Portal de Periódicos da CAPES

Complete Reconstitution of Human IκB Kinase (IKK) Complex in Yeast

2001; Elsevier BV; Volume: 276; Issue: 39 Linguagem: Inglês

10.1074/jbc.m104051200

1083-351X

Beth Schomer Miller, Ebrahim Zandi,

Cytokine Signaling Pathways and Interactions

The IκB kinase (IKK) complex, composed of two catalytic subunits (IKKα and IKKβ) and a regulatory subunit (IKKγ), is the key enzyme in activation of nuclear factor κB (NF-κB). To study the mechanism and structure of the complex, we wanted to recombinantly express IKK in a model organism that lacks IKK. For this purpose, we have recombinantly reconstituted all three subunits together in yeast and have found that it is biochemically similar to IKK isolated from human cells. We show that there is one regulatory subunit per kinase subunit. Thus, the core subunit composition of IKKα·β·γ complex is α1β1γ2, and the core subunit composition of IKKβ·γ is β2γ2. The activity of the IKK complex (α+β+γ or β+γ) expressed in yeast (which lack NF-κB and IKK) is 4–5-fold higher than an equivalent amount of IKK from nonstimulated HeLa cells. In the absence of IKKγ, IKKβ shows a level of activity similar to that of IKK from nonstimulated HeLa cells. Thus, IKKγ activates IKK complex in the absence of upstream stimuli. Deleting the γ binding domain of IKKβ or IKKα prevented IKKγ induced activation of IKK complex in yeast, but it did not prevent the incorporation of IKKγ into IKK and large complex formation. The possibility of IKK complex being under negative control in mammalian cells is discussed. The IκB kinase (IKK) complex, composed of two catalytic subunits (IKKα and IKKβ) and a regulatory subunit (IKKγ), is the key enzyme in activation of nuclear factor κB (NF-κB). To study the mechanism and structure of the complex, we wanted to recombinantly express IKK in a model organism that lacks IKK. For this purpose, we have recombinantly reconstituted all three subunits together in yeast and have found that it is biochemically similar to IKK isolated from human cells. We show that there is one regulatory subunit per kinase subunit. Thus, the core subunit composition of IKKα·β·γ complex is α1β1γ2, and the core subunit composition of IKKβ·γ is β2γ2. The activity of the IKK complex (α+β+γ or β+γ) expressed in yeast (which lack NF-κB and IKK) is 4–5-fold higher than an equivalent amount of IKK from nonstimulated HeLa cells. In the absence of IKKγ, IKKβ shows a level of activity similar to that of IKK from nonstimulated HeLa cells. Thus, IKKγ activates IKK complex in the absence of upstream stimuli. Deleting the γ binding domain of IKKβ or IKKα prevented IKKγ induced activation of IKK complex in yeast, but it did not prevent the incorporation of IKKγ into IKK and large complex formation. The possibility of IKK complex being under negative control in mammalian cells is discussed. nuclear factor κB inhibitor of κB IκB kinase tumor necrosis factor hemagglutinin glutathioneS-transferase polyacrylamide gel electrophoresis IKKγ binding domain IKKβ with γBD deleted IKKα with γBD deleted Nuclear factor κB (NF-κB)1 comprises a family of dimeric transcription factors that regulate the expression of over 150 genes involved in immune, stress, and antiapoptotic processes (1Pahl H.L. Oncogene. 1999; 18: 6853-6866Crossref PubMed Scopus (3448) Google Scholar, 2Lee H.H. Dadgostar H. Cheng Q. Shu J. Cheng G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 9136-9141Crossref PubMed Scopus (485) Google Scholar, 3You M. Ku P.