Portal de Periódicos da CAPES

PTCH Mutations in Squamous Cell Carcinoma of the Skin

2001; Elsevier BV; Volume: 116; Issue: 4 Linguagem: Inglês

10.1046/j.1523-1747.2001.01301.x

1523-1747

Ping Xiao, Desirée Ratner, Hong Zhang, Xiu Li Wu, Ming Jian Zhang, Fei Fei Chen, David N. Silvers, Monica Peacocke, Hui C. Tsou,

Nonmelanoma Skin Cancer Studies

Ultraviolet light exposure is the major risk factor for the development of squamous cell carcinoma in Caucasians. Mutations in the tumor suppressor gene p53 have been identified in both squamous cell carcinomas and basal cell carcinomas. The human homolog of the Drosophila patched gene, has been shown to be mutated in sporadic basal cell carcinomas; however, mutations in the patched gene have not been found in squamous cell carcinoma. In this study, we screened a total of 20 squamous cell carcinoma samples for mutations in the patched gene. Using polymerase chain reaction–single strand conformation polymorphism as an initial screening method, we identified one non-sense mutation, two mis-sense mutations and three silent mutations in five squamous cell carcinoma samples. In one squamous cell carcinoma sample, we identified a tandem GG→AA transitional change at nucleotide 3152 in exon 18 of the patched gene that resulted in a premature stop codon at codon 1051. The three squamous cell carcinoma samples containing non-sense and mis-sense mutations were isolated from individuals with histories of multiple basal cell carcinoma. Sequence analysis of the p53 gene in these five squamous cell carcinoma samples identified one CC→TT and three C→T ultraviolet-specific nucleotide changes. Our study provides evidence that the patched gene is mutated in squamous cell carcinoma from individuals with a history of multiple basal cell carcinoma. The identification of ultraviolet-specific nucleotide changes in both tumor suppressor genes supports the notion that ultraviolet exposure plays an important part in the development of squamous cell carcinoma. Ultraviolet light exposure is the major risk factor for the development of squamous cell carcinoma in Caucasians. Mutations in the tumor suppressor gene p53 have been identified in both squamous cell carcinomas and basal cell carcinomas. The human homolog of the Drosophila patched gene, has been shown to be mutated in sporadic basal cell carcinomas; however, mutations in the patched gene have not been found in squamous cell carcinoma. In this study, we screened a total of 20 squamous cell carcinoma samples for mutations in the patched gene. Using polymerase chain reaction–single strand conformation polymorphism as an initial screening method, we identified one non-sense mutation, two mis-sense mutations and three silent mutations in five squamous cell carcinoma samples. In one squamous cell carcinoma sample, we identified a tandem GG→AA transitional change at nucleotide 3152 in exon 18 of the patched gene that resulted in a premature stop codon at codon 1051. The three squamous cell carcinoma samples containing non-sense and mis-sense mutations were isolated from individuals with histories of multiple basal cell carcinoma. Sequence analysis of the p53 gene in these five squamous cell carcinoma samples identified one CC→TT and three C→T ultraviolet-specific nucleotide changes. Our study provides evidence that the patched gene is mutated in squamous cell carcinoma from individuals with a history of multiple basal cell carcinoma. The identification of ultraviolet-specific nucleotide changes in both tumor suppressor genes supports the notion that ultraviolet exposure plays an important part in the development of squamous cell carcinoma. patched smoothened single strand conformation polymorphism xeroderma pigmentosum Cutaneous squamous cell carcinoma (SCC) is the second most common skin cancer and occurs most frequently in Caucasians (Johnson et al., 1992Johnson T.M. Rowe D.E. Nelson B.R. Swanson N.A. Squamous cell carcinoma of the skin (excluding lip and oral mucosa).J Am Acad Dermatol. 