Transcriptional Induction of Collagenase-1 in Differentiated Monocyte-like (U937) Cells is Regulated by AP-1 and an Upstream C/EBP-β Site
1997; Elsevier BV; Volume: 272; Issue: 18 Linguagem: Inglês
10.1074/jbc.272.18.11840
ISSN1083-351X
AutoresGlenn A. Doyle, Richard A. Pierce, William C. Parks,
Tópico(s)Cancer-related gene regulation
ResumoIn this report, we demonstrate that the AP-1 site and a distal promoter element regulate transcriptional induction of collagenase-1 during monocytic differentiation. Chloramphenicol acetyltransferase expression constructs containing regions of the human collagenase-1 promoter were stably or transiently transfected into U937 cells, and reporter activity was assessed at various times after the onset of phorbol 12-myristate 13-acetate (PMA)-mediated differentiation. Rapid and strong induction of promoter activity was lost in constructs with a mutant AP-1 element; however, at 16–96 h post-PMA, the mutant collagenase-1 promoter displayed AP-1 independent PMA-mediated transactivation. The AP-1 mutant constructs also showed delayed transcriptional activation in PMA-treated fibroblasts. Western and supershift analyses indicated that functional Jun and Fos proteins were present in nuclear extracts of PMA-differentiated U937 cells. Promoter deletion constructs demonstrated the potential role of distal promoter sequences in regulating collagenase-1 transcription. In particular, Western, supershift, and promoter deletion analyses suggested a role for CCAAT/enhancer-binding protein-β (C/EBP-β) binding site between −2010 and −1954 in regulating transcription of collagenase-1 in monocytic cells. Our findings suggest that distinct regulatory elements, acting somewhat independently of each other, control expression of collagenase-1. In addition, our data suggests that the rapid PMA-mediated induction of collagenase-1 transcription is controlled by a mechanism distinct from that regulating the sustained expression of this proteinase in activated macrophages. In this report, we demonstrate that the AP-1 site and a distal promoter element regulate transcriptional induction of collagenase-1 during monocytic differentiation. Chloramphenicol acetyltransferase expression constructs containing regions of the human collagenase-1 promoter were stably or transiently transfected into U937 cells, and reporter activity was assessed at various times after the onset of phorbol 12-myristate 13-acetate (PMA)-mediated differentiation. Rapid and strong induction of promoter activity was lost in constructs with a mutant AP-1 element; however, at 16–96 h post-PMA, the mutant collagenase-1 promoter displayed AP-1 independent PMA-mediated transactivation. The AP-1 mutant constructs also showed delayed transcriptional activation in PMA-treated fibroblasts. Western and supershift analyses indicated that functional Jun and Fos proteins were present in nuclear extracts of PMA-differentiated U937 cells. Promoter deletion constructs demonstrated the potential role of distal promoter sequences in regulating collagenase-1 transcription. In particular, Western, supershift, and promoter deletion analyses suggested a role for CCAAT/enhancer-binding protein-β (C/EBP-β) binding site between −2010 and −1954 in regulating transcription of collagenase-1 in monocytic cells. Our findings suggest that distinct regulatory elements, acting somewhat independently of each other, control expression of collagenase-1. In addition, our data suggests that the rapid PMA-mediated induction of collagenase-1 transcription is controlled by a mechanism distinct from that regulating the sustained expression of this proteinase in activated macrophages. Remodeling of the extracellular matrix during normal development and in response to tissue injury and inflammation is thought to be accomplished, in part, by the properly regulated production of matrix metalloproteinases (MMPs). 