-T. Hrdlickova R. Bose Jr., H.R. Mol. Cell Biol. 1997; 17: 7328-7341Crossref PubMed Google Scholar, 4Stehlik C. de Martin R. Kumabashiri I. Schmid J.A. Binder B.R. Lipp J. J. Exp. Med. 1998; 188: 211-216Crossref PubMed Scopus (593) Google Scholar). Under normal circumstances, NF-κB is tightly regulated so as to prevent inappropriate inflammation while allowing a rapid response to infection or stress. In unstimulated cells, NF-κB is found predominantly in the cytoplasm in a complex with IκB proteins (a family of inhibitory subunits including IκBα, IκBβ, IκBγ, IκBε, and Bcl-3), which sequester NF-κB and prevent its migration to the nucleus (5Baeuerle P.A. Baltimore D. Science. 1988; 242: 540-546Crossref PubMed Scopus (1685) Google Scholar, 6Rothwarf D.M. Karin M. Signal Transduction Knowledge Environment. 1999; 5: 1-16Google Scholar). Diverse stimuli, including cytokines, bacterial and viral products, oxidants, and mitogens, lead to phosphorylation of two regulatory serine residues on IκBs, which targets it for polyubiquitination and proteolytic degradation. This frees NF-κB to move to the nucleus, where it binds to and stimulates the transcription of target genes (7Siebenlist U. Franzoso G. Brown K. Annu. Rev. Cell Biol. 1994; 10: 405-455Crossref PubMed Scopus (2015) Google Scholar). This phosphorylation is catalyzed by a large kinase complex, IκB kinase (IKK) (8DiDonato J.A. Hayakawa M. Rothwarf D.M. Zandi E. Karin M. Nature. 1997; 388: 548-554Crossref PubMed Scopus (1913) Google Scholar, 9Mercurio F. Zhu H. Murray B.W. Shevchenko A. Bennett B.L. Li J. Young D.B. Barbosa M. Mann M. Manning A. Rao A. Science. 1997; 278: 860-866Crossref PubMed Scopus (1853) Google Scholar, 10Zandi E. Rothwarf D.M. Delhase M. Hayakawa M. Karin M. Cell. 1997; 91: 243-252Abstract Full Text Full Text PDF PubMed Scopus (1589) Google Scholar). IKK is composed of two homologous kinase subunits, IKKα and IKKβ (85 and 87 kDa, respectively) and a 52-kDa regulatory subunit IKKγ (8DiDonato J.A. Hayakawa M. Rothwarf D.M. Zandi E. Karin M. Nature. 1997; 388: 548-554Crossref PubMed Scopus (1913) Google Scholar, 10Zandi E. Rothwarf D.M. Delhase M. Hayakawa M. Karin M. Cell. 1997; 91: 243-252Abstract Full Text Full Text PDF PubMed Scopus (1589) Google Scholar, 11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar), also called NEMO (NF-κB essential modulator) (12Yamaoka S. Courtois G. Bessia C. Whiteside S.T. Weil R. Agou F. Kirk H.E. Kay R.J. Israel A. Cell. 1998; 93: 1231-1240Abstract Full Text Full Text PDF PubMed Scopus (950) Google Scholar). IKKγ is required for activation of IKK in response to TNF and other stimuli (13Rothwarf D.M. Zandi E. Natoli G. Karin M. Nature. 1998; 395: 297-300Crossref PubMed Scopus (853) Google Scholar). IKKα and IKKβ each contain an N-terminal protein kinase domain (containing a canonical mitogen-activated protein kinase kinase activation loop (9Mercurio F. Zhu H. Murray B.W. Shevchenko A. Bennett B.L. Li J. Young D.B. Barbosa M. Mann M. Manning A. Rao A. Science. 1997; 278: 860-866Crossref PubMed Scopus (1853) Google Scholar)), a leucine zipper, and a helix-loop-helix motif toward the C terminus (10Zandi E. Rothwarf D.M. Delhase M. Hayakawa M. Karin M. Cell. 1997; 91: 243-252Abstract Full Text Full Text PDF PubMed Scopus (1589) Google Scholar). The catalytic subunits are associated with each other via their leucine zippers (11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar), and the helix-loop-helix domains are required for full IKK activation (14Delhase M. Hayakawa M. Chen Y. Karin M. Science. 