1992; 26: 467-484Abstract Full Text PDF PubMed Scopus (313) Google Scholar;Preston and Stern, 1992Preston D.S. Stern R.S. Nonmelanoma cancers of the skin [see comments].N Engl J Med. 1992; 327: 1649-1662Crossref PubMed Scopus (451) Google Scholar). Sunlight exposure has been linked directly to the development of SCC in individuals with fair skin, as most SCC occur on heavily sun-exposed sites (Johnson et al., 1992Johnson T.M. Rowe D.E. Nelson B.R. Swanson N.A. Squamous cell carcinoma of the skin (excluding lip and oral mucosa).J Am Acad Dermatol. 1992; 26: 467-484Abstract Full Text PDF PubMed Scopus (313) Google Scholar;Marks, 1996Marks R. Squamous cell carcinoma.Lancet. 1996; 347: 735-738PubMed Scopus (106) Google Scholar). Other risk factors for the development of SCC include immunosuppression, arsenic exposure, ionizing radiation, and chronically injured or diseased skin (Cohen et al., 1987Cohen E.B. Komorowski R.A. Clowry L.J. Cutaneous complications in renal transplant recipients.Am J Clin Pathol. 1987; 88: 32-37PubMed Google Scholar;Bernstein et al., 1996Bernstein S.C. Lim K.K. Brodland D.G. Heidelberg K.A. The many faces of squamous cell carcinoma.Dermatol Surg. 1996; 22: 243-254Crossref PubMed Google Scholar;Mittelbronn et al., 1998Mittelbronn M.A. Mullins D.L. Ramos-Caro F.A. Flowers F.P. Frequency of pre-existing actinic keratosis in cutaneous squamous cell carcinoma.Int J Dermatol. 1998; 37: 677-681Crossref PubMed Scopus (177) Google Scholar;Wong et al., 1998Wong S.S. Tan K.C. Goh C.L. Cutaneous manifestations of chronic arsenicism: review of seventeen cases.J Am Acad Dermatol. 1998; 38: 179-185Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). In contrast to basal cell carcinoma (BCC), which has no precursor lesions, SCC can arise from actinic keratoses and Bowen's disease (carcinoma in situ) (Brash and Ponten, 1998Brash D.E. Ponten J. Skin precancer.Cancer Surv. 1998; 32: 69-113PubMed Google Scholar). Germline mutations in the human homolog of the Drosophila patched gene, PTCH, were demonstrated in individuals with nevoid BCC syndrome (Hahn et al., 1996Hahn H. Wicking C. Zaphiropoulous P.G. et al.Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome.Cell. 1996; 85: 841-851Abstract Full Text Full Text PDF PubMed Scopus (1683) Google Scholar;Johnson et al., 1996Johnson R.L. Rothman A.L. Xie J. et al.Human homolog of patched, a candidate gene for the basal cell nevus syndrome.Science. 1996; 272: 1668-1671Crossref PubMed Scopus (1636) Google Scholar). Subsequently, somatic mutations in the PTCH gene were identified in 20–30% of the sporadic BCC studied (Chidambaram et al., 1996Chidambaram A. Goldstein A.M. Gailani M.R. et al.Mutations in the human homologue of the Drosophila patched gene in Caucasian and African-American nevoid basal cell carcinoma syndrome patients.Cancer Res. 1996; 56: 4599-4601PubMed Google Scholar;Gailani et al., 1996Gailani M.R. Stahle-Backdahl M. Leffell D.J. et al.The role of the human homologue of Drosophila patched in sporadic basal cell carcinomas [see comments].Nat Genet. 1996; 14: 78-81Crossref PubMed Scopus (661) Google Scholar;Hahn et al., 1996Hahn H. Wicking C. Zaphiropoulous P.G. et al.Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome.Cell. 1996; 85: 841-851Abstract Full Text Full Text PDF PubMed Scopus (1683) Google Scholar;Johnson et al., 1996Johnson R.L. Rothman A.L. Xie J. et al.Human homolog of patched, a candidate gene for the basal cell nevus syndrome.Science. 1996; 272: 1668-1671Crossref PubMed Scopus (1636) Google Scholar;Unden et al., 1996Unden A.B. Holmberg E. Lundh-Rozell B. Stahle-Backdahl M. Zaphiropoulos P.G. Toftgard R. Vorechovsky I. Mutations in the human homologue of Drosophila patched (PTCH) in basal cell carcinomas and the Gorlin syndrome: different in vivo mechanisms of PTCH inactivation.Cancer Res. 1996; 56: 4562-4565PubMed Google Scholar;Wolter et al., 1997Wolter M. Reifenberger J. Sommer C. Ruzicka T. Reifenberger G. Mutations in the human homologue of the Drosophila segment polarity gene patched (PTCH) in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumors of the central nervous system.Cancer Res. 1997; 57: 2581-2585PubMed Google Scholar;Aszterbaum et al., 1998Aszterbaum M. Rothman A. Johnson R.L. et al.Identification of mutations in the human PATCHED gene in sporadic basal cell carcinomas and in patients with the basal cell nevus syndrome.J Invest Dermatol. 