratios of these two mRNA isoforms in cells and patterns of expression of HIF-1α I.1 mRNA in resting versusactivated versus differentiated cells are not known. HIF-1α I.2 mRNA is constitutively expressed like a housekeeping gene in all tissues in an oxygen tension-independent manner, while I.1 mRNA has a tissue-specific expression (39Wenger R.H. Rolfs A. Spielmann P. Zimmermann D.R. Gassmann M. Blood. 1998; 91: 3471-3480Crossref PubMed Google Scholar). Thus, studies of expression of these two HIF-1α mRNA isoforms may allow to us to distinguish possible separate roles of HIF-1α as a transcription factor and in protein-protein interactions provided that the expression of short and long forms of HIF-1α is differentially regulated. Accordingly, in this study we asked whether HIF-1α mRNA is indeed constitutively expressed in ex vivo naive T cells, ex vivo activated T cells, differentiated T cells, and resting versus activated T cells by taking advantage of the possibilities provided by quantitative competitive RT-PCR. We report here that TCR-triggered activation of T lymphocytes results in up-regulation of the I.1 isoform of HIF-1α mRNA without an effect on I.2 mRNA expression. The expression of I.1 HIF-1α mRNA follows a pattern of immediate early response genes. These observations suggest differential regulation and functions of these two isoforms of HIF-1α proteins in resting and activated cells. Mouse 2B4 T helper hybridoma cells and mouse splenocytes were maintained in RPMI 1640 (Biofluids, Rockville, MD) supplemented with 5% dialyzed fetal calf serum (heat-inactivated) and 100 units/ml penicillin, 100 μg/ml streptomycin, 1 mmsodium pyruvate, 1 mm HEPES, nonessential amino acids (RP5), and 50 μm 2-mercaptoethanol (complete RPMI). NIH 3T3 fibroblasts were cultured in AMEM supplemented with 10% fetal calf serum, 2 mm l-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin. Single cell splenocyte suspensions were prepared from adult mouse spleens. T cells were isolated using a mixture of anti-CD4 and anti-CD8 microbeads to positively select cells on an AutoMACS (Miltenyi Biotec, Auburn, CA) using the manufacturer's protocol. Isolated cells were incubated in complete RPMI 1640. Unless otherwise indicated, 50 μm 2-mercaptoethanol was added into cell cultures conducted at 20% oxygen but not in the medium for cultures conducted at 1.0% oxygen tensions. Cells to be cultured at 1.0% oxygen were centrifuged and added to culture medium pre-equilibrated for at least 30 min with a certified gas mixture containing 1.0% oxygen, 5.0% CO2, and 94.0% N2 (Roberts Oxygen Company, Rockville, MD). Cells were incubated in a NAPCO (Winchester, VA) 7000 three-gas incubator at 1 or 20% oxygen tension as indicated in the figure legends. Th1 and Th2 cells were obtained after cytokine-driven differentiation of naive CD4+ T cells in vitro according to Ref. 41Hu-Li J. Huang H. Ryan J. Paul W.E. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3189-3194Crossref PubMed Scopus (77) Google Scholar, and they were kindly provided by Dr. J. Hu-Li (NIAID, National Institutes of Health). The TCR-activated 2B4 cells were incubated (2 × 106 cells/ml) in 96-well plates (Costar, Corning, NY) precoated with 10 μg/ml anti-TCR (clone H57-597; Pharmingen, La Jolla, CA). Studies of the biochemical pathways involved in HIF-1α mRNA regulation were performed after incubation of cells with 15 nm phorbol 12-myristate 13-acetate (Calbiochem) and/or 300 nm ionomycin (Calbiochem). Inhibitors were added as indicated: cycloheximide (Sigma) (50 μg/ml), actinomycin D (Biomol, Plymouth Meeting, PA) (5 μg/ml), cyclosporin A (Biomol, Plymouth Meeting, PA) (1 μg/ml), and K252b (20 nm). Mouse T cells were activated by plate-bound (3 μg/ml) anti-CD3 mAb (clone 145-2C110; Pharmingen, La Jolla, CA) and 3 μg/ml anti-CD28 mAb (clone 37.51; Pharmingen) for 36 h as described earlier (42Apasov S. Sitkovsky M. Int. Immunol. 