Identification of a Novel Arabinofuranosyltransferase AftB Involved in a Terminal Step of Cell Wall Arabinan Biosynthesis in Corynebacterianeae, such as Corynebacterium glutamicum and Mycobacterium tuberculosis
2007; Elsevier BV; Volume: 282; Issue: 20 Linguagem: Inglês
10.1074/jbc.m700271200
ISSN1083-351X
AutoresMathias Seidel, Luke J. Alderwick, Helen L. Birch, Hermann Sahm, Lothar Eggeling, Gurdyal S. Besra,
Tópico(s)Microbial Metabolic Engineering and Bioproduction
ResumoArabinofuranosyltransferase enzymes, such as EmbA, EmbB, and AftA, play pivotal roles in the biosynthesis of arabinogalactan, and the anti-tuberculosis agent ethambutol (EMB) targets arabinogalactan biosynthesis through inhibition of Mt-EmbA and Mt-EmbB. Herein, we describe the identification and characterization of a novel arabinofuranosyltransferase, now termed AftB (Rv3805c), which is essential in Mycobacterium tuberculosis. Deletion of its orthologue NCgl2780 in the closely related species Corynebacterium glutamicum resulted in a viable mutant. Analysis of the cell wall-associated lipids from the deletion mutant revealed a decreased abundance of cell wall-bound mycolic acids, consistent with a partial loss of mycolylation sites. Subsequent glycosyl linkage analysis of arabinogalactan also revealed the complete absence of terminal β(1 → 2)-linked arabinofuranosyl residues. The deletion mutant biochemical phenotype was fully complemented by either Mt-AftB or Cg-AftB, but not with muteins of Mt-AftB, where the two adjacent aspartic acid residues, which have been suggested to be involved in glycosyltransferase activity, were replaced by alanine. In addition, the use of C. glutamicum and C. glutamicumΔaftB in an in vitro assay utilizing the sugar donor β-d-arabinofuranosyl-1-monophosphoryl-decaprenol together with the neoglycolipid acceptor α-d-Araf-(1 → 5)-α-d-Araf-O-C8 as a substrate confirmed AftB as a terminal β(1 → 2) arabinofuranosyltransferase, which was also insensitive to EMB. Altogether, these studies have shed further light on the complexities of Corynebacterianeae cell wall biosynthesis, and Mt-AftB represents a potential new drug target. Arabinofuranosyltransferase enzymes, such as EmbA, EmbB, and AftA, play pivotal roles in the biosynthesis of arabinogalactan, and the anti-tuberculosis agent ethambutol (EMB) targets arabinogalactan biosynthesis through inhibition of Mt-EmbA and Mt-EmbB. Herein, we describe the identification and characterization of a novel arabinofuranosyltransferase, now termed AftB (Rv3805c), which is essential in Mycobacterium tuberculosis. Deletion of its orthologue NCgl2780 in the closely related species Corynebacterium glutamicum resulted in a viable mutant. Analysis of the cell wall-associated lipids from the deletion mutant revealed a decreased abundance of cell wall-bound mycolic acids, consistent with a partial loss of mycolylation sites. Subsequent glycosyl linkage analysis of arabinogalactan also revealed the complete absence of terminal β(1 → 2)-linked arabinofuranosyl residues. The deletion mutant biochemical phenotype was fully complemented by either Mt-AftB or Cg-AftB, but not with muteins of Mt-AftB, where the two adjacent aspartic acid residues, which have been suggested to be involved in glycosyltransferase activity, were replaced by alanine. In addition, the use of C. glutamicum and C. glutamicumΔaftB in an in vitro assay utilizing the sugar donor β-d-arabinofuranosyl-1-monophosphoryl-decaprenol together with the neoglycolipid acceptor α-d-Araf-(1 → 5)-α-d-Araf-O-C8 as a substrate confirmed AftB as a terminal β(1 → 2) arabinofuranosyltransferase, which was also insensitive to EMB. Altogether, these studies have shed further light on the complexities of Corynebacterianeae cell wall biosynthesis, and Mt-AftB represents a potential new drug target. Mycobacterial diseases such as tuberculosis and leprosy still represent a severe public health problem (1Gupta R. Kim J.Y. Espinal M.A. Caudron J.M. Pecoul B. Farmer P.E. Raviglione M.C. Science. 