1998; 110: 885-888https://doi.org/10.1046/j.1523-1747.1998.00222.xCrossref PubMed Scopus (253) Google Scholar). Somatic mutations in the PTCH gene were also identified in tumors derived from brain, breast, bladder, and esophageal tissues with an average frequency of 3–10% of the samples studied (Xie et al., 1997Xie J. Johnson R.L. Zhang X. et al.Mutations of the PATCHED gene in several types of sporadic extracutaneous tumors.Cancer Res. 1997; 57: 2369-2372PubMed Google Scholar;Wolter et al., 1997Wolter M. Reifenberger J. Sommer C. Ruzicka T. Reifenberger G. Mutations in the human homologue of the Drosophila segment polarity gene patched (PTCH) in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumors of the central nervous system.Cancer Res. 1997; 57: 2581-2585PubMed Google Scholar;Maesawa et al., 1998Maesawa C. Tamura G. Iwaya T. et al.Mutations in the human homologue of the Drosophila patched gene in esophageal squamous cell carcinoma.Genes Chromosomes Cancer. 1998; 21: 276-279https://doi.org/10.1002/(sici)1098-2264(199803)21:3 3.0.co;2-nCrossref PubMed Scopus (0) Google Scholar;McGarvey et al., 1998McGarvey T.W. Maruta Y. Tomaszewski J.E. Linnenbach A.J. Malkowicz S.B. PTCH gene mutations in invasive transitional cell carcinoma of the bladder.Oncogene. 1998; 17: 1167-1172Crossref PubMed Scopus (76) Google Scholar). Loss of heterozygosity on chromosome 9q22.3, where the PTCH gene is located, has been shown in SCC (Ahmadian et al., 1998Ahmadian A. Ren Z.P. Williams C. et al.Genetic instability in the 9q22.3 region is a late event in the development of squamous cell carcinoma.Oncogene. 1998; 17: 1837-1843Crossref PubMed Scopus (44) Google Scholar;Eklund et al., 1998Eklund L.K. Lindstrom E. Unden A.B. et al.Mutation analysis of the human homologue of Drosophila patched and the xeroderma pigmentosum complementation group A genes in squamous cell carcinomas of the skin.Mol Carcinog. 1998; 21: 87-92https://doi.org/10.1002/(sici)1098-2744(199802)21:2 3.0.co;2-lCrossref PubMed Scopus (0) Google Scholar); however, one study of 14 SCC samples failed to reveal any PTCH mutations (Eklund et al., 1998Eklund L.K. Lindstrom E. Unden A.B. et al.Mutation analysis of the human homologue of Drosophila patched and the xeroderma pigmentosum complementation group A genes in squamous cell carcinomas of the skin.Mol Carcinog. 1998; 21: 87-92https://doi.org/10.1002/(sici)1098-2744(199802)21:2 3.0.co;2-lCrossref PubMed Scopus (0) Google Scholar). Increased incidence of SCC has been observed in ultraviolet (UV) -irradiated PTCH heterozygous knockout mice (Aszterbaum et al., 1999Aszterbaum M. Epstein J. Oro A. Douglas V. LeBott P. Scott M.P. Epstein Jr, Eh Ultraviolet and ionizing radiation enhance the growth of BCC and trichoblastomas in Patched heterozygous knockout mice.Nat Med. 1999; 5: 1285-1291https://doi.org/10.1038/15242Crossref PubMed Scopus (345) Google Scholar). Interestingly, these SCC retained their PTCH wild-type allele. In this study, we screened a total of 20 SCC samples for mutations in the PTCH gene. Polymerase chain reaction–single strand conformation polymorphism (PCR–SSCP) was used as an initial screening method, and PCR products showing SSCP variants were then sequenced to confirm the mutation. Paraffin sections containing tumor tissue were placed into 1.5 ml microcentrifuge tubes and washed in xylene three times for 30 min each. The sections were then digested in a buffer with proteinase K (provided in the QiAamp tissue kit, Qiagen, Valencia, CA) at 55°C overnight. The tumor genomic DNA was then extracted following the instructions and using columns provided by the QiAamp Tissue Kit from Qiagen. SSCP–PCR reaction mixtures containing 25 ng of each primer, 22.5 μl of Platinum PCR supermix (Life Technology, Rockville, MD) and 0.5 μl