Transgenic RNAi Depletion of Claudin-16 and the Renal Handling of Magnesium
2007; Elsevier BV; Volume: 282; Issue: 23 Linguagem: Inglês
10.1074/jbc.m700632200
ISSN1083-351X
AutoresJianghui Hou, Qixian Shan, Tong Wang, Antonio S. Gomes, Qingshang Yan, David L. Paul, Markus Bleich, Daniel A. Goodenough,
Tópico(s)Trace Elements in Health
ResumoTight junctions play a key role in mediating paracellular ion reabsorption in the kidney. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC) is a human disorder caused by mutations in the tight junction protein claudin-16. However, the molecular mechanisms underlining the renal handling of magnesium and its dysfunction causing FHHNC are unknown. Here we show that claudin-16 plays a key role in maintaining the paracellular cation selectivity of the thick ascending limbs of the nephron. Using RNA interference, we have generated claudin-16-deficient mouse models. Claudin-16 knock-down (KD) mice exhibit chronic renal wasting of magnesium and calcium and develop renal nephrocalcinosis. Our data suggest that claudin-16 forms a non-selective paracellular cation channel, rather than a selective Mg2+/Ca2+ channel as previously proposed. Our study highlights the pivotal importance of the tight junction in renal control of ion homeostasis and provides answer to the pathogenesis of FHHNC. We anticipate our study to be a starting point for more sophisticated in vivo analysis of tight junction proteins in renal functions. Furthermore, tight junction proteins could be major targets of drug development for electrolyte disorders. Tight junctions play a key role in mediating paracellular ion reabsorption in the kidney. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC) is a human disorder caused by mutations in the tight junction protein claudin-16. However, the molecular mechanisms underlining the renal handling of magnesium and its dysfunction causing FHHNC are unknown. Here we show that claudin-16 plays a key role in maintaining the paracellular cation selectivity of the thick ascending limbs of the nephron. Using RNA interference, we have generated claudin-16-deficient mouse models. Claudin-16 knock-down (KD) mice exhibit chronic renal wasting of magnesium and calcium and develop renal nephrocalcinosis. Our data suggest that claudin-16 forms a non-selective paracellular cation channel, rather than a selective Mg2+/Ca2+ channel as previously proposed. Our study highlights the pivotal importance of the tight junction in renal control of ion homeostasis and provides answer to the pathogenesis of FHHNC. We anticipate our study to be a starting point for more sophisticated in vivo analysis of tight junction proteins in renal functions. Furthermore, tight junction proteins could be major targets of drug development for electrolyte disorders. The human renal disorder, familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC, 3The abbreviations used are: FHHNC, familial hypomagnesemia with hypercalciuria and nephrocalcinosis; RNAi, RNA interference; PBS, phosphate-buffered saline; PFA, paraformaldehyde; GFP, green fluorescent protein; shRNA, short hairpin RNAs; siRNA, small interfering RNAs; KD, knock-down; WT, wild type; nt, nucleotides; PTH, parathyroid hormone; NLS, nuclear localization sequence; TAL, thick ascending limb. OMIM 248250), is characterized by progressive renal Mg2+ and Ca2+ wasting, leading to impaired renal function and chronic renal failure. FHHNC is genetically linked to mutations in the gene of claudin-16 (CLDN16, also known as paracellin-1; Ref. 1Simon D.B. Lu Y. Choate K.A. Velazquez H. Al-Sabban E. Praga M. Casari G. Bettinelli A. Colussi G. Rodriguez-Soriano J. McCredie D. Milford D. Sanjad S. Lifton R.P. Science. 