1999; 284: 309-313Crossref PubMed Scopus (752) Google Scholar, 15Zandi E. Karin M. Mol. Cell Biol. 1999; 19: 4547-4551Crossref PubMed Scopus (307) Google Scholar). It has been suggested that intramolecular interaction of the helix-loop-helix with the kinase domain is involved in IKK activation (14Delhase M. Hayakawa M. Chen Y. Karin M. Science. 1999; 284: 309-313Crossref PubMed Scopus (752) Google Scholar, 15Zandi E. Karin M. Mol. Cell Biol. 1999; 19: 4547-4551Crossref PubMed Scopus (307) Google Scholar). Studies of recombinant IKKα and IKKβ in insect cells indicate that the catalytic subunits are capable of forming both homodimers and heterodimers (11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar). Despite the high degree of sequence similarity between IKKα and IKKβ (52% overall identity and 65% identity in the kinase domains (10Zandi E. Rothwarf D.M. Delhase M. Hayakawa M. Karin M. Cell. 1997; 91: 243-252Abstract Full Text Full Text PDF PubMed Scopus (1589) Google Scholar)), the two proteins differ. Whereas IKKβ is essential for induction of NF-κB by cytokines, IKKα is essential for limb development and skin differentiation (16Takeda K. Takeuchi O. Tsujimura T. Itami S. Adachi O. Kawai T. Sanjo H. Yoshikawa K. Terada N. Akira S. Science. 1999; 284: 313-316Crossref PubMed Scopus (539) Google Scholar, 17Hu Y. Baud V. Delhase M. Zhang P. Deerinck T. Ellisman M. Johnson R. Karin M. Science. 1999; 284: 316-320Crossref PubMed Scopus (714) Google Scholar, 18Li Q. VanAntwerp D. Mercurio D. Lee K.F. Verma I.M. Science. 1999; 284: 321-325Crossref PubMed Scopus (856) Google Scholar). Moreover, IKKβ homodimer has ∼30-fold higher activity toward IκBα than IKKα (19Huynh Q.K. Boddupalli H. Rouw S.A. Koboldt C.M. Hall T. Sommers C. Hauser S.D. Pierce J.L. Combs R.G. Reitz B.A. Diaz-Collier J.A. Weinberg R.A. Hood B.L. Kilpatrick B.F. Tripp C.T. J. Biol. Chem. 2000; 275: 25883-25891Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). Other homologs of IKKα and IKKβ have been isolated, including TBK1/NAK (20Tojima Y. Fujimoto A. Delhase M. Chen Y. Hatakeyama S. Nakayama K.-i. Kaneko Y. Nimura Y. Motoyama N. Ikeda K. Karin M. Nakanishi M. Nature. 2000; 404: 778-782Crossref PubMed Scopus (316) Google Scholar, 21Pomerantz, J. L., and Baltimore, D. (1999) EMBO J.6694–6704Google Scholar) and IKKi/IKKε (22Peters R.T. Liao S.-M. Maniatis T. Mol. Cell. 2000; 5: 513-522Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar, 23Nomura F. Kawai T. Nakanishi K. Akira S. Genes Cells. 2000; 5: 191-202Crossref PubMed Scopus (97) Google Scholar). Based on gel filtration analysis, IKK predominantly forms a 700–900-kDa complex containing IKKα, IKKβ, and IKKγ, but some IKK also elutes at 230 kDa (6Rothwarf D.M. Karin M. Signal Transduction Knowledge Environment. 1999; 5: 1-16Google Scholar, 8DiDonato J.A. Hayakawa M. Rothwarf D.M. Zandi E. Karin M. Nature. 1997; 388: 548-554Crossref PubMed Scopus (1913) Google Scholar). The stoichiometry of IKK subunits in the large complex is still not known. The 230-kDa complex appears to be dimers containing only IKKα and IKKβ, because IKKα and IKKβ expressed in insect cells and purified to homogeneity elute at 230 kDa (11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar) and because, in IKKγ-deficient cells, IKKα and IKKβ elute at this size (12Yamaoka S. Courtois G. Bessia C. Whiteside S.T. Weil R. Agou F. Kirk H.E. Kay R.J. Israel A. Cell. 1998; 93: 1231-1240Abstract Full Text Full Text PDF PubMed Scopus (950) Google Scholar). The large IKK complex contains a roughly stoichiometric amount of IKKα and IKKβ and an unknown amount of IKKγ (6Rothwarf D.M. Karin M. Signal Transduction Knowledge Environment. 1999; 5: 1-16Google Scholar, 8DiDonato J.A. Hayakawa M. Rothwarf D.M. Zandi E. Karin M. Nature. 