of [33P]deoxycytidine triphosphate (NEN, Boston, MA) were subjected to 30 cycles of PCR amplification. After thermal cycling, 1 μl of PCR product was added to 10 μl of stop solution (95% formamide; 10 mM NaOH, 0.25% bromophenol blue, and 0.25% xylene cyanol). The mixtures were heated to 94°C for 3 min and placed on ice immediately. Three microliters of the denatured mixtures were loaded on to a 0.5 × Mutation Detection Enhancement gel solution (FMC Bioproducts, Rockland, ME) with 10% glycerol and run at 10 W for 20 h at room temperature. PCR products with SSCP variants were sequenced using a BigDye terminator cycle sequencing kit (ABI, Columbia, MD) and were then run on an Applied Biosystem 310 automated sequencing system (Applied Biosystems, Foster City, CA). A set of 20 pairs of primers flanking exon 3 to exon 23 of the PTCH gene, as previously described (Hahn et al., 1996Hahn H. Wicking C. Zaphiropoulous P.G. et al.Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome.Cell. 1996; 85: 841-851Abstract Full Text Full Text PDF PubMed Scopus (1683) Google Scholar;Xie et al., 1997Xie J. Johnson R.L. Zhang X. et al.Mutations of the PATCHED gene in several types of sporadic extracutaneous tumors.Cancer Res. 1997; 57: 2369-2372PubMed Google Scholar), was used to amplify tumor genomic DNA. These PCR amplicons were then subjected to an SSCP–PCR reaction with the nested primers. PCR products containing SSCP variants were then sequenced and analyzed on an Applied Biosystems model 310 DNA sequencer. Mutations were confirmed with repeated PCR and sequence reactions starting from genomic DNA. Each tumor sample was screened for mutations in exon 4 to exon 8 of the p53 gene by direct sequencing analysis. Genomic DNA from each tumor was subjected to PCR amplification with primers flanking each exon of the p53 gene (Table I). The resulting amplicons were then sequenced and analyzed on an Applied Biosystems model 310 DNA sequencer. Each mutation was confirmed by new PCR and sequence reactions starting from genomic DNA.Table IPrimers for the the p53 geneExon 4AATGGATGATTTGATGCTGTCCCCTCAGGGCAACTGACCGTGCExon 5TTCCTCTTCCTGCAGTACTCGCCCCAGCTGCTCACCATCGExon 6CTGATTGCTCTTAGGTCTGGAGTTGCAAACCAGACCTCAGExon 7GTGTTGTCTCCTAGGTTGGCAAGTGGCTCCTGACCTGGAGExon 8AGTGGTAATCTACTGGGACGATTCTCCATCCAGTGGTTTC Open table in a new tab The hematoxylin and eosin sections from each of the 20 tumors were reviewed and the diagnosis of SCC was confirmed. The paraffin sections used in this study contain over 50% of tumor tissues. Three SCC samples, S006, DS17, and Ap85, were isolated from individuals with histories of multiple BCC. These three individuals were over 70 and the multiple BCC were caused by accumulation of UV damage, and do not represent familial cases. Genomic DNA isolated from each SCC sample was amplified with primers flanking the coding sequences of the PTCH gene. PCR–SSCP analysis was performed and six SSCP variants were detected in DNA from five SCC samples. Sequence analysis of these SSCP variants revealed one tandem nucleotide change and five single nucleotide changes. A tandem GG→AA transitional change at nucleotides 3152–3153 in exon 18 of the PTCH gene was detected in SCC sample S006, resulting in a premature stop codon at codon 1051 (see Figure 1). S006 is a poorly differentiated SCC with an abundant mitosis that was isolated from the lower back of a 77 y old Caucasian male. The wild-type allele of the PTCH gene was lost in this poorly differentiated tumor. Sequence analysis of DNA from the adjacent normal skin did not reveal the same PTCH mutation. In SCC samples, DS17 and Ap85, we detected two single nucleotide changes, resulting in mis-sense mutations in exon 15 and exon 22, respectively (see Table II). These tumors were isolated from two Caucasian males in their seventies with a history of multiple BCC. In addition, we detected three single nucleotide changes in coding sequences of the PTCH gene that did not result in any amino acid substitutions (see Table II). The wild-type alleles of the PTCH gene were present in SCC samples