1999; 11: 179-189Crossref PubMed Scopus (45) Google Scholar). Female C57BL/6 mice were injected intravenously with 20 mg/kg concanavalin A (type IV; Sigma) dissolved in sterile phosphate-buffered saline. After 6 h, tissue samples were taken, and spleen T cells were isolated using AutoMACS as described above. Total RNA was isolated using the RNA STAT-60 kit (Tel-Test, Friendswood, TX) according to the manufacturer's protocol. Measurements of cytokine levels (tumor necrosis factor-α and interferon-γ in the sera were determined using enzyme-linked immunosorbent assay kits obtained from R&D systems (Minneapolis, MN) according to the manufacturer's instructions. Cells were centrifuged and resuspended in 2× sample buffer (Novex) with 4% 2-mercaptoethanol followed by 30-s ultrasonic treatment. Samples were boiled for 5 min and loaded to 7% SDS-PAGE. An immunoblot assay was performed as described (12Wang G.L. Jiang B.H. Rue E.A. Semenza G.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5510-5514Crossref PubMed Scopus (5208) Google Scholar) except that 1:200 diluted antibodies (Transduction Laboratories, Lexington, KY) were used. Total RNA was extracted from 105 to 107 cells using RNA STAT-60 kit (Tel-Test, Friendswood, TX) according to the manufacturer's protocol. Northern blotting was performed following the general procedure (formaldehyde gel) (43Sambrook J. Fritch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual.2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) using 1 μg of messenger RNA purified with the Oligotex mRNA Mini Kit (Qiagen, Chatsworth, CA) per lane. HIF-1α probe was synthesized using a 380-bp HIF-1α cDNA fragment. The glyceraldehyde-3-phosphate dehydrogenase probe was purchased from CLONTECH (Palo Alto, CA). The EcoRI-PstI fragment of human HIF-1α cDNA (GenBankTM number U22431), which has high homology with mouse HIF-1α (GenBankTM number AF003695) was subcloned into pGEM-3Zf(+) (Promega, Madison, WI) to be used for mimic construction. For deletion of the internal region from wild type cDNA, PCR was performed using M13 reverse primer andSpeI containing primer GAAACTACTAGTCGGACAGCCTCACCAAAC. PCR product was digested with PstI and SpeI and was inserted instead of the SpeI-PstI fragment in the HIF-1α cDNA EcoRI-PstI fragment. The resulting HIF-1α mimic cDNA was 33 bp shorter then wild type HIF-1α cDNA (Fig. 1B). I.1 (GenBankTMnumber Y09086) and I.2 (GenBankTM number Y13656) mimic cDNA were constructed by PCR using TTTCTGGGCAAACTGTTA and CTCTGGACTTGTCTC, respectively, and TAACCCCATGTATTTGTTC. PCR was performed on total cDNA from activated 2B4 cells. PCR products were digested with XbaI, resulting in the deletion of 167 bp (see Fig. 3B) and cloned into blunted XbaI site in pGEM-3Zf(+) (Promega, Madison, WI). The above primers were also used in competitive RT-PCR for determination of either I.1 or I.2 mRNA concentrations in cellular extracts. VEGF mimic cDNA was made by PCR on total mouse cDNA using primers TTTTTTGAATTCTTGAGTTAAACGAACGTACTTGC and TTTTTTGGATCCACGAGCTCTACAGGAATACCAG. A 369-bp PCR product was digested with EcoRI, BamHI, and HinfI and cloned into in pGEM-3Zf(+) (Promega, Madison, WI) byEcoRI-BamHI sites. Mimic cDNA for iNOS was created from total mouse cDNA by PCR using primers AATAATGAATTCAACTGCAAGAGAACGGAGAAC and AATAATGGATCCGAGCTCCTCCAGAGGGTAGG. 