2001; 293: 1049-1051Crossref PubMed Scopus (124) Google Scholar). For instance, the recent emergence of multidrug-resistant tuberculosis strains and, more recently, extensively drug-resistant tuberculosis clinical isolates (2Zignol M. Hosseini M.S. Wright A. Weezenbeek C.L. Nunn P. Watt C.J. Williams B.G. Dye C. J. Infect. Dis. 2006; 194: 479-485Crossref PubMed Scopus (438) Google Scholar, 3Singh J.A. Upshur R. Padayatchi N. PLoS Med. 2007; 4: e50Crossref PubMed Scopus (148) Google Scholar) has prompted the need for new drugs and drug targets. The causative agent of these diseases, Mycobacterium tuberculosis and Mycobacterium leprae, respectively, are characterized by an intricate cell envelope (4McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1990; 265: 18200-18206Abstract Full Text PDF PubMed Google Scholar, 5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 6McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1991; 266: 13217-13223Abstract Full Text PDF PubMed Google Scholar). This characteristic mycobacterial cell envelope is composed of four macromolecules, lipoarabinomannan, mycolic acids, arabinogalactan (AG), 4The abbreviations used are: AG, arabinogalactan; Ara, arabinose; CMAME, corynomycolic acid methyl ester; DPA, decaprenol phosphoarabinose; EMB, ethambutol; Gal, galactose; GC, gas chromatography; MS, mass spectrometry; mAGP, mycolyl-arabinogalactan-peptidoglycan; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; TM, transmembrane; MOPS, 4-morpholinepropanesulfonic acid; ES, electrospray; TMCM, trehalose monocorynomycolate; TDCM, trehalose dicorynomycolate. 4The abbreviations used are: AG, arabinogalactan; Ara, arabinose; CMAME, corynomycolic acid methyl ester; DPA, decaprenol phosphoarabinose; EMB, ethambutol; Gal, galactose; GC, gas chromatography; MS, mass spectrometry; mAGP, mycolyl-arabinogalactan-peptidoglycan; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; TM, transmembrane; MOPS, 4-morpholinepropanesulfonic acid; ES, electrospray; TMCM, trehalose monocorynomycolate; TDCM, trehalose dicorynomycolate. and peptidoglycan (4McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1990; 265: 18200-18206Abstract Full Text PDF PubMed Google Scholar, 5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 6McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1991; 266: 13217-13223Abstract Full Text PDF PubMed Google Scholar, 7Chatterjee D. Bozic C.M. McNeil M. Brennan P.J. J. Biol. Chem. 1991; 266: 9652-9660Abstract Full Text PDF PubMed Google Scholar). The galactan domain of AG is linked to peptidoglycan via a specialized “linker unit,” l-Rhap-(1 → 4)-α-d-GlcNAc, and its distal arabinan domain to mycolic acids, forming the mycolyl-arabinogalactan-peptidoglycan (mAGP) complex (4McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1990; 265: 18200-18206Abstract Full Text PDF PubMed Google Scholar, 5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 6McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1991; 266: 13217-13223Abstract Full Text PDF PubMed Google Scholar). The arabinan domain contains α(1 → 5), α(1 → 3), and β(1 → 2) arabinofuranosyl (Araf) linkages, arranged in several distinct structural motifs (5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 8Daffe M. Brennan P.J. McNeil M. J. Biol. Chem. 1990; 265: 6734-6743Abstract Full Text PDF PubMed Google Scholar, 9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). The nonreducing arabinan termini of AG consists of t-Araf, 2-Araf, 5-Araf, and 3,5-Araf residues arranged into a characteristic terminal Ara6 motif, with the 5-OH of the t-Araf and 2-Araf residues representing sites of mycolylation (6McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1991; 266: 13217-13223Abstract Full Text PDF PubMed Google Scholar). The packing and ordering of mycolic acids within the mAGP and additional lipids within the outer envelope results in a highly impermeable barrier (10Minnikin D.E. Kremer L. Dover L.G. Besra G.S. Chem. Biol. 2002; 9: 545-553Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). It is interesting to note that several frontline anti-tubercular drugs, such as ethambutol (EMB) (11Takayama K. Kilburn J.O. Antimicrob. Agents Chemother. 