1999; 5424: 103-106Crossref Scopus (964) Google Scholar), which is expressed exclusively in the kidney (2Kiuchi-Saishin Y. Gotoh S. Furuse M. Takasuga A. Tano Y. Tsukita S. J. Am Soc. Nephrol. 2002; 13: 875-886Crossref PubMed Google Scholar). The claudins comprise a 22 gene family that encodes essential structural components of the tight junction, the principal regulator of paracellular permeability. In vitro studies have shown that ion selectivity of the paracellular conductance (see review: Ref. 3Anderson J.M. Van Itallie C.M. Fanning A.S. Curr. Opin. Cell Biol. 2004; 16: 140-145Crossref PubMed Scopus (186) Google Scholar) is a complex function of claudin subtype and cellular context (4Hou J. Gomes A.S. Paul D.L. Goodenough D.A. J. Biol. Chem. 2006; 281: 36117-36123Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar, 5Hou J. Paul D.L. Goodenough D.A. J. Cell Sci. 2005; 118: 5109-5118Crossref PubMed Scopus (201) Google Scholar). Thus, in vivo models of FNNHC are essential to our understanding of its pathogenesis. To develop an in vivo model of FNNHC, we have employed transgenic RNA interference (RNAi), which is in theory more rapid and flexible than a conventional knock-out approach. While the use of transgenic RNAi has been limited thus far, it has been shown that an RNAi knockdown of Rasa1 recapitulates a null phenotype in mice (6Kunath T. Gish G. Lickert H. Jones N. Pawson T. Rossant J. Nat. Biotechnol. 2003; 21: 559-561Crossref PubMed Scopus (254) Google Scholar). In addition, transgenic RNAi has been used to establish a role for Ryk in axon guidance (7Lu W. Yamamoto V. Ortega B. Baltimore D. Cell. 2004; 119: 97-108Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar) and a role for Nramp1 in controlling susceptibility to Type 1 diabetes (8Kissler S. Stern P. Takahashi K. Hunter K. Peterson L.B. Wicker L.S. Nat. Genet. 2006; 38: 479-483Crossref PubMed Scopus (108) Google Scholar). We used lentiviral transgenesis because it is more resistant than onco-retroviral transgenesis to epigenetic silencing during embryonic development (9Jaenisch R. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 1260-1264Crossref PubMed Scopus (324) Google Scholar, 10Jahner D. Stuhlmann H. Stewart C.L. Harbers K. Lohler J. Simon I. Jaenisch R. Nature. 1982; 5875: 623-628Crossref Scopus (353) Google Scholar, 11Lois C. Hong E.J. Pease S. Brown E.J. Baltimore D. Science. 2002; 5556: 868-872Crossref Scopus (1618) Google Scholar). In this study, we report the generation of CLDN16-deficient transgenic mouse lines using RNAi and have established physiological functions of CLDN16. We observed homeostatic changes of Mg2+, Ca2+, Na+, and K+ resulting from RNAi-mediated knockdown. The lumen-positive transepithelial potential in the thick ascending limb (TAL) of the nephron drives the reabsorption of Mg2+ and Ca2+ (see review, Ref. 12Greger R. Physiol. Rev. 1985; 65: 760-797Crossref PubMed Scopus (544) Google Scholar). It is generated by the electrogenic NaCl reabsorption and, as a direct consequence of the tubular fluid dilution, it is mainly a diffusion potential between luminal and basolateral extracellular spaces if they are separated by cation-selective tight junctions. We show here that the loss of CLDN16 caused tight junctions in TAL to lose the cation selectivity, leading to the dissipation of the lumen-positive potential with concomitant loss of the driving force for Mg2+ reabsorption. This model is consistent with our in vitro analysis (5Hou J. Paul D.L. Goodenough D.A. J. Cell Sci. 2005; 118: 5109-5118Crossref PubMed Scopus (201) Google Scholar) but strongly contrasts with previous models of CLDN16 function (1Simon D.B. Lu Y. Choate K.A. Velazquez H. Al-Sabban E. Praga M. Casari G. Bettinelli A. Colussi G. Rodriguez-Soriano J. McCredie D. Milford D. Sanjad S. Lifton R.P. Science. 