1The abbreviations used are: MMP, matrix metalloproteinase; PMA, phorbol 12-myristate 13-acetate; C/EBP-β, CCAAT/enhancer-binding protein-β; kb, kilobase(s); TK, thymidine kinase; CAT, chloramphenicol acetyltransferase; PCR, polymerase chain reaction; CAPS, 3-(cyclohexylamino)propanesulfonic acid. As a group, these enzymes can degrade essentially all extracellular matrix components, and hence, they have been implicated in normal remodeling processes, such as uterine involution, blastocyst implantation, angiogenesis, and wound healing (for review, see Refs. 1Mignatti P. Rifkin D.B. Welgus H.G. Parks W.C. Clark R.A.F. The Molecular and Cellular Biology of Wound Repair. Plenum Press, New York1996: 427-474Google Scholar, 2Birkedal-Hansen H. Moore W.G.I. Bodden M.K. Windsor L.J. Birkedal-Hansen B. DeCarlo A. Engler J.A. Crit. Rev. Oral Biol. Med. 1993; 4: 197-250Google Scholar, 3Matrisian L.M. BioEssays. 1992; 14: 455-463Google Scholar). However, inappropriate expression of these proteinases is thought to contribute to the pathogenesis of various conditions, such as arthritis (4Brinckerhoff C.E. Crit. Rev. Eukaryotic Gene Expression. 1992; 2: 145-164Google Scholar, 5McCachren S.S. Haynes B.F. Niedel J.E. J. Clin. Immunol. 1990; 10: 19-27Google Scholar), vascular disease (6Halpert I. Roby J.D. Sires U.I. Potter-Perigo S. Wight T.N. Welgus H.G. Shapiro S.D. Wickline S.A. Parks W.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9748-9753Google Scholar, 7Libby P. Circulation. 1995; 91: 2844-2850Google Scholar, 8Thompson R.W. Holmes D.R. Mertens R.A. Liao S. Botney M.D. Mecham R.P. Welgus H.G. Parks W.C. J. Clin. Invest. 1995; 96: 318-327Google Scholar), metastasis (3Matrisian L.M. BioEssays. 1992; 14: 455-463Google Scholar), and destructive skin diseases (9Parks W.C. Sires U.I. Curr. Opin. Dermatol. 1996; 3: 240-247Google Scholar). Notably, collagenase-1 has been localized to resident and infiltrating inflammatory cells in many of these conditions (5McCachren S.S. Haynes B.F. Niedel J.E. J. Clin. Immunol. 1990; 10: 19-27Google Scholar, 7Libby P. Circulation. 1995; 91: 2844-2850Google Scholar,10Nikkari S.T. O'Brien K.D. Ferguson M. Hatsukami T. Welgus H.G. Alpers C.E. Clowes A.W. Circulation. 1995; 92: 1393-1398Google Scholar, 11Saarialho-Kere U.K. Chang E.S. Welgus H.G. Parks W.C. J. Invest. Dermatol. 1993; 100: 335-342Google Scholar, 12Saarialho-Kere U.K. Vaalamo M. Karjalainen-Lindsberg M.-L. Airola K. Parks W.C. Puolakkainen P. Am. J. Pathol. 1996; 148: 519-526Google Scholar). Although extracellular matrix proteins can be degraded by various proteinases, fibrillar type I collagen, the most abundant protein in the body, is resistant to degradation by most enzymes. Collagen degradation is initiated by the catalytic activity of collagenases, a subgroup of the MMP gene family with the unique ability to cleave fibrillar collagens type I, II, and III within their triple helical domain (13Jeffrey J.J. Mecham R.P. Regulation of Matrix Accumulation. Academic Press, Inc., New York1986: 53-98Google Scholar). At physiological temperature, cleaved collagen molecules denature and become susceptible to complete digestion by other proteinases. Of the three known human metallo-collagenases, collagenase-1 (MMP-1) seems to be the enzyme that is principally responsible for collagen turnover in most human tissues. In a variety of normal and disease-associated tissue remodeling events, collagenase-1 is expressed by macrophages as well as by epithelial cells, fibroblasts, endothelial cells, and chondrocytes (14Fisher C. Gilbertson-Beadling S. Powers E.A. Petzold G. Poorman R. Mitchell M.A. Dev. Biol. 1994; 162: 499-510Google Scholar, 15Galis Z.S. Sukhova G.K. Lark M.W. Libby P. J. Clin. Invest. 