1989; 33: 1493-1499Crossref PubMed Scopus (278) Google Scholar, 12Belanger A.E. Besra G.S. Ford M.E. Mikusova K. Belisle J.T. Brennan P.J. Inamine J.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11919-11924Crossref PubMed Scopus (394) Google Scholar, 13Telenti A. Philipp W.J. Sreevatsan S. Bernasconi C. Stockbauer K.E. Wieles B. Musser J.M. Jacobs Jr., W.R. Nat. Med. 1997; 3: 567-570Crossref PubMed Scopus (376) Google Scholar) and isoniazid (14Winder F.G. Collins P.B. J. Gen. Microbiol. 1970; 63: 41-48Crossref PubMed Scopus (174) Google Scholar, 15Banerjee A. Dubnau E. Quemard A. Balasubramanian V. Um K.S. Wilson T. Collins D. de Lisle G. Jacobs Jr., W.R. Science. 1994; 263: 227-230Crossref PubMed Scopus (1215) Google Scholar), target aspects of the biosynthesis of the mAGP complex. Corynebacterium glutamicum has proven useful in the study of orthologous M. tuberculosis genes essential for viability (16Gande R. Gibson K.J. Brown A.K. Krumbach K. Dover L.G. Sahm H. Shioyama S. Oikawa T. Besra G.S. Eggeling L. J. Biol. Chem. 2004; 279: 44847-44857Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 17Portevin D. De Sousa-D'Auria C. Houssin C. Grimaldi C. Chami M. Daffe M. Guilhot C. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 314-319Crossref PubMed Scopus (277) Google Scholar). This bacterium together with Corynebacterium diphtheriae and Corynebacterium jeikeium as well as M. tuberculosis and M. leprae and a number of other closely related species form the well defined taxon Corynebacterianeae. The bacteria within this taxon share many characteristic cell wall features, such as AG and mycolic acids. In addition, the use of C. glutamicum together with its low number of paralogous genes (18Kalinowski J. Bathe B. Bartels D. Bischoff N. Bott M. Burkovski A. Dusch N. Eggeling L. Eikmanns B.J. Gaigalat L. Goesmann A. Hartmann M. Huthmacher K. Kramer R. Linke B. McHardy A.C. Meyer F. Mockel B. Pfefferle W. Puhler A. Rey D.A. Ruckert C. Rupp O. Sahm H. Wendisch V.F. Wiegrabe I. Tauch A. J. Biotechnol. 2003; 104: 5-25Crossref PubMed Scopus (756) Google Scholar) has proven useful in the study of the mAGP complex within this peculiar group of organisms (9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). For instance, we recently identified a novel mycobacterial arabinofuranosyltransferase AftA using C. glutamicum due to the fact that it is largely tolerable with respect to the deletion of Cg-emb (9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar) and Cg-aftA (19Alderwick L.J. Seidel M. Sahm H. Besra G.S. Eggeling L. J. Biol. Chem. 2006; 281: 15653-15661Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar), which are otherwise essential in M. tuberculosis. 5G. S. Besra, unpublished results. 5G. S. Besra, unpublished results. The structural basis of AG is now well defined (4McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1990; 265: 18200-18206Abstract Full Text PDF PubMed Google Scholar, 5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 8Daffe M. Brennan P.J. McNeil M. J. Biol. Chem. 1990; 265: 6734-6743Abstract Full Text PDF PubMed Google Scholar); conversely, aspects of its biogenesis remained poorly resolved. The biosynthesis of AG involves the formation of a linear galactan chain with alternating β(1 → 5) and β(1 → 6)-d-galactofuranosyl (Galf) residues of ∼30 residues in length from the specialized “linker unit,” l-Rhap-(1 → 4)-α-d-GlcNAc (20Mikusova K. Yagi T. Stern R. McNeil M.R. Besra G.S. Crick D.C. Brennan P.J. J. Biol. Chem. 2000; 275: 33890-33897Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 21Kremer L. Dover L.G. Morehouse C. Hitchin P. Everett M. Morris H.R. Dell A. Brennan P.J. McNeil M.R. Flaherty C. Duncan