1999; 5424: 103-106Crossref Scopus (964) Google Scholar, 13Kausalya P.J. Amasheh S. Gunzel D. Wurps H. Muller D. Fromm M. Hunziker W. J. Clin. Investig. 2006; 116: 878-891Crossref PubMed Scopus (165) Google Scholar). Furthermore, our study supports the utility of RNAi knockdown (KD) of gene expression in vivo as a complement to traditional gene knock-out approaches. Antibodies, Cell Lines, and Animals—The following antibodies were used in this study: rabbit polyclonal anti-CLDN16 (Zymed Laboratories); fluorescein isothiocyanate-labeled goat anti-rabbit immunoglobulin G (Chemicon). 293T cells (a kind gift from Dr Joan Brugge, Harvard Medical School) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, penicillin/streptomycin, and 1 mm sodium pyruvate. Animals (strain: B6D2F1, CD-1 female foster mice, and CD-1 vasectomized male stud mice) were from Charles River Laboratory. Molecular Cloning and Lentivirus Production—For siRNA studies, the siRNA hairpin oligonucleotides (complementary to the mouse CLDN16 mRNA sequence (GenBank™ AF323748)) were synthesized by Integrated DNA Technologies (IDT, Coralville, IA) and annealed and cloned into the pFUGW lentivirus backbone downstream of the human snRNA U6 or H1 promoter to create the CLDN16 siRNA constructs (4Hou J. Gomes A.S. Paul D.L. Goodenough D.A. J. Biol. Chem. 2006; 281: 36117-36123Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). A set of twelve short hairpin oligonucleotides (shRNAs) were tested in vitro for the ability to efficiently deplete CLDN16 mRNA in cultured primary tubular cells isolated from the renal segment of the thick ascending limb. VSV-G pseudotyped lentivirus were produced in 293T cells and used to inject the single cell mouse embryos at a titer of 1 × 106 units/μl, as described before (11Lois C. Hong E.J. Pease S. Brown E.J. Baltimore D. Science. 2002; 5556: 868-872Crossref Scopus (1618) Google Scholar). Animal Protocols—All mice were bred and maintained according to the Harvard Medical School animal research requirements, and all procedures were approved by the Institutional Animal Research and Care committee. To increase the yield of embryo collection following superovulation in female mice and to facilitate the rapid generation of transgenic animals, we utilized a common hybrid mouse strain (B6D2F1: F1 cross between DBA/2 male and C57BL/6 female) as the donor stain (14Eggan K. Akutsu H. Loring J. Jackson-Grusby L. Klemm M. Rideout 3rd, W.M. Yanagimachi R. Jaenisch R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6209-6214Crossref PubMed Scopus (505) Google Scholar). The transgenic founders were crossed to B6D2F1 wild-type mice, and progeny were analyzed. All mice were fed ad libitum and housed under a 12-h light cycle. Generation of Transgenic Mice Using Lentivirus—Transgenic mice using lentivirus were generated as described (11Lois C. Hong E.J. Pease S. Brown E.J. Baltimore D. Science. 2002; 5556: 868-872Crossref Scopus (1618) Google Scholar). Female donor mice (B6D2F1 hybrid strain) were superovulated with a combination of pregnant mare serum (5 units) and human chorionic gonadotropin (5 units). On average, around 20-30 embryos were collected per female. Approximately 10-100 pl of concentrated lentivirus at 106 units/μl were injected into the perivitelline space of single cell mouse embryos and allowed to develop to 2-cell embryo stage. Around 20 embryos were implanted into each pseudopregnant female (CD-1 strain; 0.5 dpc) and carried to term. The transgenic founder mice and their progeny were identified by direct observation of GFP fluorescence using a hand-head GFP flashlight (Nightsea, MA). Surgical Protocols and Renal Clearance—The methods for preparing mice for renal clearance measurements, for monitoring intra-arterial mean arterial blood pressure, and for collecting urine samples have been previously described (15Bailey M.A. Giebisch G. Abbiati T. Aronson P.S. Gawenis L.R. Shull G.E. Wang T. J. Physiol. 