1997; 388: 548-554Crossref PubMed Scopus (1913) Google Scholar,13Rothwarf D.M. Zandi E. Natoli G. Karin M. Nature. 1998; 395: 297-300Crossref PubMed Scopus (853) Google Scholar). IKKγ is required for the stimulation of IKK activity by upstream signals such as TNF, Tax, lipopolysaccharide, phorbol 12-myristate 13-acetate, and interleukin 1 (12Yamaoka S. Courtois G. Bessia C. Whiteside S.T. Weil R. Agou F. Kirk H.E. Kay R.J. Israel A. Cell. 1998; 93: 1231-1240Abstract Full Text Full Text PDF PubMed Scopus (950) Google Scholar, 13Rothwarf D.M. Zandi E. Natoli G. Karin M. Nature. 1998; 395: 297-300Crossref PubMed Scopus (853) Google Scholar). An α-helical region toward the N terminus of IKKγ interacts with six amino acids at the very C terminus of IKKα and IKKβ (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar); interfering with this interaction by means of a peptide inhibitor in cells diminishes stimulation of IKK by TNFα (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar). The effect of IKKγ on basal IKK activity is less clear. One report indicated that IKKβ (lacking the C-terminal region, where it binds to IKKγ) was able to activate NF-κB 1.5–2 times more than wild-type IKKβ, and expression of IKKβ that contains point mutations to prevent IKKγ binding was able to activate NF-κB to a greater extent than IKKβ that is capable of binding IKKγ (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar). Moreover, Mayet al. (Ref. 24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar; see their Fig. 4F) showed that the peptide that diminished interaction of IKKγ with IKKβ increased basal NF-κB activity 2-fold (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar). From these experiments, the authors suggested that interfering with the interaction of IKKγ and IKKβ increases basal intrinsic activity of IKK (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar). By contrast, another report indicated that expressed IKKβ in COS cells alone had low activity but that its activity was stimulated by co-expression of IKKγ, suggesting that IKKγ stimulates IKKβ (in the absence of stimuli) (25Li X.-H. Fang X. Gaynor R.B. J. Biol. Chem. 2001; 276: 4494-4500Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). To better understand whether the presence of IKKγ has a stimulatory or inhibitory effect on IKKβ in the absence of stimulation and to ascertain the role of the IKKγ binding domain (γBD) on basal IKK activity, reconstitution of the full IKK complex in a model system lacking endogenous IKK and its upstream signaling pathways would be very helpful. In this paper, we demonstrate that human IKK can be reconstituted in yeast and forms a complex that is the same size as IKK isolated from human cells. The activity of this complex was 4–5-fold higher than the IKK activity from nonstimulated HeLa cells. We used this reconstituted system to study the role of the interaction of IKKγ with IKKα and IKKβ (on the level of kinase activity) and also to study the stoichiometry of subunits. All IKK subunits were expressed with an influenza hemagglutinin (HA) tag at the N terminus. HA-IKKγ was subcloned into the p425 methionine-inducible yeast expression vector, which contains a LEU2 selection marker (26Mumberg D. Muller R. Funk M. Nucleic Acids Res. 1994; 22: 5767-5768Crossref PubMed Scopus (803) Google Scholar). The promoter regions of pESC-ura and pESC-trp (Stratagene) were removed and replaced with the promoter, multiple cloning site, and transcription termination sequence from p425, and HA-IKKα and HA-IKKβ were subcloned into these vectors, respectively, to generate pESC ura met HA-IKKα