Portal de Periódicos da CAPES

Analysis of the Phthiocerol Dimycocerosate Locus ofMycobacterium tuberculosis

2001; Elsevier BV; Volume: 276; Issue: 23 Linguagem: Inglês

10.1074/jbc.m100662200

1083-351X

Luis R. Camacho, Patricia Constant, Catherine Raynaud, Marie‐Antoinette Lanéelle, James A. Triccas, Brigitte Gicquel, Mamadou Daffé, Christophe Guilhot,

Infectious Diseases and Tuberculosis

Among the few characterized genes that have products involved in the pathogenicity of Mycobacterium tuberculosis, the etiological agent of tuberculosis, are those of the phthiocerol dimycocerosate (DIM) locus. Genes involved in biosynthesis of these compounds are grouped on a 50-kilobase fragment of the chromosome containing 13 genes. Analysis of mRNA produced from this 50-kilobase fragment in the wild type strain showed that this region is subdivided into three transcriptional units. Biochemical characterization of five mutants with transposon insertions in this region demonstrated that (i) the complete DIM molecules are synthesized in the cytoplasm of M. tuberculosis before being translocated into the cell wall; (ii) the genesfadD26 and fadD28 are directly involved in their biosynthesis; and (iii) both the drrC andmmpL7 genes are necessary for the proper localization of DIMs. Insertional mutants unable to synthesize or translocate DIMs exhibit higher cell wall permeability and are more sensitive to detergent than the wild type strain, indicating for the first time that, in addition to being important virulence factors, extractable lipids of M. tuberculosis play a role in the cell envelope architecture and permeability. This function may represent one of the molecular mechanisms by which DIMs are involved in the virulence ofM. tuberculosis. Among the few characterized genes that have products involved in the pathogenicity of Mycobacterium tuberculosis, the etiological agent of tuberculosis, are those of the phthiocerol dimycocerosate (DIM) locus. Genes involved in biosynthesis of these compounds are grouped on a 50-kilobase fragment of the chromosome containing 13 genes. Analysis of mRNA produced from this 50-kilobase fragment in the wild type strain showed that this region is subdivided into three transcriptional units. Biochemical characterization of five mutants with transposon insertions in this region demonstrated that (i) the complete DIM molecules are synthesized in the cytoplasm of M. tuberculosis before being translocated into the cell wall; (ii) the genesfadD26 and fadD28 are directly involved in their biosynthesis; and (iii) both the drrC andmmpL7 genes are necessary for the proper localization of DIMs. Insertional mutants unable to synthesize or translocate DIMs exhibit higher cell wall permeability and are more sensitive to detergent than the wild type strain, indicating for the first time that, in addition to being important virulence factors, extractable lipids of M. tuberculosis play a role in the cell envelope architecture and permeability. This function may represent one of the molecular mechanisms by which DIMs are involved in the virulence ofM. tuberculosis. phthiocerol dimycocerosate(s) kilobase(s) open reading frame(s) base pair(s) polymerase chain reaction reverse transcriptase dimycocerosate(s) of phthiocerol A dimycocerosates of phthiocerol B dimycocerosate(s) of phthiodiolone gas chromatography mass spectrometry isocitrate desydrogenase reactive nitrogen intermediate(s) bacillus Calmette-Guerin matrix-assisted laser desorption ionization-time of flight Mycobacterium tuberculosis, the etiological agent of tuberculosis, is an intracellular pathogen that causes more human deaths than any other single infectious agent. Despite its tremendous importance as a public health problem, the molecules involved in