1994; 94: 2493-2503Google Scholar, 16Saarialho-Kere U.K. Kovacs S.O. Pentland A.P. Olerud J. Welgus H.G. Parks W.C. J. Clin. Invest. 1993; 92: 2858-2866Google Scholar, 17Stricklin G.P. Li L. Jancic V. Wenczak B.A. Nanney L.B. Am. J. Pathol. 1993; 143: 1657-1666Google Scholar, 18Wolfe G.C. MacNaul K.L. Beuchel F.F. McDonnell J. Hoerrner L.A. Lark M.W. Moore V.L. Hutchinson N.I. Arthritis Rheum. 1993; 36: 1457-1540Google Scholar). Collagenase-2 (MMP-8) is found only in neutrophils and chondrocytes (19Chubinskaya S. Huch K. Mikecz K. Cs-Szabo G. Hasty K.A. Kuettner K.E. Cole A.A. Lab. Invest. 1996; 74: 232-240Google Scholar, 20Hasty K.A. Pourmotabbed T.F. Goldberg G.I. Thompson J.P. Spinella D.G. Stevens R.M. Mainardi C.L. J. Biol. Chem. 1990; 265: 11421-11424Google Scholar), and collagenase-3 (MMP-13), originally cloned from a breast carcinoma line (21Freije J. Diez-Itza I. Balbin M. Sanchez L.M. Blasco R. Tolivia J. Lopez-Otin C. J. Biol. Chem. 1994; 269: 16766-16773Google Scholar), is also expressed in articular cartilage (22Mitchell P.G. Magna H.A. Reeves L.M. Lopresti-Morrow L.L. Yocum S.A. Rosner P.J. Geoghegan K.F. Hambor J.E. J. Clin. Invest. 1996; 97: 761-768Google Scholar, 23Reboul P. Pelletier J.P. Tardif G. Cloutier J.M. Martel-Pelletier J. J. Clin. Invest. 1996; 97: 2011-2019Google Scholar) and developing bone (24Gack S. Vallon R. Schmidt J. Grigoriadis A. Tuckermann J. Schenkel J. Weiher H. Wagner E.F. Angel P. Cell Growth Differ. 1995; 6: 759-767Google Scholar). Many agents, such as PMA, bacterial endotoxin (lipopolysaccharide), and proinflammatory cytokines, and events, such as contact with type I collagen and activated T-cells, induce or markedly stimulate collagenase-1 transcription in macrophages (25Lacraz S. Isler P. Vey E. Welgus H.G. Dayer J.-M. J. Biol. Chem. 1994; 269: 22027-22033Google Scholar, 26Pierce R.A. Sandefur S. Doyle G.A.R. Welgus H.G. J. Clin. Invest. 1996; 97: 1890-1899Google Scholar, 27Saarialho-Kere U.K. Welgus H.G. Parks W.C. J. Biol. Chem. 1993; 268: 17354-17361Google Scholar, 28Shapiro S.D. Kobayashi D.K. Pentland A.P. Welgus H.G. J. Biol. Chem. 1993; 268: 8170-8175Google Scholar). Much of what is known about the transcriptional regulation of collagenase-1 points to a critical role for the AP-1 site at −72 to −66 in the human promoter. AP-1 elements bind dimers of the Jun (c-Jun, JunB, and JunD) and Fos (c-Fos, FosB, Fra-1, and Fra-2) families of transcription factors (29Nakabeppu Y. Ryder K. Nathans D. Cell. 1988; 55: 907-915Google Scholar). Angel et al. (30Angel P. Baumann I. Stein B. Delius H. Rahmsdorf H.J. Herrlich P. Mol. Cell. Biol. 1987; 7: 2256-2266Google Scholar) first demonstrated that the AP-1 site is necessary and sufficient to confer PMA-mediated induction of the native collagenase-1 promoter or of a heterologous promoter containing this element. However, because the level of PMA-mediated induction was greater with larger collagenase-1 promoter constructs, they concluded that elements upstream of the AP-1 site might also be important in regulating collagenase-1. Indeed, the AP-1 site, the polyoma enhancer A-binding protein-3 site (−91 to −83) and the "TTCA" element (−105 to −102) are also required for full PMA-mediated induction in fibroblasts (31Auble D.T. Brinckerhoff C.E. Biochemistry. 1991; 30: 4629-4635Google Scholar, 32Gutman A. Wasylyk EMBO J. 1990; 9: 2241-2246Google Scholar). We assessed the requirement of the AP-1 site and more distal promoter sequences to collagenase-1 gene activation during and subsequent to monocytic differentiation. We used PMA-treated U937 cells as anin vitro model because they mimic the differentiation of monocytes into macrophages (33Harris P. Ralph P. J. Leukocyte Biol. 1985; 37: 407-422Google Scholar) and because activation of collagenase-1 expression in these cells occurs strictly by a transcriptional mechanism (27Saarialho-Kere U.K. Welgus H.G. Parks W.C. J. Biol. Chem. 1993; 268: 17354-17361Google Scholar, 34Shapiro S.D. Doyle G.A.R. Ley T.J. Parks W.C. Welgus H.G. Biochemistry. 