K. Besra G.S. J. Biol. Chem. 2001; 276: 26430-26440Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar). MALDI-TOF mass spectrometry (MS) analyzes of per-O-methylated AG of C. glutamicum deleted of its single arabinofuranosyltransferase, Cg-emb, revealed that the 8th, 10th, and 12th Galf residue possessed singular Araf residues (9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). These specific Araf residues were recently shown to be transferred by a specialized arabinofuranosyltransferase AftA, whose gene in all Corynebacterianeae analyzed to date is adjacent to the emb cluster (19Alderwick L.J. Seidel M. Sahm H. Besra G.S. Eggeling L. J. Biol. Chem. 2006; 281: 15653-15661Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). These initial Araf residues “prime” the galactan backbone for further attachment of α(1 → 5)-linked Araf residues. These reactions require the arabinofuranosyltransferase activities of Mt-EmbA and Mt-EmbB or Cg-Emb, which are also targets of EMB (9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 13Telenti A. Philipp W.J. Sreevatsan S. Bernasconi C. Stockbauer K.E. Wieles B. Musser J.M. Jacobs Jr., W.R. Nat. Med. 1997; 3: 567-570Crossref PubMed Scopus (376) Google Scholar, 22Radmacher E. Stansen K.C. Besra G.S. Alderwick L.J. Maughan W.N. Hollweg G. Sahm H. Wendisch V.F. Eggeling L. Microbiology. 2005; 151: 1359-1368Crossref PubMed Scopus (94) Google Scholar), to eventually result in mature AG. The Emb and AftA proteins utilize the specialized sugar donor, β-d-arabinofuranosyl-1-monophosphoryl-decaprenol (DPA) (23Wolucka B.A. McNeil M.R. de Hoffmann E. Chojnacki T. Brennan P.J. J. Biol. Chem. 1994; 269: 23328-23335Abstract Full Text PDF PubMed Google Scholar, 24Lee R.E. Brennan P.J. Besra G.S. Glycobiology. 1997; 7: 1121-1128Crossref PubMed Scopus (93) Google Scholar, 25Lee R.E. Mikusova K. Brennan P.J. Besra G.S. J. Am. Chem. Soc. 1995; 117: 11829-11832Crossref Scopus (147) Google Scholar), and is a characteristic feature found only in Corynebacterianeae (26Alderwick L.J. Dover L.G. Seidel M. Gande R. Sahm H. Eggeling L. Besra G.S. Glycobiology. 2006; 16: 1073-1081Crossref PubMed Scopus (31) Google Scholar, 27Huang H. Scherman M.S. D'Haeze W. Vereecke D. Holsters M. Crick D.C. McNeil M.R. J. Biol. Chem. 2005; 280: 24539-24543Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 28Mikusova K. Huang H. Yagi T. Holsters M. Vereecke D. D'Haeze W. Scherman M.S. Brennan P.J. McNeil M.R. Crick D.C. J. Bacteriol. 2005; 187: 8020-8025Crossref PubMed Scopus (154) Google Scholar). In addition, these proteins also belong to the GT-C superfamily of integral membrane glycosyltransferases (29Liu J. Mushegian A. Protein Sci. 2003; 12: 1418-1431Crossref PubMed Scopus (176) Google Scholar). A recent topological analysis of Cg-Emb (30Seidel M. Alderwick L.J. Sahm H. Besra G.S. Eggeling L. Glycobiology. 2007; 17: 210-219Crossref PubMed Scopus (33) Google Scholar) together with a mutational study of Mt-EmbC (31Berg S. Starbuck J. Torrelles J.B. Vissa V.D. Crick D.C. Chatterjee D. Brennan P.J. J. Biol. Chem. 2005; 280: 5651-5663Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar) revealed for the first time a clear domain organization of these proteins, with the glycosyltransferase DDX signature evident in the extracellular loop that connects helixes III-IV and the chain elongation “Pro-motif” in the extracellular loop connecting helixes XIII-XIV (31Berg S. Starbuck J. Torrelles J.B. Vissa V.D. Crick D.C. Chatterjee D. Brennan P.J. J. Biol. Chem. 2005; 280: 5651-5663Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). It is interesting to note that the arabinan domain of AG utilizes several different Araf linkages, which suggests that additional arabinofuranosyltransferases must be required to form a fully matured AG. Moreover, initial Araf residues at branching sites could require specialized arabinofuranosyltransferases as already observed for AftA (19Alderwick L.J. Seidel M. Sahm H. Besra G.S. Eggeling