the pathogenicity of the tubercle bacillus remain largely unknown. The mycobacterial cell envelope has long been thought to be involved in both the pathogenicity of these bacteria and their resistance to hostile environments and antibiotics. In addition to its postulated passive role through a strong resistance to degradation by host enzymes, impermeability to toxic macromolecules, and inactivation of small reactive molecules, such as reactive oxygen and nitrogen derivatives, the mycobacterial cell envelope may exert a more active role, notably by interacting with host cell receptors to facilitate uptake of the bacterium and by modulating the immune response (1Daffé M. Draper P. Adv. Microb. Physiol. 1998; 39: 131-203Crossref PubMed Google Scholar). The mycobacterial envelope is unique, both in molecular composition and in the architectural arrangement of its constituents. From the cytoplasm to the external side of the bacterium, the cell envelope is composed of: (i) a plasma membrane; (ii) a cell wall consisting of a peptidoglycan covalently attached to the heteropolysaccharide arabinogalactan, which is in turn esterified by very long chain (C60–C90) fatty acids called mycolic acids and various noncovalently attached lipids and glycolipids; and (iii) a capsule of polysaccharides, proteins, and lipids (1Daffé M. Draper P. Adv. Microb. Physiol. 1998; 39: 131-203Crossref PubMed Google Scholar). In the last 50 years, considerable effort has been devoted to searching for putative virulence factors among constituents of the mycobacterial cell envelope. Two structurally related families of noncovalently attached cell wall and capsular lipids, phthiocerol and phenolphthiocerol diesters (Fig. 1), have retained special attention. These complex lipids are composed of a mixture of long chain β-diols, which are esterified by multimethyl-branched fatty acids. Depending on the stereochemistry of the chiral centers bearing the methyl branches, the fatty acids are called mycocerosic or phthioceranic acids (2Asselineau J. Indian J. Chest Dis. 1982; 24: 143-157Google Scholar, 3Daffé M. Lanéelle M.A. J. Gen. Microbiol. 1988; 134: 2049-2055PubMed Google Scholar). Phthiocerol dimycocerosates (DIM)1 and diphthioceranates have been identified to date in eight mycobacterial species. DIM have been found in M. tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium leprae, Mycobacterium gastri, and Mycobacterium kansasii, and phthiocerol diphthioceranates have been found in Mycobacterium marinum and Mycobacterium ulcerans. With the exception of M. gastri, all of the DIM- or phthiocerol diphthioceranate-containing species are mycobacterial pathogens (3Daffé M. Lanéelle M.A. J. Gen. Microbiol. 1988; 134: 2049-2055PubMed Google Scholar). In addition, a DIM-less H37Rv-derived strain of M. tuberculosishas been shown to be attenuated in the guinea pig model in comparison with the DIM-producing H37Rv strain (4Goren M.B. Broki O. Schaefer W.B. Infect. Immun. 1974; 9: 150-158Crossref PubMed Google Scholar). Furthermore, an avirulent strain of M. tuberculosis coated with a mixture of DIM and cholesteryl oleate has been shown to persist longer than the uncoated strain in the spleen and lungs of infected mice (5Kondo E. Kanai K. Jpn. J. Med. Sci. Biol. 1976; 29: 199-210Crossref PubMed Scopus (17) Google Scholar). However, all of this evidence is indirect, and there has been no direct demonstration that these molecules are involved in pathogenicity. With recent advances in the molecular biology of mycobacteria, the biosynthesis of these lipids has been shown to involve at least seven genes in M. bovis BCG. Five of these genes,ppsA–E, encode a type I modular polyketide synthase responsible for the synthesis of phthiocerol and phenolphthiocerol by elongation of a C20–C22 fatty acyl chain or an acyl chain containing a phenol moiety with three malonyl-CoA and two methylmalonyl-CoA units (6Azad A.K. Sirakova T.D. Fernandes N.D. Kolattukudy P.E. J. Biol. Chem. 1997; 272: 16741-16745Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Another gene, mas, encodes an iterative type I polyketide synthase that produces mycocerosic acids after two to four rounds of extension of C18–C20 fatty acids with methylmalonyl-CoA units (7Azad A.K. Sirakova T.D. Rogers L.M. Kolattukudy P.E. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4787-4792Crossref PubMed Scopus (86) Google Scholar, 8Mathur M. Kolattukudy P.E. J. Biol. Chem. 1992; 267: 19388-19395Abstract Full Text PDF PubMed Google Scholar). Finally, the fadD28 gene (also namedacoas) has been shown to encode an acyl-CoA synthase that is thought to be involved in the release and transfer of mycocerosic acid from Mas onto the diols (9Fitzmaurice A.M. Kolattukudy P.E. J. Biol. Chem. 1998; 273: 8033-8039Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Genome sequencing of M. tuberculosis has revealed that these seven genes are clustered on a 50-kb fragment of the chromosome containing six other open reading frames (ORF): three ORF (drrA, drrB, anddrrC) encoding polypeptides very similar to ABC transporters, another ORF (mmpL7) encoding a transporter of the RND permease superfamily (10Tseng T.-T. Gratwick K.S. Kollman J. Park D. Nies D.H. Goffeau A. Saier Jr., M.H. J. Mol. Microbiol. Biotechnol. 1999; 1: 107-125PubMed Google Scholar), one ORF encoding an acyl-CoA synthase (fadD26), and the final ORF (papA5) encoding a protein of unknown function (see Fig. 2) (11Cole S.T. Brosch R. Parkhill J. Garnier T. Churcher C. Harris D. Gordon S.V. Eiglmeier K. Gas III, S. C. E.B. Tekaia F. Badcock K. Basham D. Brown D. Chillingworth T. Connor R. Davies R. Devlin K. Feltwell T. Gentles S. Hamlin N. Holroyd S. Hornsby T. Jagels K. Krogh A. McLean J. Moule S. Murphy L. Oliver K. Osborne J. Quail M.A. Rajandream M.-A. Rogers J. Rutter S. Seeger K. Skelton J. Squares R. Squares S. Sulston J.E. Taylor K. Whitehead S. Barrell B.G. Nature. 1998; 393: 537-544Crossref PubMed Scopus (6522) Google Scholar). We recently searched for the virulence factors of M. tuberculosis by applying the Signature-tagged transposon mutagenesis method to mycobacteria. We isolated four different insertions in the 50-kb region, which led to a strong growth defect in lungs of intravenously infected mice in comparison with the wild type parental strain. In these mutants, transposon insertions occurred upstream from fadD26 and within fadD26,drrC, or mmpL7 (12Camacho L.R. Ensergueix D. Perez E. Gicquel B. Guilhot C. Mol. Microbiol. 1999; 34: 257-267Crossref PubMed Scopus (517) Google Scholar). A similar approach using the Erdman strain of M. tuberculosis also led to the isolation of attenuated mutants with an insertion upstream from fadD26and within fadD28 and mmpL7, confirming that the 50-kb region is important for the virulence of M. tuberculosis (13Cox J.S. Chen B. McNeil M. Jacobs Jr., W.R. Nature. 1999; 402: 79-83Crossref PubMed Scopus (615) Google Scholar). No DIM production was observed in thefadD26 and fadD28 strains, whereas themmpL7 insertional mutant of the Erdman strain appeared to synthesize this molecule but was defective in its secretion (13Cox J.S. Chen B. McNeil M. Jacobs Jr., W.R. Nature. 