1993; 32: 4286-4292Google Scholar). We report that collagenase-1 promoter activity is induced and maintained in the absence of a functional AP-1 site. We conclude that although the AP-1 site is required to mediate strong collagenase-1 transcription, other upstream elements, including a newly identified CCAAT/enhancer-binding protein-β (C/EBP-β) site, participate in achieving maximal and sustained PMA-mediated collagenase-1 transactivation in monocytic cells. U937 cells (35Sundstrom C. Nilsson K. Int. J. Cancer. 1976; 17: 565-577Google Scholar) were obtained from the American Type Culture Collection (CRL 1593) and maintained in RPMI 1640 medium (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% low endotoxin fetal calf serum (Life Technologies, Inc.), non-essential amino acids, l-glutamine, sodium pyruvate, 100 units/ml penicillin, and 100 μg/ml streptomycin. For induction of cell differentiation, U937 cells were plated at 5 × 105 cells/ml and exposed to 8 × 10−8m PMA (Sigma). Human skin fibroblasts were grown in Dulbecco's modified Eagle's medium, 10% fetal calf serum (Life Technologies, Inc.) containing the same supplements listed above. Total RNA was isolated by the guanidinium phenol extraction method (36Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Google Scholar). Conditions for Northern hybridization and washes were as described (27Saarialho-Kere U.K. Welgus H.G. Parks W.C. J. Biol. Chem. 1993; 268: 17354-17361Google Scholar). Blots were hybridized with a 2.2-kb human collagenase-1 (37Goldberg G.I. Wilhelm S.M. Kronberger A. Bauer E.A. Grant G.A. Eisen A.Z. J. Biol. Chem. 1986; 261: 6600-6605Google Scholar), a 2.0-kb human c-fos(38vanStraaten F. Müller R. Curran T. Beveren C.V. Verma I.M. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 3183-3187Google Scholar), a 1.2-kb human c-jun (39Hattori K. Angel P. Beau M.M.L. Karin M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 9148-9152Google Scholar), or a 1.3-kb rat glyceraldehyde-3-phosphate dehydrogeanse (40Fort P. Piechaczyk M. El Sabrouty S. Danz C. Jeantner I. Blanchard J.M. Nucleic Acids Res. 1985; 13: 1431-1442Google Scholar) random-primed,32P-labeled cDNA probe. Filters were washed and then visualized by autoradiography. Transcription rates of specific mRNAs were measured using 2.5 × 107 isolated nuclei as described (41Pierce R.A. Kolodziej M.E. Parks W.C. J. Biol. Chem. 1992; 267: 11593-11599Google Scholar). Nascent RNA transcripts were isolated, and equivalent counts of 32P-labeled RNA were hybridized to denatured, gel-purified cDNA inserts slotted on nitrocellulose. As an indicator of total transcription, a 2.5-kb pair human Alu repeat fragment derived from the ε-globin gene (42Wu J. Grindlay G. Bushel P. Mendelsohn L. Allan M. Mol. Cell. Biol. 1990; 10: 1209-1216Google Scholar) was blotted as well. Fig. 1 shows maps of all collagenase-1 promoter constructs used in this study. pBLCAT2 contains the −105/+51 region of the herpes simplex virus thymidine kinase (TK) promoter fused to a CAT reporter gene (43Luckow B. Schutz G. Nucleic Acids Res. 1987; 15: 5490Google Scholar). pAPCAT2a is derived from pBLCAT2, and contains a tandem triplet of the collagenase-1 AP-1 site subcloned 5′ of the TK promoter. A plasmid containing the −2278/+36 region of the human collagenase-1 promoter (44Frisch S.M. Reich R. Collier I.E. Genrich L.T. Martin G. Goldberg G.I. Oncogene. 