2004; 561: 765-775Crossref PubMed Scopus (42) Google Scholar). Mice were anesthetized by intraperitoneal injection of (5-ethyl-5-(l-methylpropyl)-2-thiobarbituric acid (Inactin, 100 mg kg-1; Sigma)). A tracheotomy was performed, and the jugular vein and carotid artery were catheterized for intravenous infusion and blood sampling. Following surgery, each animal received an intravenous infusion of 140 mm NaCl and 5 mm KHCO3 at 0.5 ml h-1, with [3H]inulin included in the infusate (10 μCi ml-1; 10 μCi of primer). After an equilibration period of 60 min, renal clearance measurements were initiated for a 60-min period. Urine was collected under mineral oil, and a 30-μl blood sample was taken at hourly intervals. Blood pressure was measured at the beginning, middle, and end of each clearance period. Urine and plasma Na+, K+, Mg2+, and Ca2+ concentrations were measured by flame photometry (type 480 Flame Photometer, Corning Medical and Scientific, Corning, NY). Renal Tubule Perfusion—The methods for perfusion and transepithelial measurements in freshly isolated mouse TAL segments were performed as described previously (16Greger R. Pflugers. Arch. 1981; 390: 30-37Crossref PubMed Scopus (163) Google Scholar). The tubule was held and perfused by a concentric glass pipette system. The perfusion pipette was double-barreled with an outer diameter of 10-12 μm. One barrel was used for perfusion, fluid exchange, and voltage measurement. The second barrel was used for constant current injection (13 nA). The collection side consisted of a glass pipette with an inner diameter of 45 μm. Cable equations as described (16Greger R. Pflugers. Arch. 1981; 390: 30-37Crossref PubMed Scopus (163) Google Scholar) were used appropriately to calculate transepithelial resistance Rte. Equivalent short circuit current Isc was calculated from Rte and Vte according to Ohms law. The length constant for a tubular length of at least three times the length constant was calculated with λ =ΔVo × pi × r2/(Io × rho); Vo = voltage deflection at the perfusion side; r = tubular radius, Io = injection current; rho = resistivity of the perfusion solution. The rates of perfusion were 10-20 nl/min. The bath was thermostated at 38 °C. Continuous bath perfusion at 3-5 ml/min was obtained by gravity perfusion. Relative permeabilities were calculated from the observed transepithelial diffusion potentials according to the Goldman equation. Bone Analysis—Femurs were evaluated using a desktop microtomographic imaging system (μCT40, Scanco Medical AG, Bassersdorf, Switzerland) equipped with a 10-mm focal spot microfocus x-ray tube. Transverse CT slices of the distal femoral metaphysis were acquired using 12-μm isotropic voxel size. To assess the trabecular bone parameters for the distal femur, 200 CT slices were acquired, and trabecular bone properties were evaluated in a region starting 0.36 mm proximal to the growth plate and extending 1.8 mm proximally. Images were reconstructed, filtered, and thresholded using a specimen-specific threshold. Morphometric parameters were computed using a direct three-dimensional approach that does not rely on any assumptions about the underlying structure. Measured parameters were expressed according to bone histomorphometry nomenclature (17Parfitt A.M. Drezner M.K. Glorieux F.H. Kanis J.A. Malluche H. Meunier P.J. Ott S.M. Recker R.R. J. Bone Miner. Res. 1987; 2: 595-610Crossref PubMed Scopus (4906) Google Scholar). For trabecular morphology, we assessed the following variables: trabecular bone volume (BV), total bone marrow volume including trabeculae (TV), trabecular thickness (TbTh, μm), trabecular separation (TbSp, μm), trabecular number (TbN, 1/mm) (18Hildebrand T. Ruegsegger P. J. Microscopy. 