1999; 402: 79-83Crossref PubMed Scopus (615) Google Scholar). This study was undertaken to dissect the 50-kb region and to obtain further insights into the molecular mechanisms underlying the role of DIM in the virulence of M. tuberculosis. The transcriptional organization of this 50-kb region was studied. We analyzed the production and subcellular localization of DIM in five different strains with transposon insertions in this region. We found that both DrrC and MmpL7 were involved in the proper localization of DIM in the cell envelope and demonstrated that, in addition to the covalently bound mycolic acids, DIM are involved in the cell wall permeability barrier of M. tuberculosis. M. tuberculosis Mt103, the wild type strain used in this study, was isolated from an immunocompetent tuberculosis patient (14Jackson M. Phalen S.W. Lagranderie M. Ensergueix D. Chavarot P. Marchal G. McMurray D.N. Gicquel B. Guilhot C. Infect. Immun. 1999; 67: 2867-2873Crossref PubMed Google Scholar). Strains MYC2251 to MYC2261 were isolated using the Signature-tagged transposon mutagenesis procedure, as previously described (12Camacho L.R. Ensergueix D. Perez E. Gicquel B. Guilhot C. Mol. Microbiol. 1999; 34: 257-267Crossref PubMed Scopus (517) Google Scholar). MYC2251 contains an IS1096::km insertion 113 bp upstream from the predicted start codon of fadD26. MYC2253, MYC2260, MYC2261, and MYC2267 harbor insertions within the fadD26,mmpL7, drrC, and fadD28 genes, respectively. Strain MYC2267 was obtained by PCR screening of our 6912 insertional mutant library as described by Jackson et al.(15Jackson M. Raynaud C. Lanéelle M.-A. Guilhot C. Laurent-Winter C. Ensergueix D. Gicquel B. Daffé M. Mol. Microbiol. 1999; 31: 1573-1587Crossref PubMed Scopus (224) Google Scholar). The occurrence of an IS1096::kminsertion within fadD28 in MYC2267 was confirmed by PCR using primers fadD28C3 and fadD28S3, which are specific forfadD28, and primers IS1 and IS2, which are specific for IS1096::km (TableI). The use of the two fadD28-specific primers in a PCR reaction gave a 1882-bp fragment with the wild type strain Mt103, whereas no PCR fragment was obtained with MYC2267. In contrast, DNA fragments of the expected size were amplified if IS1 and fadD28C3 or IS2 and fadD28S3 were used (data not shown). The IS1096::km insertion site was sequenced and found to be located 460 bp downstream from the predicted start codon of the fadD28 gene.Table IOligonucleotide primers used for MYC2267 characterization, RT-PCR analysis, and construction of pLCF26, pLCF28, and pLCDCPrimerNucleotide sequence (5′ → 3′)Annealing temperature used°CTranscriptional couplingfC26CGCAGTGCCCGACGACATCA65fD26GTCGAGTGAGTTCCGGGCAC65ppsA1GCCGAGAGGTCGGTGTGATGC55ppsB1AGCATTCGCTGCTGCGGGTCC55ppsB7AATGACCGCAGCGACACCAGATCG55ppsC6TAGCCGGCCCGCCAGCGTGAGCAT55ppsCATGACAAGTCTGGCGGAGCGCGCG55ppsD5TCCGGTGCTCAGGTACGGGTCGAT55ppsD11CGGCGGGTGACCTCGGCG66ppsE12CGCCCGCGTCCTCGAGCG66ppsE1TACAGTTCGACTCGGACATGACGC60drrA1GACTTGCTCAGTCCCCACAGACGA60drrA2GTGCCCCGCGATCTGAAGGATCTG60drrB2CCATCGGACTGGACTGAAACCGAC60drrB3CTGTAAAGCTGTTTCCGCACTGGA60drrC3GCGACAAAAGTTGACCCAGTGATC60pap1GATTCAGCCGTTCGTCGCCC60pap2TCCAGAGTGCAGCAGGTCGTC60f28CCGCGGGCGCTGCCGCGGCGATCTCG68mmpL7.3CCCACGTGGCGGGTGTCGGCGCGC68Characterization of MYC2267IS1CTTCTGCAGCAACGCCAGGTCCACACT60IS2GAGGCGGCAGAAAGTCGTCAGGTCAG60fadD28S3ATGGTGGACCCATGGCGAGCC60fadD28C3GGACTAGTCTAGGCATCCAAGCGGGCGAA60Construction of pLCF26f26C1GACTAGTCCGGCATCGCACACG60f26C2GACTAGTTACGGCTACGTCCAG60Construction of pLCF28f28C1GACTAGTCCGGTGTTACCCGAC62f28C3GGACTAGTCTAGGCATCCAAGCGGGCGAA62Construction of pLCDCdrrC1CGGGATCCATGATCACGACGACAAGT63drrC4GTTCTGCAGATGCGTGCTGGCCCG63 Open table in a new tab Strains were grown on Sauton medium as surface pellicles, Middlebrook 7H9 medium (Difco) supplemented with ADC (0.2% dextrose, 0.5% bovine serum albumin fraction V, 0.0003% beef catalase), and 0.05% Tween 80 where indicated or on solid Middlebrook 7H11 medium (Difco) supplemented with OADC (0.005% oleic acid, 0.2% dextrose, 0.5% bovine serum albumin fraction V, 0.085% NaCl, 0.0003% beef catalase). Kanamycin was added when required at a concentration of 20 μg/ml. M. tuberculosiscultures (10 ml) were grown to mid-exponential growth phase. Bacterial cells were pelleted by centrifugation for 10 min at 4000 ×g, resuspended in 1 ml of TE (10 mm Tris-Cl, 1 mm EDTA, pH 8) containing lysozyme (5 mg/ml), and incubated for 20–30 min at 37 °C. Cells were disrupted by adding 500 μl of mini glass beads (0.1 mm in size; PolyLabo) and vigorous shaking for 3 min using a mini bead beater. Total RNA was then extracted using the RNeasy total RNA kit (Qiagen). Contaminating DNA was removed by digestion with DNase I according to the manufacturer's instructions (Roche Molecular Biochemicals). This enzyme was removed by extractions with two chloroform/isoamylic alcohol followed by ethanol precipitation. RNA (1 μg) and oligonucleotide primer were denatured by heating to 65 °C for 10 min. Reverse transcription was performed with the ExpandTM reverse transcriptase (Roche Molecular Biochemicals) in a final volume of 20 μl containing 10 mmdithiothreitol, 1 mm dNTP (Amersham Pharmacia Biotech), 1 μl of RNase inhibitor (Amersham Pharmacia Biotech), 50 units of reverse transcriptase, and the manufacturer's buffer (provided with the enzyme). This mixture was incubated for 55 min at 43 °C, and the enzyme was inactivated by heating for 2 min at 95 °C. A control reaction containing the same components but no reverse transcriptase was included to check for DNA contamination. The cDNA products (2 μl) were then used in a PCR reaction performed in a final volume of 50 μl containing 2 units of Amplitaq Gold polymerase (PerkinElmer Life Sciences), 10% Me2SO, and 15 pmol of each primer. A positive control in which M. tuberculosischromosomal DNA was used as a template for the PCR reaction was included. The amplification program consisted of one cycle of 10 min at 95 °C followed by 35 cycles of 1 min at 95 °C, 1 min at annealing temperature (depending on the primer used (Table I)), 1 min at 72 °C, and a final 10 min at 72 °C. The PCR products were then analyzed by electrophoresis in 0.8% agarose gels. The identities of the PCR products were confirmed by sequencing. Plasmid pMIP12 is an Escherichia coli/mycobacteria shuttle vector derived from pAL5000. It contains a mycobacterial promotor, pBlaF*, upstream from a multicloning site followed by a transcription terminator. 2Le Dantel, C., Winter, N., Gicquel, B., Vincent, V., and Picardeau, M. (2001) J. Bacteriol. 183,2157–2164. A 1.6-kbBamHI fragment containing the hygromycin resistance gene (hyg) was blunt-ended and inserted into the blunt-endedNsiI + DraI-digested pMIP12 vector to give rise to pMIP12H. The drrC gene was amplified from cosmid MTCY19H9 (11Cole S.T. Brosch R. Parkhill J. Garnier T. Churcher C. Harris D. Gordon S.V. Eiglmeier K. Gas III, S. C. E.B. Tekaia F. Badcock K. Basham D. Brown D. Chillingworth T. Connor R. Davies R. Devlin K. Feltwell T. Gentles S. Hamlin N. Holroyd S. Hornsby T. Jagels K. Krogh A. McLean J. Moule S. Murphy L. Oliver K. Osborne J. Quail M.A. Rajandream M.-A. Rogers J. Rutter S. Seeger K. Skelton J. Squares R. Squares S. Sulston J.E. Taylor K. Whitehead S. Barrell B.G. Nature. 1998; 393: 537-544Crossref PubMed Scopus (6522) Google Scholar) with the drrC1 and drrC4 primers (Table I) using the Expand High Fidelity PCR system (Roche Molecular Biochemicals) according to the the manufacturer's instructions. The 830-bp PCR product was digested withBamHI and PstI and inserted into theBamHI + PstI-cut pMIP12H vector leading to give pLCDC. In this construct, the predicted start codon of drrCis located 6 bp downstream from a Shine-Dalgarno sequence and is under the control of the mycobacterial promotor pBlaF*. Plasmid pOIP23H is an integrative mycobacterial vector containing the integrase gene int and the attachment site attPfrom mycobacteriophage Ms6. 