1990; 5: 75-83Google Scholar) was generously provided by Dr. Steven Frisch (La Jolla Cancer Research Foundation, La Jolla, CA). To eliminate the possibility of transcriptional differences due to the vector backbone, all collagenase-1 promoter sequences were subcloned into pBLCAT2. The TK promoter of pBLCAT2 was removed during the synthesis of the collagenase-1 promoter deletion constructs (Fig. 1 A). The p-2278CAT, p-2278MCAT, p-511CAT, p-179CAT, p-95CAT, and p-72CAT vectors were generated by PCR as described (26Pierce R.A. Sandefur S. Doyle G.A.R. Welgus H.G. J. Clin. Invest. 1996; 97: 1890-1899Google Scholar). Constructs p-2010CAT, p-1954CAT, p-1689CAT, p-1552CAT, p-1197CAT, and p-997CAT were made by digestion of p-2278CAT with BsaHI, HpaI,XmnI, EcoRV, BglII, orBamHI, respectively. The digestion products were blunted (when necessary) with the Klenow fragment of DNA polymerase, further digested with XhoI, and the appropriate blunt/XhoI fragment was subcloned into blunted-HindIII/XhoI digested pBLCAT2. The internal deletion construct, p-1197Δ-997CAT, was created by cutting p-2278CAT with BglII and BamHI followed by ligation of the vector. Internal deletion construct p-2010Δ-1954CAT was created by recombinant, whole plasmid PCR (45Hughes M.J.G. Andrews D.W. BioTechniques. 1996; 20: 188-196Google Scholar) using the 5′ (ATAgcatgcACCCTGGAAGAGTCTCAT) and the 3′ (CGCgcatgcCTATTAACTCACCCTTGT) primers (deleted/mutated sequences in lowercase). The PCR product was digested with SphI and ligated. The resultant construct was digested with HindIII and BamHI, and the HindIII/BamHI fragment was subcloned into HindIII/BamHI cut p-2278CAT. All PCR was performed with either VentTM or Deep VentTM DNA polymerase (New England Biolabs, Beverly, MA) to minimize unwanted mutations. All newly created plasmids were sequenced to verify that only the desired alterations were introduced during PCR steps. Sequencing reactions were done using a SequenaseTM Kit (U. S. Biochemical Corp., Cleveland, OH). Heterologous promoter constructs contain collagenase-1 promoter sequences upstream of −997 linked to the TK promoter. These were constructed by subcloning the BamHI/XhoI TK promoter fragment of pBLCAT2 into deletion constructs that had been digested with BamHI and XhoI. For example, p-2278CAT gives rise to p-2278TKCAT, in which −2278 is the most 5′ and −997 (at the BamHI site) is the most 3′ nucleotide of the collagenase-1 promoter fragment (Fig. 1 B). U937 cells (107 in 0.5 ml) were transfected with 5 μg of linearized pRSV-Neo and 50 μg of linearized pBLCAT2, pAPCAT2a, p-72CAT, p-511CAT, p-2278CAT, or p-2278MCAT. Cells were electroporated at 250 V and 600 microfarads in a 0.4-cm gap cuvette using a BTX 3000 electroporator (Biotechnologies and Experimental Research, Inc., San Diego, CA), placed on ice for 10 min, added to 9 ml of culture medium, centrifuged to pellet the cells, and plated in 10 ml of fresh medium. After 24 h, cells were shifted to medium supplemented with 400 μg/ml Geneticin® (Life Technologies, Inc.). After 2 weeks, G-418-resistant cells were subcloned by limiting dilution or maintained as a pooled population of clones in medium containing 200 μg/ml Geneticin®. To minimize insertion effects, two groups of stable clones, one consisting of 6 clones and the other of 12 clones, were pooled. Southern hybridization with 32P-labeled CAT cDNA was done on individual clones and demonstrated that incorporated DNA was roughly equivalent among clones (data not shown). U937 cells were transfected by a modification of the DEAE-dextran method essentially as described (26Pierce R.A. Sandefur S. Doyle G.A.R. Welgus H.G. J. Clin. Invest. 