and pESC trp met HA-IKKβ. The mutant IKKβΔγBD was generated by PCR using Pfupolymerase (Stratagene) and the primers 5′-GTTAAATGAGGGCCACACATTGG and 5′-TCATGAGGCCTGCTCCAGGCAGCTGTGCTCTTCTTCTTCCGTCTGGGCCG TGAAACTCTG to loop out the 18 nucleotides corresponding to the γBD (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar); the PCR product was digested and subcloned into the vector pESC trp met HA-IKKβ. IKKαΔγBD was constructed using PCR to truncate the last 8 amino acids using the primers 5′ GGATCAGATTATGTCTTTGCATGC and 5′ CCCGTTAACTCAATTCATCATACT and subcloned into the pESC ura met HA-IKKα vector. The deleted regions were verified by sequencing. Plasmids were transformed into Saccharomyces cerevisiaestrain YPH499 (Stratagene) using lithium acetate as described (Stratagene pESC Yeast Epitope Tagging Vectors Instruction Manual). A 2-ml overnight culture of yeast was grown in selective drop-out medium (Q-Biogene) containing 4 mmmethionine (Q-Biogene) to suppress expression of the IKK and then amplified in 400 ml of selective noninducing drop-out medium. The yeast were grown at 30 °C with shaking at 300 rpm for 30 h before being transferred to inducing medium (without methionine) for 10–12 h (at 30 °C with shaking). For harvesting and lysing the yeast, all steps were performed at 4 °C unless otherwise indicated. They were first washed in 400 mm (NH4)2SO4, 200 mm Tris-HCl (pH 8.0), 10 mm MgCl2, 10% glycerol containing protease inhibitors (2.5 μg/ml leupeptin, 20 μg/ml aprotinin, 2.5 μg/ml antipain, 2 μg/ml pepstatin, 1 mm phenylmethylsulfonyl fluoride, 0.1 μg/ml chymostatin, and 1.1 μg/ml phosphoramidon). 1–2 g of yeast pellet was resuspended in 2 ml of lysis buffer (20 mm Tris (pH 7.6), 20 mm NaF, 20 mm β-glycerophosphate, 0.5 mm Na3VO4, 2.5 mmsodium metabisulfite, 5 mm benzamidine, 1 mm EDTA, 0.5 mm EGTA, 10% glycerol, 300 mm NaCl, 1% Triton X-100, 2 mm dithiothreitol with protease inhibitors) in a capped 15-ml conical tube, frozen at −80 °C, and thawed on ice. Acid-washed 425–600-μm glass beads from Sigma (equal in volume to the yeast pellet) were added to the yeast, and the suspension was vortexed 3 times for 1 min each (with 1-min incubation on ice between mixings). Then the suspension was centrifuged at 3000 × g for 3 min, and the supernatant was collected. To extract more protein, 1 ml of additional lysis buffer was added to the yeast, and the vortexing and centrifugation and resuspension procedure was repeated an additional eight times. To remove particulate material, the crude supernatant was centrifuged at 65,000 × g for 1.5 h, and the supernatant was collected and stored at –80 °C. For some experiments, IKK was partially purified by gel filtration. For all gel filtration procedures, up to 0.3 ml of sample (0.3–1 mg of yeast extract) was injected onto a Superose 6 gel filtration column (Amersham Pharmacia Biotech). For HeLa cell extracts, IKK was concentrated by Q Sepharose chromatography prior to gel filtration. Samples were fractionated with a flow rate of 0.3 ml per min, and 1-ml fractions were collected. The gel filtration buffer contained 20 mm Tris (pH 7.6), 20 mm NaF, 20 mmβ-glycerophosphate, 0.5 mmNa3VO4, 2.5 mm sodium metabisulfite, 5 mm benzamidine, 1 mmEDTA, 0.5 mm EGTA, 10% glycerol, 300 mm NaCl, and 0.1% Brij 35. The column was calibrated using the following standards (Amersham Pharmacia Biotech): blue dextran 2000 (void,V0), thyroglobulin (670 kDa), ferritin (440 kDa), catalase (230 kDa), and aldolase (158 kDa). Lysates (S100 supernatants) from nonstimulated or TNF-stimulated HeLa cells were prepared as previously described (8DiDonato J.A. Hayakawa M. Rothwarf D.M. Zandi E. Karin M. Nature. 