455-bp PCR product was digested with EcoRI,BamHI, and HinfI and cloned into in pGEM-3Zf(+) (Promega, Madison, WI) by EcoRI-BamHI sites.Figure 3Differential up-regulation of HIF-1α I.1 mRNA upon T cell activation.A, RT-PCR for I.1 and I.2 isoforms of HIF-1α mRNA from mouse T cells and 2B4 hybridoma cells. Cells were incubated with or without plate-bound anti-CD3 mAb at 1% or 20% O2 at 37 °C for 24 h. B, design of mimics for competitive RT-PCR for HIF-1α I.1 and I.2 mRNA isoforms. C, quantitative RT-PCR for HIF-1α I.1 mRNA from mouse T cells and 2B4 hybridoma cells. Cells were activated as described above. The positions of the target and mimic RT-PCR products are indicated by the arrows. Results obtained with 2-fold mimic dilutions are shown, where M1 is the maximal mimic concentration. The amount of HIF-1α mRNA from untreated cells is assigned 1 relative unit for the presentation of results. Samples were normalized for β-actin mRNA expression. D, competitive RT-PCR for HIF-1α I.2 mRNA from T cells and 2B4 cells. Cells were stimulated as described above. The positions of the target and mimic RT-PCR products are indicated by the arrows. The same concentration of mimic was used for each sample. E, ConA-induced T cell activation. Upper panel, up-regulation of proinflammatory cytokines after intravenous injection of concanavalin A. C57BL/6 mice were treated with concanavalin A (20 mg/kg), and serum tumor necrosis factor-α and interferon-γ levels were determined by enzyme-linked immunosorbent assay. Tumor necrosis factor-α levels after 1.5 h and interferon-γ levels after 8 h were shown. Lower panel, quantitative RT-PCR for HIF-1α I.1 mRNA from ConA-activated T cells. T lymphocytes werein vivo stimulated by ConA as described under "Experimental Procedures." 3-fold mimic dilutions are shown, whereM1 represents maximal mimic concentration. The amount of HIF-1α mRNA from T cells derived from untreated mice is used as 1 relative unit. Samples were normalized for β-actin mRNA expression.View Large Image Figure ViewerDownload Hi-res image Download (PPT) RNA corresponding mimic cDNA was synthesized with T7 RNA polymerase (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer's manual. Transcription product was analyzed in 8% PAGE, and an 850-base nondegraded RNA band was observed. Optical dichroism of RNA product was measured at 260 nm, and 1 μg of mimic RNA was subjected to reverse transcription in the same conditions as for endogenous RNA. Total RNA was prepared using the RNA STAT-60 kit followed by treatment with DNase I (Life Technologies). The first strand cDNA was synthesized on 1 μg of total RNA using the SuperSCRIPT preamplification system (Life Technologies) with random hexaprimers according to the manufacturer's instructions. After RNase H treatment, the reaction mixture was diluted to a final volume of 100 μl. The competitive PCR was performed using PLATINUM Taq DNA polymerase (Life Technologies) under standard conditions for 30 cycles in a 30-μl reaction volume that included 1 μl of the diluted cDNA and 1 μl of mimic DNA at the concentrations indicated in the figure legends. PCR using HIF-1α-specific primers ACTGCCACCACTGATGAATCAAAAACAG and TTCCATTTTTCGCTTCCTCTGAGCATTC gave a 283-bp product from mimic cDNA and a 316-bp product from wild type HIF-1α cDNA. Twenty microliters of PCR product was fractionated in a 2% agarose gel and examined by ethidium bromide staining. The density of each band was determined with Stratagene Eagle Eye II (Stratagene, Cedar Creek, TX). The densities of RT-PCR products were normalized for differences in cDNA quantity between samples using PCR quantitation of β-actin mRNA using a β-actin competitive PCR set (Takara Shuzo Co., Kyoto, Japan). The use of β-actin mRNA as an internal standard in studies of activated murine T lymphocytes was justified in previous experiments reported by Koshiba et al. (44Koshiba M. Apasov S. Sverdlov V. Chen P. Erb L. Turner J.T. Weisman G.A. Sitkovsky M.V. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 831-836Crossref PubMed Scopus (77) Google Scholar). Quantitative determination of mRNA was done by estimating the equivalent point (where the mimic/target PCR product ratio equals 1.0) in a competitive RT-PCR experiment with serial dilutions of mimic. To estimate the equivalent point, 10-fold serial dilutions of mimic DNA were used in preliminary PCR experiments followed by more precise estimations using 2-fold dilutions of mimic DNA. Electrophoretic mobility shift assay was performed as in Gorlach et al. (40Gorlach A. Camenisch G. Kvietikova I. Vogt L. Wenger R.H. Gassmann M. Biochim. Biophys. Acta. 2000; 1493: 125-134Crossref PubMed Scopus (74) Google Scholar). Briefly, plasmids pmHIF-I.1, pmHIF-I.2 (kind gift of Dr. R. Wenger, Medical University in Lubeck, Germany), and pBM5/NEO/M1–1 (kind gift of Dr. O. Hankinson (UCLA) were used for transcription in vitro of HIF-I.1, HIF-I.2, and human ARNT mRNAs, respectively, by T7 RNA polymerase (Roche Molecular Biochemicals), which were subsequently used for translation in vitro using rabbit reticulocyte lysate system (Promega, Madison, WI) with or without [35S]Met (Amersham Biosciences, Inc.). After that, 5 μl of unlabeled in vitro synthesized ARNT and either one of the HIF-1α isoforms were incubated for 30 min at room temperature before the addition of 104 cpm of32P-labeled ([γ-32P]ATP for 5′ labeling of oligonucleotide was purchased from Amersham Biosciences) double-stranded oligodeoxyribonucleotide AGCTTGCCCTACGTGCTGTCTCAG, corresponding to HRE from the human erythropoietin gene enhancer, and binding buffer (20 mm Tris-HCl pH 7.5, 20% glycerol, 0.1m KCl, 0.2 mm EDTA, 2.5 mmdithiothreitol, 0.5 mm phenylmethylsulfonyl fluoride, 1 mm Na3VO4) to a final volume of 40 μl. The same but unlabeled double-stranded oligonucleotide was used as a competitor in 20-fold excess. After 20 min of incubation at 4 °C, the samples were resolved using 5% nondenaturating gel with 0.5× TBE. Expression vector containing the HIF-I.2 isoform was prepared by cloning HIF-I.2 cDNA containing 45-bp 5′-untranslated region in pCEP4 plasmid (CLONTECH, Palo Alto, CA). An expression construct of the I.1 isoform was created by deletion of 36 bp corresponding to amino acid residues 1–12 from I.2 cDNA. Human HIF-1α expressing vector pCEP4/HIF-1α T7 was kindly provided by Dr. G. Semenza (Johns Hopkins University, Baltimore, MD), and plasmid pBM5/NEO/M1–1 containing human ARNT was a kind gift from Dr. O. Hankinson. Reporter plasmid HRE-Luc, containing three copies of iNOS promoter-derived HRE, was kindly provided by Dr. M. Blagosklonny (NCI, National Institutes of Health). 