1996; 97: 1890-1899Google Scholar,46Grosschedl R. Baltimore D. Cell. 1985; 41: 885-897Google Scholar). Human skin fibroblasts were transiently transfected by calcium phosphate precipitation. After transfection, cells were allowed to recover for 24 h prior to treatment with PMA. After recovery, cultures were divided equally and cells were plated in medium with or without PMA. After transfection, cells were given fresh medium and allowed to recover for 24 h prior to treatment with PMA. Hirt extraction (47Hirt B. J. Mol. Biol. 1967; 26: 365-369Google Scholar) and Southern hybridization with 32P-labeled CAT cDNA was done to determine transfection efficiency. At the indicated times, cells were harvested, washed, and lysed in 200 μl of 250 mm Tris, pH 7.8, by freeze-thawing. Lysates were incubated at 65 °C for 5 min and then cleared of debris by centrifugation. Equivalent amounts (25–100 μg) of cleared lysate, normalized to total protein (Bradford protein assay; Bio-Rad), were assayed for CAT activity using acetyl-CoA (Sigma) and [14C]chloramphenicol essentially as described (48Gorman C. Moffat L. Howard B. Mol. Cell. Biol. 1982; 2: 1044-1051Google Scholar). Reaction products were separated by thin layer chromatography and visualized by autoradiography. Results were quantified by cutting and counting the appropriate spots from the chromatography plate. Relative induction was obtained by dividing percent acetylation of treatedversus untreated samples. Nuclear extracts were prepared by the method of Dignamet al. (49Dignam J. Martin P. Shastry B. Roeder R. Meth. Enzymol. 1983; 101: 582-598Google Scholar). The integrity of all nuclear extract preparations was assessed by determining the ability of proteins to bind a radiolabeled Oct-1 double-stranded oligomer (data not shown). Oct-1 protein binding was constitutive and, thus, served as an internal control. Only extracts without apparent protein degradation were used. For AP-1 studies, double-stranded oligomers containing either wild-type (GATCAAAGCATGAGTCAGACACCT) or mutant (GATCAAAGCAcccgggAGACACCT) human collagenase-1 promoter sequence were used as probes and competitors. For the binding analyses to the upstream region at −2010 to −1954, double-stranded oligomers containing collagenase-1 promoter sequence between −2013 to −1990 (TGACGTCTTAGGCAATTTCCTGTC), −1994 to −1968 (CTGTCCAATCACAGATGGTCACATCAC), and −1970 to −1947 (CACATGCTGCTTTCCTGAGTTAAC) were used as probes (1, 2, and3 in Fig. 10). Competition was done with oligomers 1, 2, or 3, wild-type (TGCAGATTGCGCAATCTGCA) or mutant (TGCAGAgactagtcTCTGCA) C/EBP consensus oligomers (Santa Cruz Biotechnology, Santa Cruz, CA), or with a wild-type (AGTTGAGGGGACTTTCCCAGGC) NF-κB consensus oligomer (Promega Corp., Madison, WI). Double-stranded oligomers were radiolabeled with [γ-32P]ATP using T4 polynucleotide kinase or with [α-32P]dCTP using the Klenow fragment of DNA polymerase. Binding reactions and electrophoresis conditions were as described (26Pierce R.A. Sandefur S. Doyle G.A.R. Welgus H.G. J. Clin. Invest. 1996; 97: 1890-1899Google Scholar). Equivalent amounts of nuclear protein (5 μg) and probe counts were used in all reactions. Supershift reactions were identical to those described above, except 1 μg of appropriate antibody was added to the binding reactions after addition of the labeled probes and reactions were incubated overnight at 4 °C prior to electrophoresis. The pan-Jun, pan-Fos, and pan-C/EBP antibodies were c-Jun/AP-1[D], c-Fos[4–10G], and C/EBP-β[Δ198], respectively. The antibodies specific to c-Jun, JunB, JunD, c-Fos, FosB, and C/EBP-β were c-Jun/AP-1[N], JunB[N-17], JunD[329], c-Fos[4], FosB[102], and C/EBP-β[C-19], respectively. All antibodies were purchased from Santa Cruz Biotechnology. Equivalent amounts of nuclear proteins were prepared for electrophoresis by adding 1 volume of 2 × sample buffer and β-mercaptoethanol to 50 mm. Samples were boiled for 1 