1997; 388: 548-554Crossref PubMed Scopus (1913) Google Scholar). IKKγ with a hexahistidine tag was expressed in Escherichia coli and purified by nickel affinity chromatography as described previously (13Rothwarf D.M. Zandi E. Natoli G. Karin M. Nature. 1998; 395: 297-300Crossref PubMed Scopus (853) Google Scholar). IKKβ with a hexahistidine tag was expressed in Sf9 cells and purified by nickel affinity chromatography as described (11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar). Extracts or fast protein liquid chromatography fractions from HeLa cells and yeast were immunoprecipitated using 1 μg of monoclonal anti-IKKα antibodies (B78–1, Pharmingen) followed by binding to protein G-Sepharose beads (Amersham Pharmacia Biotech). Immune complexes were pelleted and washed once with lysis buffer and once with 20 mm Tris (pH 7.6), 20 mmMgCl2. For kinase assays, 5–15 μl of fast protein liquid chromatography fraction or washed immune complexes was incubated for 30 min at 30 °C with a 30-μl reaction mixture containing 20 mm Tris (pH 7.6), 20 mm MgCl2, 20 μm cold ATP, 2 mm dithiothreitol, 33 μg/ml GST-IκBα1–54, and γ-32P ATP (ICN). (GST-IκBα1–54, expressed in bacteria and purified using glutathione-Sepharose beads (Amersham Pharmacia Biotech), was used as the substrate because it contains the regulatory serines but lacks other residues that could be phosphorylated nonspecifically (27DiDonato J.A. Mercurio F. Rosette C. Wu-Li J. Suyang H. Ghosh S. Karin M. Mol. Cell Biol. 1996; 16: 1295-1304Crossref PubMed Google Scholar).) The reaction was terminated by the addition of SDS-PAGE sample buffer and heating for 5 min at 97 °C. After SDS-PAGE and transfer (see below) radiolabeling was detected by PhosphorImager (Molecular Dynamics). Extracts, immunoprecipitated proteins, and fast protein liquid chromatography fractions were electrophoresed by SDS-PAGE and transferred to polyvinylidene difluoride (Bio-Rad). Blots were probed using monoclonal antibodies directed against IKKα, IKKβ, or IKKγ (Imgenex) or against HA (USC/Norris core facility) followed by horseradish peroxidase-linked anti-mouse IgG antibodies (Amersham Pharmacia Biotech) and then detected by chemiluminescence (Pierce SuperSignal reagent). For experiments to quantify the ratio of catalytic to regulatory subunits, proteins were transferred for 2 h at 300 mA; to verify that the transfer of IKK proteins was complete, any remaining proteins in the gel were transferred to a second polyvinylidene difluoride membrane. The results indicated that 99% of IKKβ and 100% of IKKγ were transferred under our conditions. Densitometry was performed using a Bio-Rad Fluor-S Max quantification system. Endogenous and recombinantly expressed IKK has been characterized from mammalian cells as well as insect cells (Sf9 cells with the baculovirus system), but the yeast system may have some advantages for biochemical studies. The baculovirus expression system in Sf9 cells has been successfully used to reconstitute catalytic subunits (11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar, 19Huynh Q.K. Boddupalli H. Rouw S.A. Koboldt C.M. Hall T. Sommers C. Hauser S.D. Pierce J.L. Combs R.G. Reitz B.A. Diaz-Collier J.A. Weinberg R.A. Hood B.L. Kilpatrick B.F. Tripp C.T. J. Biol. Chem. 2000; 275: 25883-25891Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). However, a complete reconstitution has not been shown in Sf9 cells and is not practical due to the complications associated with multiple viral infection in Sf9 cells. Mechanistic analysis is also complicated in Sf9 and