containing these five single nucleotide changes. The adjacent normal tissues in three SCC samples (Ap128, Ap85, and S060) showed no nucleotide changes. We were not able to obtain the corresponding normal tissue for tumor DS 17. All five single nucleotide changes occurred on bases that are conserved and not detected in 40 normal control alleles, suggesting that they were not sequence polymorphisms.Table IIPTCH and p53 mutationsNo.SexAgeSitePTCHp53ExNucleotideEffectExNucelotideEffectS006M77Left lower back183152-3GG→ααW1051XDS17M73Left anterial shoulder152485G→αV828MAp85M78Right forehead152334G→AT778T6560–1,560CC→TTsplice site mutation and G187L223742G→AE1242KS060M58Left cheek121725C→TL575L4 5 6238C→T 535C→T 586C→TP80S H179Y R196XAP128M61Left nasal sidewall193240C→TA1080A Open table in a new tab Most PTCH mutations identified in nevoid BCC syndrome individuals and sporadic BCC resulted in truncated PTCH proteins (Wicking et al., 1997Wicking C. Shanley S. Smyth I. et al.Most germ-line mutations in the nevoid basal cell carcinoma syndrome lead to a premature termination of the PATCHED protein, and no genotype-phenotype correlations are evident.Am J Hum Genet. 1997; 60: 21-26PubMed Google Scholar). Of the three PTCH mutations identified in the SCC samples from this study, only one was a tandem nucleotide change, resulting in a truncated PTCH protein. The other two were single nucleotide changes that led to mis-sense mutations. All five nucleotide changes detected in this study occurred on bases that are conserved, and the functional significance of these nucleotide changes is unclear. Two of the five SCC samples with nucleotide changes in the PTCH gene, also contained UV specific changes in the p53 gene. Over 50% of SCC examined to date have mutations in the p53 gene, most of them UV specific mutations (Brash et al., 1991Brash D.E. Rudolph J.A. Simon J.A. et al.A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma.Proc Natl Acad Sci USA. 1991; 88: 10124-10128Crossref PubMed Scopus (1730) Google Scholar;Kubo et al., 1994Kubo Y. Urano Y. Yoshimoto K. Iwahana H. Fukuhara K. Arase S. Itakura M. p53 gene mutations in human skin cancers and precancerous lesions: comparison with immunohistochemical analysis.J Invest Dermatol. 1994; 102: 440-444Abstract Full Text PDF PubMed Google Scholar). The prevalence of UV-specific p53 mutations in SCC is higher than in BCC, suggesting that UV irradiation is more directly linked to the development of SCC than BCC. A study using PTCH heterozygous mice showed a direct UV effect in the development of SCC in these animals (Aszterbaum et al., 1999Aszterbaum M. Epstein J. Oro A. Douglas V. LeBott P. Scott M.P. Epstein Jr, Eh Ultraviolet and ionizing radiation enhance the growth of BCC and trichoblastomas in Patched heterozygous knockout mice.Nat Med. 1999; 5: 1285-1291https://doi.org/10.1038/15242Crossref PubMed Scopus (345) Google Scholar). The six nucleotide changes detected in our SCC samples, two C→T, one GG→AA, and three G→A nucleotide changes in the PTCH gene, are known to be UV specific. Furthermore, three SCC samples containing PTCH mutations were isolated from individuals who are over the age of 70 and with sun-damaged skin (evident by a history of multiple BCC). Our data confirmed the observation that UV exposure plays an important part in the development of SCC. In conclusion, our study provides evidence that the PTCH gene is mutated in a subset of SCC from individuals with a history of multiple BCC. We identified PTCH mutations in 15% (three of 20) of SCC samples studied. Three of the six nucleotide changes were silent mutations. We speculate that they might be one of the multiple changes contributing to the development of SCC in sun-damaged skin. The role of the PTCH gene in the development of SCC needs to be further explored. This work was supported by grants from the National Institute of Arthritis and Musculoskeletal and Skin Diseases (P30 AR44535, Skin Disease Research Center, P & F project to H.C.T.) and the National Institution of Aging (AG00760 to H.C.T. and AG00694 to M.P.).