1997; 185: 67-75Crossref Scopus (1434) Google Scholar), connectivity density (ConnD 1/mm3; measurement of the interconnectivity of the trabecular network; Ref. 19Odgaard A. Gundersen H.J. Bone. 1993; 14: 173-182Crossref PubMed Scopus (573) Google Scholar) and structure model index (SMI; predominance of the shape of the trabeculae; 0 = plate-like; 3 = rod-like; Ref. 20Hildebrand T. Ruegsegger P. Comput. Methods. Biomech. Biomed. Engin. 1997; 1: 15-23Crossref PubMed Scopus (916) Google Scholar). Transverse CT slices were also acquired at the femoral mid-shaft (diaphysis) using 12-μm slice increment (50 μCT slices per specimen). For this cortical region, we assessed the total cross-sectional area, cortical bone area and medullary area (TA, BA, and MA, respectively, mm2), bone area fraction (BA/TA, %), and cortical thickness (μm) (18Hildebrand T. Ruegsegger P. J. Microscopy. 1997; 185: 67-75Crossref Scopus (1434) Google Scholar). Furthermore, bone mineral density (BMD, g/cm2) and bone mineral content (BMC, g) of the whole body was measured using dual-energy x-ray absorptiometry (PIXImus GELunar, Madison, WI). Real-time Quantitative PCR—Gene expression was quantified by real-time quantitative PCR using iQ SYBR green super-mix (Bio-Rad) and the ABI Prism 7700 Sequence Detection System (Applied Biosystems). Total RNA was extracted from the kidney using the TRIzol reagent (Invitrogen). The amount of kidney total RNA for each reaction was adjusted within the range 0.05 to 0.2 μg depending on the gene to ensure that gene expression was within the range of linear correlation between the log (amount of total RNA) and threshold cycle number. The housekeeping gene β-actin was used as an endogenous control, and the expression levels of genes of interest were presented as ratios relative to the expression level of β-actin. The primers annealed to two adjacent exons to avoid amplifying genomic DNA and the primer sequences (5′-end to 3′-end) are summarized as follows: claudin-16, CAAACGCTTTTGATGGGATTC and TTTGTGGGTCATCAGGTAGG; β-actin, CTGCCTGACGGCCAAGTC and CAAGAAGGAAGGCTGGAAAAGA. Hormonal Assays—Mouse serum PTH and 1,25-(OH)2D3 levels were measured using ELISA kits (Alpco Diagnostics) according to the manufacturer's instruction; mouse serum aldosterone measured using ELISA (Alpha Diagnostic). To provide enough serum for separation of 1,25-(OH)2D3 from 25-(OH)D3 by immunochromatography (Alpco Diagnostics), serum from two animals within each group were pooled at 1:1 ratio. In this assay, six mice within each group were sacrificed, and the N is counted as three for statistics. Histology—The Von Kossa staining method was used to demonstrate nephrocalcinosis in kidney (21Sheehan D. Hrapchak B. Theory and Practice of Histotechnology.2nd Ed. Battelle Press, Ohil1980: 226-227Google Scholar). Kidneys from both wild-type and transgenic mice were freshly dissected, fixed with 10% formalin, dehydrated with ethanol and xylene, and embedded into paraffin at 60 °C. 5-μm sections were de-paraffinized using xylene and ethanol and rehydrated. Sections were incubated with 5% silver nitrate, followed by an exposure to UV light and a wash with 5% sodium thiosulfate. Finally, sections were stained with Nuclear Fast Red, dehydrated, and mounted with Permount (Fisher Scientific). Light micrographs were captured using a Spot RT camera mounted on a Nikon E800 photomicroscope. Immunolabeling and Confocal Microscopy—For viewing GFP expression in tissues, mice were anesthetized with ketamine (100 mg/ml) and perfused