3I. Méderlé, I. Bourguin, D. Ensergveix, E. Badell, J. Moniz-Peirein, B. Cicquel, and N. Winter, manuscript in preparation.Transformation of M. tuberculosis strains with this plasmid leads to integration of the entire plasmid into the alaVgene. This plasmid carries the hygromycin resistance gene,hyg, a multicloning site (containing a singleSpeI restriction site) flanked by two transcription terminators, and an origin of replication for E. coli. A 2168-bp fragment was produced by PCR amplification from cosmid MTCY338 using the primers f26C1 and f26C2 (Table I). It contained the predicted fadD26 gene and the 287-bp sequence located upstream from fadD26 and downstream from Rv2929. This fragment was digested with SpeI and inserted into theSpeI site of pOIP23H to give plasmid pLCF26. Similarly,fadD28 (1740 nucleotides) and the intergenic sequence upstream from fadD28 (620 nucleotides) were amplified from cosmid MTCY24G1 using primers f28C1 and f28C3. The amplicon was digested with SpeI and cloned into pOIP23H to give pLCF28. The integrity of genes drrC, fadD26, andfadD28 was checked by sequencing. Bacterial pellicles from 200 ml of 20-day cultures in Sauton medium were used for the isolation of DIM for structural analysis. Cells were collected by pouring off the medium and were inactivated by heating at 95 °C for 2 h. Bacterial pellicles were left in CHCl3/CH3OH (2:1 v/v) at room temperature overnight, and lipids were extracted twice with CHCl3/CH3OH (1:1 v/v), concentrated under vacuum, washed three times with water, and dried. This crude lipid extract was subjected to chromatography on a Florisil (60–100 mesh) column and was eluted with increasing concentrations of diethyl ether (0, 10, 20, 30, 50, and 100%) in petroleum ether. The DIM content of each fraction was determined by TLC on silica gel G 60 plates (20 × 20 cm; Merck) using petroleum ether/diethyl ether (9:1 v/v) as the eluent. Lipid compounds were visualized by spraying the plates with 10% phosphomolybdic acid in ethanol and heating. The DIM-containing fractions (10% diethyl ether in petroleum ether fractions) were pooled, dried, and subjected to chromatography on another Florisil column. Increasing concentrations of diethyl ether (0, 1, 2, 3, 5, 8, 10, and 50%) in petroleum ether were used as eluents to obtain the various members of the DIM family (e.g.dimycocerosates of phthiocerol A (DIMA), dimycocerosates of phthiocerol B (DIMA′), and dimycocerosates of phthiodiolone (DIMB); Fig. 1). Samples of purified DIM (2 mg) were analyzed by NMR spectroscopy. Spectra were recorded on a Bruker AMX-500 spectrometer equiped with an Aspect X32 computer. The samples were dissolved in CDCl3 (99.96 atom % D) and analyzed in 200 × 5-mm 535-PP NMR tubes. One-dimensional1H spectra were recorded at 295 K; 1H chemical shifts were expressed with respect to the internal CHCl3(at 7.27 ppm). Purified DIM samples were also analyzed by mass spectrometry with a linear mode of detection using a VOYAGER DE-STR MALDI-TOF instrument (PerSeptive Biosystems, Framingham, MA). DIM (1 μl of a 1 mg/ml solution) was mixed with 0.5 μl of the matrix solution. The mass spectra were mass assigned using an external calibration. The matrix used was 2,5-dihydroxybenzoic acid (10 mg/ml) in CHCl3/CH3OH (1:1 v/v). The two constituents of DIM, mycocerosic acid residues and phthiocerol and related substances, were structurally characterized as their methyl and O-methylated derivatives, respectively, using the conventional Hakomori procedure. Briefly, 200 μg of DIMs were dissolved in dimethylsulfinyl potassium in dimethyl sulfoxide (200 μl), and the mixture was stirred at room temperature for 4 h. A large excess of CD3I (100 μl) was then added, and the reaction was left for 2 h and stopped by adding 1 ml of H2O and sodium