5 × 104 NIH 3T3 cells/well were plated in 24-well plates (Costar, Corning, NY) the day before transfection. Cells were transfected in triplicate using LipofectAMINE PLUS reagent (Life Technologies) in the same medium according to the manufacturer's protocol. The following amounts of plasmids were used: 0.1 μg of HRE-Luc, 0.2–0.5 μg of one of the HIF-1α-expressing vectors, 0.2–0.5 μg of pBM5/NEO/M1. The total amount of DNA/well was adjusted to 1 μg with pGEM-3Zf(+) (Promega, Madison, WI). Sixteen hours after transfection, fresh medium was added, and cells were grown for an additional 24 h at either 1 or 20% O2. Luciferase activity was determined using the Luciferase Assay System (Promega, Madison, WI) according to the manufacturer's protocol. Our studies of T cell functions under hypoxic conditions revealed HIF-1α protein up-regulation in TCR-triggered activated T lymphocytes under normoxic conditions (20% O2).2 T lymphocytes are not unique to receptor-triggered HIF-1α up-regulation. This phenomenon has been reported in normoxic conditions in different cells after incubations with hormones (36Richard D.E. Berra E. Pouyssegur J. J. Biol. Chem. 2000; 275: 26765-26771Abstract Full Text Full Text PDF PubMed Google Scholar) or proinflammatory cytokines (37Thornton R.D. Lane P. Borghaei R.C. Pease E.A. Caro J. Mochan E. Biochem. J. 2000; 350: 307-312Crossref PubMed Scopus (193) Google Scholar). We undertook detailed studies of HIF-1α regulation in activated T cells, since HIF-1α has important transcriptional activities and affects important regulatory proteins (45Semenza G.L. Crit. Rev. Biochem. Mol. Biol. 2000; 35: 71-103Crossref PubMed Scopus (580) Google Scholar). Up-regulation of HIF-1α protein and HIF-1α mRNA in activated versus nonactivated T cells is demonstrated by Western and Northern blot analysis of extracts from 2B4 T helper hybridoma cells after their incubation with anti-TCR mAb at nonhypoxic conditions at 20% oxygen (Fig.1A). Increased amounts of HIF-1α mRNA in activated T cells was unexpected, since HIF-1α regulation was known to be controlled on a post-translational level (19Wenger R.H. Gassmann M. Biol. Chem. 1997; 378: 609-616PubMed Google Scholar). Further detailed mRNA expression studies by Northern blot analysis of HIF-1α mRNA in T lymphocytes were limited by the requirement of the large numbers of cells and inadequate quantitative measurement of HIF-1α mRNA increase by Northern blot analysis. This precluded analysis of small numbers of cells in different T cells populations ex vivo and after in vitrodifferentiation and prompted the development of quantitative competitive RT-PCR assay using the mimic corresponding to the 3′ region of HIF-1α mRNA (Fig. 1B). We determined that HIF-1α mRNA expression is greater than 5-fold higher in TCR-stimulated T cells cultured at 1% O2 as compared with nonstimulated cells, with a 15-fold increase in HIF-1α mRNA in cells activated in normoxic conditions, at 20% O2 (Fig. 1C). Direct measurements established that there were lower levels of HIF-1α mRNA in ex vivo CD4+ naive T cells than in Th1 and Th2 T cells obtained after their differentiation in vitro (data not shown). Therefore, TCR-mediated activation, but not hypoxia, leads to HIF-1α mRNA expression up-regulation in T cells. Incubation of T cells with TCR-cross-linking reagents triggers a complex cascade of events such as inositol-triphosphate signaling, increases in intracellular Ca2+, Ca2+/CaM-dependent phosphatase, and calcineurin and protein kinase C activation (46Crabtree G.R. Clipstone N.A. Annu. Rev. Biochem. 1994; 63: 1045-1083Crossref PubMed Scopus (629) Google Scholar). To test whether these pathways may be implicated in HIF-1α mRNA up-regulation, we tested the effects of protein kinase C activators and Ca2+ ionophore. It appears that these pathways are responsible, in part, for the observed increases in HIF-1α mRNA expression. Protein kinase
Referência(s)