min and separated through a 10% SDS-polyacrylamide gel. Gels were equilibrated in 1 × transfer buffer (10 mm CAPS, 10% methanol, pH 11.0) prior to transferring to polyvinylidene difluoride paper. After transfer, membranes were blotted according to the procedures suggested by Santa Cruz Biotechnology. Blots were developed using horseradish peroxidase-conjugated secondary antibodies and the enhanced chemiluminescence. We reported that collagenase-1 transcription is induced in U937 cells at 16–24 h after exposure to PMA (34Shapiro S.D. Doyle G.A.R. Ley T.J. Parks W.C. Welgus H.G. Biochemistry. 1993; 32: 4286-4292Google Scholar). We used various assays to more carefully examine the kinetics of this differentiation-dependent induction. Collagenase-1 mRNA was not detected in untreated U937 cells (Fig.2 A). By 12 h post-PMA, collagenase-1 mRNA was detected, increased by 24 h, and remained elevated at 48 h post-PMA. Nuclear run-off assays demonstrated that collagenase-1 transcription was detectable at 12 h of PMA differentiation and remained at a constant level thereafter (Fig.2 B). These observations demonstrate that the onset of collagenase-1 induction occurs earlier than reported previously (34Shapiro S.D. Doyle G.A.R. Ley T.J. Parks W.C. Welgus H.G. Biochemistry. 1993; 32: 4286-4292Google Scholar). CAT activity conferred by the full-length collagenase-1 promoter construct (p-2278CAT) in transiently transfected, PMA-treated U937 cells paralleled the pattern of induction of the endogenous gene (Fig.2 C). Only slight background CAT activity was seen in untreated cells. By 4 h post-PMA, promoter activity was increased, and maximal and sustained levels of CAT activity were achieved by 8 h post-PMA. Consistent results were obtained in four separate experiments. A similar time course for induction of collagenase-1 promoter activity was observed in stable transformants (Fig.3, −2278). Full induction of the wild-type collagenase-1 promoter was detected at 6 h after PMA treatment, and the levels were maintained for up to 96 h (Figs. 2 Cand 3). These data indicate that events necessary for maximal induction of collagenase-1 are activated within 4–6 h post-PMA.Figure 3Collagenase-1 promoters containing wild-type or mutant AP-1 element are induced in stably transfected U937 cells. U937 cells were transfected with p-2278CAT or p-2278MCAT, and stable clones were selected and pooled. 107 cells of each population were treated with PMA for the times indicated, and CAT activity in cell lysates was assessed. For the lines containing the wild-type construct (−2278), CAT assays were done with 25 μg of total protein for 24 h (left) or 12 h (right). For the mutant construct (−2278M) lines, CAT assays were done with 100 μg of total protein for 24 h. For all constructs, results shown are representative data of three experiments each with both pooled populations.View Large Image Figure ViewerDownload (PPT) Stable transformants were created to determine if a functional AP-1 site is needed for collagenase-1 induction. The proximal AP-1 site in the −2278/+36 promoter fragment was replaced with a SmaI recognition site (Fig.1 A). Gel shift analysis with labeled mutant oligomer demonstrated that the mutated AP-1 site does not bind nuclear proteins (data not shown). In two groups of pooled clones, mutation of the AP-1 site (p-2278MCAT) eliminated the rapid (i.e. by 4–6 h) and strong transactivation observed with the wild-type construct (p-2278CAT) (Fig. 3). Between 0 and 8 h post-PMA, no CAT activity was detected in U937 cells stably transfected with the mutant AP-1 construct (data not shown). However, transcriptional induction of the mutant AP-1 collagenase-1 promoter was consistently detected at 16 h post-PMA (Fig. 3, −2278M). Although CAT activity