thiosulfate. Fatty acid trideuteriomethyl esters and per-O-deuteriomethylated substances of the phthiocerol family were extracted with CHCl3, washed with water, dried under nitrogen, and dissolved in diethyl ether prior to analysis by gas chromatography (GC) and GC-mass spectrometry (GC-MS). GC was performed on a Girdel series 30 apparatus equipped with an OV1 capillary column (0.30 mm × 25 m) using helium gas (0.7 bar) with a flame ionization detector at 310 °C. The temperature separation program involved an increase from 200 to 310 °C at the rate of 5 °C/min, followed by 10 min at 310 °C. GC-MS analyses were performed on a Hewlett-Packard 5889 X mass spectrometer (electron energy, 70 eV) coupled to a Hewlett-Packard 5890 series II gas chromatograph fitted with a similar OV1 column (0.30 mm × 12 m). GC-MS analyses were performed in both electron impact and chemical ionization modes; in the latter mode, NH3 was used as the reagent gas. We determined the distribution of DIMs in the various cell fractions ofM. tuberculosis using labeled cultures; 20 μCi of sodium [1-14C]propionate (specific activity, 55 Ci/mol; ICN) was added to 100 ml of 16-day cultures of the wild type and insertional mutants of M. tuberculosis that were incubated at 37 °C for 16 h with continuous shaking. Cultures were centrifuged for 10 min at 4000 × g, and culture supernatants were filtered twice through membranes with 0.2-μm pores (Millipore) to remove contaminating cells and concentrated to one-tenth of their initial volume. Half of each bacterial pellet was gently shaken with 10 g of glass beads (4-mm diameter) for 30 s, resuspended in 10 ml of H2O, and centrifuged for 10 min at 4000 ×g. Supernatants were filtered through membranes (0.2-μm pores) to yield the surface-exposed materials (17Ortalo-Magné A. Lemassu A. Lanéelle M.-A. Bardou F. Silve G. Gounon P. Marchal G. Daffé M. J. Bacteriol. 1996; 178: 456-461Crossref PubMed Scopus (207) Google Scholar). Mini glass beads (500 μl; PolyLabo) and 1 ml of H2O were added to the remaining half of each bacterial cell that was disrupted using a mini bead beater for 3 min. Bacterial extracts were centrifuged for 10 min at 5000 × g to eliminate intact cells, and supernatants were recentrifuged for 30 min at 15,000 ×g. The 15,000 × g supernatants corresponded to cytoplasmic and cell membrane components, whereas the corresponding pellets contained mainly cell envelope components. These pellets were washed twice with 1 ml of H2O, and the second washing and the other fractions were kept for isocitrate desydrogenase (ICD) activity assays to check for contamination with cytoplasmic compounds. This enzyme assay was performed as previously described (18Raynaud C. Etienne G. Peyron P. Lanéelle M.-A. Daffé M. Microbiology. 1998; 144: 577-587Crossref PubMed Scopus (90) Google Scholar) using a 100-μg protein equivalent of each fraction. The fractions were first sterilized by filtration through membranes (0.2-μm pores); protein concentration was then determined using the Coomassie Blue reaction (Bio-Rad protein assay). We checked for contamination with the extracellular fraction by performing Western blot analysis as previously described using 30 μg of proteins of the various fractions and antiserum raised against the Erp protein (19Berthet F.-X. Lagranderie M. Gounon P. Laurent-Winter C. Ensergueix D. Chavarot P. Thouron F. Maranghi E. Pelicic V. Portnoı̈ D. Marchal G. Gicquel B. Sciences. 1998; 282: 759-762Crossref PubMed Scopus (177) Google Scholar). In M. bovis BCG, it was found that in liquid medium without Tween, most of the Erp protein was present in the supernatant. 