with 4% paraformaldehyde (PFA) in 0.1 m phosphate-buffered saline (PBS). Tissues were isolated and fixed in 4% PFA at 4 °C overnight, washed three times in PBS, cryoprotected for 24 h in 30% sucrose in PBS, and embedded in OCT prior to cryostat sectioning. Cryostat sections (10 μm) were counterstained with a nuclear marker Hoechst 33258 (0.5 μg/ml) for 10 min and mounted with Mowiol (CalBiochem). For viewing CLDN16 expression and localization, fresh cryostat sections (10 μm) were fixed with cold methanol at -20 °C, followed by blocking with PBS containing 10% fetal bovine serum, incubation with primary antibodies (CLDN16, Zymed Laboratories Inc.; 1:300) and fluorescein isothiocyanate (FITC)-labeled secondary antibodies (1:200). After washing with PBS, slides were mounted with Mowiol. Confocal analyses were performed using the Nikon TE2000 confocal microscopy system equipped with Plan-Neofluar ×40 (NA 1.3 oil) and ×63 (NA 1.4 oil) objectives and krypton-argon laser (488 and 543 lines). For the imaging of FITC, fluorescent images were collected by exciting the fluorophores at 488 nm (FITC) with argon laser. Emissions from FITC were detected with the band-pass FITC filter set of 500-550 nm. All images were converted to JPEG format and arranged using Photoshop 6.0 (Adobe). Protein Electrophoresis and Immunoblotting—Both kidneys from each mouse were homogenized using a Dounce homogenizer in ice cold water containing 250 mm sucrose and 50 mm Tris (pH 8.0), rupturing the membrane of cells. The homogenate was centrifuged in conical tubes at 5,000 × g for 10 min to remove cytosolic proteins. The sediment was resuspended in CSK buffer (150 mm NaCl, 0.5 mm EDTA, 1% Triton X-100, 50 mm Tris-HCl (pH 8.0), 1× protease inhibitor mixture (Pierce)) to extract membrane proteins. 50 μg of membrane protein were subjected to SDS-PAGE under denaturing conditions and transferred to a nitrocellulose membrane followed by blocking with 3% milk, incubation with claudin-16 antibodies (Zymed Laboratories Inc.; 1:1,000) and the horseradish peroxidase-labeled secondary antibody (1:5000), and exposure to an ECL Hyperfilm (Amersham Biosciences). Molecular mass was determined relative to protein markers (Bio-Rad). Statistical Analyses—The significance of differences between groups was tested by ANOVA (Statistica 6.0, Statsoft 2003). When the all-effects F value was significant (p < 0.05), post-hoc analysis of differences between individual groups was made with the Neuman-Keuls test. Values were expressed as mean ± S.E. unless otherwise stated. Lentivirus-directed Transgenesis—To characterize the efficiency of lentiviral transgenesis, we used lentivirus based on the pFUGW vector in which the ubiquitin-C promoter drives expression of GFP (Fig. S1A of supplemental information; Ref. 11Lois C. Hong E.J. Pease S. Brown E.J. Baltimore D. Science. 2002; 5556: 868-872Crossref Scopus (1618) Google Scholar). Lentivirus was injected into the perivitelline space of single cell mouse embryos. Nearly all injected embryos developed to the two-cell stage, at which time they were implanted into pseudopregnant females (0.5 dpc). On average, 50% of the implanted embryos developed to full term. The rate of transgene expression was very high, with >70% of the pups expressing the marker protein GFP (Table 1), consistent with the original study by Lois et al. (11Lois C. Hong E.J. Pease S. Brown E.J. Baltimore D. Science. 