expressed by −2278MCAT was much lower than that conferred by the wild-type promoter, the level of CAT activity was maintained for up to 96 h after PMA differentiation, similar to the sustained activity from the wild-type promoter (Fig. 3). Experiments with individual stable clones showed the same patterns of induction with both the wild-type and mutant promoters (data not shown). Southern hybridization demonstrated that incorporated DNA was roughly equivalent among stable lines (data not shown). PMA treatment stimulated activation of the wild-type collagenase-1 promoter in human skin fibroblasts (Fig.4, −2278). Basal activity of the wild-type collagenase-1 promoter was high in these cells, likely due to constitutive c-Jun expression (data not shown), but at 8 and 24 h post-PMA, CAT activity increased. Mutation of the AP-1 site eliminated the high basal activity seen with the wild-type collagenase-1 promoter (Fig. 4, −2278M). However, similar to that observed in differentiated U937 cells, p-2278MCAT conferred transcriptional induction in transiently transfected fibroblasts at 8 and 24 h post-PMA (Fig.4, −2278M). Thus, the collagenase-1 promoter can be transcriptionally induced by PMA in the absence of a functional proximal AP-1 element. Time matched controls incubated without PMA had the same level of CAT activity for p-2278CAT or p-2278MCAT as did the 0 h cells (data not shown). The kinetics of c-fos and c-junexpression were assessed by Northern analysis (data not shown). In contrast to the delayed kinetics of collagenase-1 induction (Fig. 2) and in full agreement with data from others (50Mitchell R.L. Zokas L. Schreiber R.D. Verma I.M. Cell. 1985; 40: 209-217Google Scholar, 51Mollinedo F. Naranjo J.R. Eur. J. Biochem. 1991; 200: 483-486Google Scholar, 52Sherman M.L. Stone R.M. Datta R. Bernstein S.H. Kufe D.W. J. Biol. Chem. 1990; 265: 3320-3323Google Scholar), c-fosand c-jun transcripts were detected as early as 15 min post-PMA, peaked between 1 and 2 h after PMA addition, and were sustained at low levels over the next 48 h (data not shown). Because c-Fos protein expression may not correlate with expression of its mRNA in U937 cells (50Mitchell R.L. Zokas L. Schreiber R.D. Verma I.M. Cell. 1985; 40: 209-217Google Scholar) and because its subcellular localization is regulated (53Roux P. Blanchard J.-M. Fernandez A. Lamb N. Jeanteur P. Piechaczyk M. Cell. 1990; 63: 341-351Google Scholar), we used an immunoblotting assay to detect Fos family proteins in nuclear extracts from untreated and PMA-differentiated U937 cells. c-Fos protein was detected in both 1- and 24-h post-PMA nuclear extracts using pan-Fos or c-Fos-specific antibodies (Fig. 5). The upward shift in the c-Fos band seen in the 24-h extract may be due to increased protein phosphorylation (54Abate C. Marshak D.R. Curran T. Oncogene. 1991; 6: 2179-2185Google Scholar). While the presence of c-Fos in nuclear extracts at 1 h post-PMA was anticipated, the clear abundance of c-Fos protein in the 24-h extract was not. A previous report indicated that c-Fos protein could not be detected in PMA-differentiated U937 cells after 2 h of treatment (50Mitchell R.L. Zokas L. Schreiber R.D. Verma I.M. Cell. 1985; 40: 209-217Google Scholar). Because these authors immunoprecipitated metabolically-labeled protein from whole cell extracts, they may have underestimated c-Fos protein levels during periods of low c-Fos protein synthesis. We detected no FosB protein by immunoblotting nuclear extracts from untreated or PMA-treated U937 cells with a FosB-specific antibody (data not shown). Proteins distinct from c-Fos were detected by the pan-Fos antibody in the nuclear extract from untreated cells, but not in those from PMA-treated cells. The identity of these protein
Referência(s)