4L. Mendonza-Lima, personal communication. All of the extracts were inactivated by incubation for 2 h at 95 °C before extraction with organic solvents for lipid analysis. Lipids were extracted from the various cell fractions by adding 2 volumes of CH3OH and 1 volume of CHCl3 to 0.8 volume of a given fraction to yield a homogeneous one-phase mixture. The mixture was incubated for 2 h and then partitioned into two phases by adding 1 volume of H2O/CHCl3 (1:1 v/v). The organic phase was recovered, washed twice with water, and dried to yield the subcellular lipid extracts. The various extracts were dissolved in CHCl3 to give a final lipid concentration of 20 mg/ml. Equivalent volumes of each extract were deposited on silica gel G 60 plates (20 × 20 cm; Merck), which were run in petroleum ether/diethyl ether (9:1 v/v). 14C-Labeled lipids were detected by scanning chromatograms with a Berthold LB 2832 TLC linear analyzer. The total number of counts per min recovered in the region corresponding to DIM on TLC was used to determine the amount of DIM in the portion of each fraction analyzed and, consequently, in the whole bacterial compartment of each mycobacterial strain examined (expressed as relative percentages). The drug sensitivity of the wild type strain and its isogenic insertional mutants was determined as described previously (15Jackson M. Raynaud C. Lanéelle M.-A. Guilhot C. Laurent-Winter C. Ensergueix D. Gicquel B. Daffé M. Mol. Microbiol. 1999; 31: 1573-1587Crossref PubMed Scopus (224) Google Scholar). Permeability assays were performed using M. tuberculosis cells in the exponential phase of growth, as described previously (15Jackson M. Raynaud C. Lanéelle M.-A. Guilhot C. Laurent-Winter C. Ensergueix D. Gicquel B. Daffé M. Mol. Microbiol. 1999; 31: 1573-1587Crossref PubMed Scopus (224) Google Scholar). Cells were first labeled by incubation for 16 h with [5,6-3H]uracil (2 × 10−5m, 1.85 TBq mmol−1) in Middlebrook 7H9 medium to quantify the biomass present in the aliquots used in the accumulation assays. They were then collected by centrifugation and washed with 10 mm phosphate buffer (pH 7.4). Aliquots of labeled cells were counted, dried, and weighed to correlate3H labeling with cell dry weight. Assays of accumulation of [14C]chenodeoxycholate (2 × 10−5m, 1.8 GBq mmol−1; purchased from PerkinElmer Life Sciences) were performed under continuous agitation. M. tuberculosisprecultures were grown to mid-logarithmic phase in 7H9 supplemented with ADC and kanamycin (when necessary) and centrifuged, and the cell concentrations were adjusted to allow the inoculation of 10-ml cultures at a final A600 nm of 0.02 with 100 μl of bacterial suspension. For assays of resistance to RNI, NaNO2 (Sigma) was added to a final concentration of 1 or 5 mm, and the pH was adjusted to 5.5. The effect of this pH itself on growth of the various M. tuberculosis strains was monitored by inoculating the standard medium adjusted to pH 5.5 without NaNO2. Cultures were incubated for 10 days, and aliquots were collected after 0, 1, 4, and 10 days of growth. The number of bacteria was evaluated by plating serial dilution on 7H11 medium. For assays of resistance to detergent, SDS was added to a final concentration of 0.01, 0.04, or 0.1%. Cultures were incubated for 9 days, and aliquots were collected after 0, 1, 4, and 9 days of growth. The number of viable bacteria was evaluated by plating serial dilutions on 7H11 medium. In silicoanalysis of the 13 different ORF present in the 50-kb fragment (Fig.2) showed that ORF fadD26 topapA5 were all transcribed in the same orientation and that, based on their predicted start codons, several of these ORF overlapped (11Cole S.T. Brosch R. Parkhill J. Garnier T. Churcher C. Harris D. Gordon S.V. Eiglmeier K. Gas III, S. C. E.B. Tekaia F. Badcock K. Basham D. Brown D. Chillingworth T. Connor R. Davies R. Devlin K. Feltwell T. Gentles S. Hamlin N. Holroyd S. Hornsby