2002; 5556: 868-872Crossref Scopus (1618) Google Scholar).TABLE 1Summary of transgenesis, gene expression, and phenotypessiRNA constructTotal number bornNumber of transgenic (visualized by epifluorescence illumination)CLDN16 expressionPhenotypepFUGW75 (71%)Not affectedNormalpUG-U6-756115 (45%)Not affectedNormalpUG-U6-4532411 (46%)Knocked downHypomagnesemia, hypermagnesuria and hypercalciuriapUG-U6-453 (GFP-NLS)206 (30%)Knocked downNDaND, not determined.pUG-H1-45352 (40%)Knocked downHypomagnesemia, hypermagnesuria and hypercalciuriapUG-miR30-453159 (60%)Knocked downHypomagnesemia, hypermagnesuria and hypercalciuriapUG-U6-551179 (53%)Knocked downHypomagnesemia, hypermagnesuria and hypercalciuriapUG-U6-551 (GFP-NLS)123 (25%)Knocked downNDa ND, not determined. Open table in a new tab To express short hairpin RNAs (shRNA) in vivo, we modified pFUGW by inserting a U6 or H1 RNA polymerase III promoter to drive the expression of shRNA hairpins (pUG-U6 or pUG-H1, shown in Fig. S1A). The rate of shRNA transgenesis (assayed by expression of GFP, shown in supplemental Fig. S2) was 25-53% (Table 1). 70% of the pUG-U6 transgenic animals grew normally and did not show any gross differences compared with the wild types in body weight (see Table 2) and longevity (vide infra), while 30% of the transgenic pups (n = 20) were runted or died shortly after birth. Our founder animals exhibited multiple-copy integration (data not shown), consistent with previous studies (11Lois C. Hong E.J. Pease S. Brown E.J. Baltimore D. Science. 2002; 5556: 868-872Crossref Scopus (1618) Google Scholar).TABLE 2Body weight, mean blood pressure, and plasma electrolytes in WT and CLDN16 KD miceGenotypeNaN, number of animals.BWbBW, body weight.BPPNacPNa, PK, PCa, PMg: plasma Na+, K+, Ca2+, and Mg2+ concentrations measured on anesthetized animals during renal clearance study.PKcPNa, PK, PCa, PMg: plasma Na+, K+, Ca2+, and Mg2+ concentrations measured on anesthetized animals during renal clearance study.PMgcPNa, PK, PCa, PMg: plasma Na+, K+, Ca2+, and Mg2+ concentrations measured on anesthetized animals during renal clearance study.PCacPNa, PK, PCa, PMg: plasma Na+, K+, Ca2+, and Mg2+ concentrations measured on anesthetized animals during renal clearance study.gmmHgmmmmmmmmWT925.78 ± 1.2791.91 ± 0.94138.76 ± 2.244.45 ± 0.200.71 ± 0.062.01 ± 0.08KD924.00 ± 1.0071.56 ± 2.24dSignificant difference between WT and KD, p < 0.05.141.59 ± 2.603.68 ± 0.20dSignificant difference between WT and KD, p < 0.05.0.51 ± 0.03dSignificant difference between WT and KD, p < 0.05.2.16 ± 0.04a N, number of animals.b BW, body weight.c PNa, PK, PCa, PMg: plasma Na+, K+, Ca2+, and Mg2+ concentrations measured on anesthetized animals during renal clearance study.d Significant difference between WT and KD, p < 0.05. Open table in a new tab The analysis of pFUGW expression described by Lois et al. (11Lois C. Hong E.J. Pease S. Brown E.J. Baltimore D. Science. 2002; 5556: 868-872Crossref Scopus (1618) Google Scholar) was limited to a small number of tissue and cell types. Thus, it was important to rigorously establish the transgene expression profile and possible gene silencing effects. Because the signal from cytoplasmic GFP was diffuse, it was difficult to distinguish from backgrounds variably present in cryostat sections. To allow unambiguous identification of GFP-positive cells, we modified pUG-U6 by fusing a nuclear localization sequence (NLS) onto the C terminus of GFP (pUG-nlsGFP-U6). A sample of nuclear GFP expression in 10-μm cryostat sections from pUGnls-U6 transgenic mice is presented in Fig. 1 and a comprehensive set in supplemental Fig. S4. GFP was detected in most cells in stomach, duodenum, jejunum, ileum, colon, pancreas, liver, kidney, lung, cerebellum, spinal cord, myocardium, skeleton muscle, skin, lens, cornea, retina, and ciliary epithelium. Typically, GFP expression was observed in all or nearly all cells of a given type. However, expression was silenced in pancreatic fibroblasts and endothelial cells (Fig. 1A), hepatic endothelial and Kupffer cells (Fig. 1B) and germ cells from