L. J. Biol. Chem. 2006; 281: 15653-15661Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar), and it has to be considered that even further specialized arabinofuranosyltransferases might exist to incorporate Araf into lipoarabinomannan. Clearly additional arabinofuranosyltransferases still remain to be identified in Corynebacterianeae. Indeed, Liu and Mushegian (29Liu J. Mushegian A. Protein Sci. 2003; 12: 1418-1431Crossref PubMed Scopus (176) Google Scholar) identified 15 members of the GT-C superfamily, representing candidates involved in the biosynthesis of cell wall related glycans and lipoglycans in M. tuberculosis. We have continued our earlier studies (9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 16Gande R. Gibson K.J. Brown A.K. Krumbach K. Dover L.G. Sahm H. Shioyama S. Oikawa T. Besra G.S. Eggeling L. J. Biol. Chem. 2004; 279: 44847-44857Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 19Alderwick L.J. Seidel M. Sahm H. Besra G.S. Eggeling L. J. Biol. Chem. 2006; 281: 15653-15661Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar) to identify genes required for the biosynthesis of the core structural elements of the mAGP complex in Corynebacterianeae by studying mutants of C. glutamicum and the orthologous genes and enzymes of M. tuberculosis. Herein we present Rv3805c as a new arabinofuranosyltransferase of the GT-C superfamily that is responsible for the transfer of Araf residues from DPA to the arabinan domain to form terminal β(1 → 2)-linked Araf residues, which marks the “end point” for AG arabinan biosynthesis before decoration with mycolic acids. Strains and Culture Conditions—M. tuberculosis H37Rv DNA was obtained from the Tuberculosis Research Material Contract (National Institutes of Health) at Colorado State University. C. glutamicum ATCC 13032 (the wild type strain, and referred for the remainder of the text as C. glutamicum) and Escherichia coli DH5α were grown in Luria-Bertani broth (LB, Difco) at 30 and 37 °C, respectively. The mutants generated in this study were grown on complex brain heart infusion medium (32Eggeling L. Reyes O. Eggeling L. Bott M. Handbook of Corynebacterium glutamicum. 2005; (pp. , CRC Press, Inc., Boca Raton, FL): 535-566Crossref Google Scholar). Kanamycin and ampicillin were used at a concentration of 50 μg/ml. Samples for lipid analyzes were prepared by harvesting cells at an optical density of 10–15 followed by a saline wash and freeze drying. Construction of Plasmids and Strains—The vectors made were pMSX-Cg-aftB (NCgl2780), pMSX-Mt-aftB (Rv3805c), and pK19mobsacBΔaftB, with the gene number of the M. tuberculosis and C. glutamicum aftB orthologue added in parentheses. To express M. tuberculosis aftB in C. glutamicum, the primer pair GTATGAGCATATGGTCCGGGTCAGCTTGTGG (all primers in 5′-3′direction) and ATTGCCCCTCACTCGAGCTCCCGCGGTGGCGGG was used, with the restriction sites NdeI and XhoI underlined, using M. tuberculosis H37Rv chromosomal DNA as a template. The purified PCR fragment was ligated with accordingly digested pMSX to give pMSX-Mt-aftB. pMSX was prepared from pEKEx2 (33Eikmanns B.J. Kleinertz E. Liebl W. Sahm H. Gene (Amst.). 1991; 102: 93-98Crossref PubMed Scopus (189) Google Scholar) to generate a derivative providing an appropriate ribosome binding site together with a C-terminal His tag. It was created by the individual cleavage of pEKEx2 with NdeI and XhoI, each followed by Klenow treatment and religation. The intermediate construct was SalI/DraI-cleaved, treated with mung bean nuclease, and ligated with the XbaI/MroI fragment from pET22b (Novagen), which before use was treated with the Klenow fragment to eventually yield pMSX. To overexpress Cg-aftB, the primer pair ATGTGGCCATATGACGTTTAGCCCCCAGCGTC and TGTTTACTCGAGCTGAGAGCTATATAAAGGTTCTCCGC was used to amplify C. glutamicum aftB, which was ligated with NdeI- and XhoI-cleaved pMSX to generate pMSX-Cg-aftB. To construct the deletion vector pK19mobsacBΔaftB crossover PCR was applied