ovary and testis (Fig. 1, E and F). More selective silencing was observed in the kidney; for example, a single cell within a distal convoluted tubule showed gene silencing, whereas the rest of cells of the same tubule were active in the gene expression (Fig. 1, C and D). To determine the stability of lentiviral expression with age, we examined the patterns of expression in animals at postnatal day 1 as well as 3 weeks, 8 weeks, and 4 months of age. Expression patterns were similar or identical in each case (data not shown). To determine heritability, a similar analysis was performed on founders and 3 subsequent generations (for pUG-U6 and pUG-nlsGFP-U6). No significant differences were observed (data not shown). In Vivo RNA Interference Generated by Expression of shRNA or miRNA—A set of twelve short hairpin oligonucleotides (shRNAs) were tested in vitro for the ability to efficiently deplete CLDN16 mRNA (see "Experimental Procedures"). Each set contained a unique, complementary 19-nt sequence within the coding region of mouse CLDN16 (for diagram of vector topology see supplemental Fig. S1B; Refs. 4Hou J. Gomes A.S. Paul D.L. Goodenough D.A. J. Biol. Chem. 2006; 281: 36117-36123Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar and 22Brummelkamp T.R. Bernards R. Agami R. Science. 2002; 5567: 550-553Crossref Scopus (3968) Google Scholar). ShRNA oligonucleotides were cloned into pUG-U6 or pUG-H1 for lentiviral expression. After infection, transcribed shRNAs are processed into siRNAs by Dicer, and siRNAs are incorporated into an RNA-induced silencing complex which cleaves homologous mRNAs (see review, Ref. 23Hannon G.J. Nature. 2002; 418: 244-251Crossref PubMed Scopus (3524) Google Scholar). Sequence 551 was highly effective in vitro (>100-fold knockdown, see supplemental Fig. S3B). Sequence 453 was equally effective, but sequence 756 was completely ineffective and was used subsequently as the negative control (data not shown). After transgenesis, the analysis of total RNA (supplemental Fig. S3C) and total membrane protein (supplemental Fig. S3D) from mouse kidneys showed that shRNA-mediated depletion of CLDN16 mRNA and protein was highly effective in vivo (>100 fold knockdown). Real-time quantitative RT-PCR was used to determine in vivo expression levels of CLDN16 relative to β-actin (WT: 0.113 ± 0.004, KD: 0.0010 ± 0.0001; n = 3, p < 0.05). Animals transgenic for pUG-U6-551 (supplemental Fig. S3), pUG-U6-453 and pUG-H1-453 (data not shown) showed >100-fold reduction in CLDN16 mRNA levels. Control animals transgenic for pFUGW and pUG-U6-756 showed no effects on CLDN16 expression (data not shown). In WT mouse kidney, CLDN16 was immunolocalized to a subset of tubules extending from outer medulla through cortex and in bundles within cortico-medullary rays (Fig. 2, A and B). This is consistent with previous findings that CLDN16 is expressed exclusively in the thick ascending limbs (TAL) of the loops of Henle (2Kiuchi-Saishin Y. Gotoh S. Furuse M. Takasuga A. Tano Y. Tsukita S. J. Am Soc. Nephrol. 2002; 13: 875-886Crossref PubMed Google Scholar). In pUG-U6-551 transgenic mouse kidneys, CLDN16 staining was completely eliminated (Fig. 2, C and D). Similar results were obtained using pUG-U6-453, pUG-H1-453, and constructs incorporating both shRNA sequences and NLS-eGFP (data not shown). On the other hand, control animals transgenic for pFUGW and pUG-U6-756 showed normal patterns of CLDN16 staining (data not shown). We also tested the efficacy of microRNAs (miRNAs) to suppress CLDN16 expression. MiRNAs are single-stranded RNA molecules of 19-25 nt in length that are generated from endogenous hairpin-shaped transcripts (24Bartel D.P. Cell. 2004; 116: 281-297Abstract Full Text Full Text PDF Pu
Referência(s)