with primer pairs AB (A, ACGCCAAGCTTTGCTAGTCGCTGCGTTTGGTTC; B, CCCATCCACTAAACACTGGGGGCTAAACGTCATGAG) and CD (C, TGTTTAAGTTTAGTGGATGGGGAACCTCGCGGAGAACCTTTATATA; D, GCCAGTGAATTCGGCGCGCAGCGTTGGTATC) and C. glutamicum genomic DNA as template. Both amplified products were used in a second PCR with primer pairs AD to generate a fragment consisting of sequences adjacent to Cg-aftB, which was blunt end-ligated with SmaI-cleaved pK19mobsacB. All plasmids were confirmed by sequencing. The chromosomal deletion of Cg-aftB was performed as described previously using two rounds of positive selection (34Schafer A. Tauch A. Jager W. Kalinowski J. Thierbach G. Puhler A. Gene (Amst.). 1994; 145: 69-73Crossref PubMed Scopus (2143) Google Scholar), and its successful deletion was verified by use of different primer pairs. Plasmid pMSX-Mt-aftB and pMSX-Cg-aftB were introduced into C. glutamicumΔaftB by electroporation with selection to kanamycin resistance (25 μg/ml). Site-specific mutations were introduced in Mt-aftB using appropriate mutagenic primers and pMSX-Mt-aftB as the double-stranded template (QuikChange kit, Stratagene). After linear amplification of the newly synthesized strands and DpnI digestion of parental strands, plasmids pMSX-Mt-aftB-D29A and pMSX-Mt-aftB-D30A were generated carrying the mutations as indicated. All plasmids were verified by sequencing. Protein Analysis—Recombinant C. glutamicum strains deleted of the chromosomal Cg-aftB copy but carrying either pMSX, pMSX-Mt-aftB, pMSX-Mt-aftB-D29A, or pMSX-Mt-aftB-D30A were each grown in LB up to an optical density of 4. Cells were harvested by centrifugation, washed, and resuspended in 30 ml of 50 mm Tris-HCl (pH 7.4) buffer, containing 200 mm NaCl and 50 mm imidazole and disrupted by probe sonication. Centrifugation at 27,000 × g resulted in a clear supernatant, which was applied to a 1-ml HiTrap™ chelating high performance column (GE Healthcare) using an AåTKA chromatography system. The column was initially washed with 10 ml of the aforementioned buffer, and bound proteins were subsequently eluted with 2 ml of the same buffer but containing 500 mm imidazole. Eluted proteins were precipitated, dried, and resuspended in 10 μl of loading buffer, and SDS-PAGE was carried out on a 10% polyacrylamide gel, which was subsequently stained using 0.05% Coomassie G250 in 10% acetic acid and 25% isopropanol. Bands of interest were excised and subjected to in-gel digestion with trypsin before peptide mass fingerprinting. Peptides were extracted by the sequential addition of water (12 μl) and 0.1% (v/v) trifluoroacetic acid in 30% (v/v) acetonitrile (10 μl) and analyzed manually using an Applied Biosystems Voyager STR MALDI-TOF mass spectrometer (Weiterstadt, Germany). Extraction and Analysis of Cell Wall-associated and Cell Wall-bound Lipids—Cells (100 mg) were extracted by two consecutive extractions using 2 ml of CHCl3/CH3OH/H2O (10: 10:3, v/v/v) for 3 h at 50°C, and the resulting delipidated cells were stored for further use (as described below). Organic extracts were combined with 1.75 ml of CHCl3 and 0.75 ml H2O, mixed, and centrifuged. The lower organic phase was recovered, washed twice with 2 ml of CHCl3/CH3OH/H2O (3:47:48, v/v/v), dried, and resuspended in 200 μl of CHCl3/CH3OH/H2O (10:10:3, v/v/v). An aliquot (20 μl) was analyzed by thin layer chromatography (TLC) using silica gel plates (5735 silica gel 60F254, Merck) developed in CHCl3/CH3OH/H2O (60:16:2, v/v/v). TLCs were visualized by charring with 5% molybdophosphoric acid in ethanol at 100 °C to reveal cell wall-associated lipids. The bound corynomycolic acids from delipidated extracts or purified cell walls (see below) were released by the addition of a 5% aqueous solution of tetra-butyl ammonium hydroxide followed by overnight incubation at 100 °C and methylated as described previously (9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Corynomycolic acid methyl esters (CMAMEs) were analyzed by TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in petroleum ether/acetone (95:5, v/v). TLCs were visualized by charring with 5% molybdophosphoric acid in ethanol at 100 °C to reveal CMAMEs. Alternatively, 14C labeling of cell wall-associated lipids and cell wall-bound corynomycolic acids was performed by growing cultures initially at 30 °C in 5 ml of brain heart infusion media supplemented with antibiotic where appropriate. Once the optical density reached ∼0.5, cultures were labeled with 5 μCi of [14C]acetic acid (50–62 μCi/mmol, Amersham Biosciences) and further incubated for 8 h. Cells were harvested by centrifugation, and the cell wall-associated lipids were extracted as described above. The cell wall-associated 14C-labeled lipids were resuspended in 200 μl of CHCl3/CH3OH/H2O (10:10:3, v/v/v), and an aliquot (5 μl) was dried in a scintillation vial and then mixed with 10 ml of EcoScintA scintillation fluid (National Diagnostics, Atlanta, GA) and counted. Equal counts (25,000 cpm) of each sample were analyzed by TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in CHCl3/CH3OH/H2O (60:16:2, v/v/v) and quantified using phosphorimaging after exposure to Kodak X-Omat film for 24 h. The bound [14C]corynomycolic acids from the delipidated extracts were released by base treatment and methylated as described above to afford [14C]CMAMEs. The [14C]CMAMEs were resuspended in 100 μl of CH2Cl2, and an aliquot (5 μl) was dried in a scintillation vial and then mixed with 10 ml of EcoScintA scintillation fluid (National Diagnostics) and counted to quantify cell wall-bound [14C]corynomycolic acids. A 5-μl aliquot of [14C]CMAMEs was also analyzed by TLC using silica gel plates (5735 silica gel 60F254, Merck) developed in petroleum ether/acetone (95:5, v/v). TLC autoradiograms were obtained by exposing TLCs to Kodak X-Omat film for 24 h. Isolation of the mAGP Complex—The thawed cells were resuspended in phosphate-buffered saline containing 2% Triton X-100 (pH 7.2), disrupted by sonication, and centrifuged at 27,000 × g (5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 8Daffe M. Brennan P.J. McNeil M. J. Biol. Chem. 1990; 265: 6734-6743Abstract Full Text PDF PubMed Google Scholar, 9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). The pelleted material was extracted 3 times with 2% SDS in phosphate-buffered saline at 95 °C for 1 h to remove associated proteins, successively washed with water, 80% (v/v) acetone in water, and acetone, and finally lyophilized to yield a highly purified cell wall preparation (5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 8Daffe M. Brennan P.J. McNeil M. J. Biol. Chem. 1990; 265: 6734-6743Abstract Full Text PDF PubMed Google Scholar, 9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Glycosyl Composition and Linkage Analysis of Cell Walls by Alditol Acetates—Cell wall preparations were hydrolyzed using 2 m trifluoroacetic acid and reduced with NaB2H4, and the resultant alditols per-O-acetylated were examined by gas chromatography (GC) (5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 8Daffe M. Brennan P.J. McNeil M. J. Biol. Chem. 1990; 265: 6734-6743Abstract Full Text PDF PubMed Google Scholar, 9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Cell wall preparations were per-O-methylated using dimethyl sulfinyl carbanion (5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemistry. 1995; 34: 4257-4266Crossref PubMed Scopus (206) Google Scholar, 8Daffe M. Brennan P.J. McNeil M. J. Biol. Chem. 1990; 265: 6734-6743Abstract Full Text PDF PubMed Google Scholar, 9Alderwick L.J. Radmacher E. Seidel M. Gande R. Hitchen P.G. Morris H.R. Dell A. Sahm H. Eggeling L. Besra G.S. J. Biol. Chem. 2005; 280: 32362-32371Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). The per-O-methylated cell walls were hydrolyzed using 2 m trifluoroacetic acid, reduced with NaB2H4, per-O-acetylated, and examined by GC/MS (5Besra G.S. Khoo K.H. McNeil M.R. Dell A. Morris H.R. Brennan P.J. Biochemis
Referência(s)