mammalian cells by the presence of endogenous proteins because expressed mutated forms of IKK are directed into heterocomplexes containing endogenous proteins (11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar). Recent development of IKK knockout cell lines partially resolves this problem, but there are also newly discovered IKK homologs that may have some redundant and overlapping functions. Many of these potential pitfalls can be overcome by using a reconstituted system. Current knowledge indicates that S. cerevisiae lacks NF-κB activity (28Epinat J.-C. Whiteside S.T. Rice N.R. Israel A. Yeast. 1997; 13: 599-612Crossref PubMed Scopus (13) Google Scholar) and therefore is unlikely to contain NF-κB or its upstream signaling molecules. Therefore, exogenously expressed proteins (such as IKK subunits) probably would not be affected by yeast signaling pathways. The three subunits of IKK were subcloned into plasmids (each with a different selection marker: uracil, tryptophan, or leucine) containing HA tags and methionine-inducible promoters and transformed into yeast. (The inducible system was used in order to grow the yeast to a sufficient density before induction in case the expressed proteins were toxic). The yeast were grown in selective liquid media prior to induction. After 10–12 h induction, the yeast were washed and lysed, and the S100 was obtained (see under "Experimental Procedures"). As indicated by Western blot (Fig.1A), yeast that were not transformed did not contain IKKα, IKKβ, or IKKγ (see thefar right lane (YPD)); however, these yeast do contain a protein recognized by the αHA antibody that runs below IKKγ (data not shown). Yeast were transformed with IKKα, IKKβ, or IKKγ in various combinations, and clones expressing the IKK proteins at high levels were chosen for further study. In most clones transformed with multiple subunits, the IKKγ expression was higher than the expression of α or β (as assessed by Western analysis with their identical HA tag). The level of IKKα was slightly lower than the level of IKKβ in the IKKα·β·γ clone shown (which was used for further studies). Because IKK expressed in bacteria forms large aggregates that are not native (data not shown), we needed first to determine whether IKK reconstituted in yeast formed a complex that was similar in size to IKK isolated from human cells. Extracts from untransformed yeast and yeast expressing human IKKβ or IKKα·β·γ or mutant IKKβKA·γ were fractionated on a Superose 6 gel filtration column, and IKK activity toward GST-IκBα1–54 was assessed in each fraction. As shown in Fig. 1B, IKKβ (alone) produced in yeast runs at 158–300 kDa; this is the same size as dimers of IKKβ (without IKKγ) from mammalian or Sf9 cells (11Zandi E. Chen Y. Karin M. Science. 1998; 281: 1360-1363Crossref PubMed Google Scholar). The predominant peak of IKK from TNF-stimulated HeLa cells elutes at about 900 kDa. IKKα·β·γ produced in yeast produces two peaks, one the size of the full IKK complex from human cells and the other around 158–300 kDa (the size of the catalytic subunit dimers). Extracts from untransformed yeast and from yeast expressing mutant IKKβKA·γ do not have significant IKK activity in any fraction (compared with an equal amount of fractions 10–11 taken from yeast expressing IKKα·β·γ). Similar results were obtained when IKK was isolated from each fraction by immunoprecipitation for kinase assay. These results indicate that the IKK that we have expressed in yeast is native and that, most likely, the 900-kDa complex contains no additional proteins. To demonstrate that it behaves the same as in mammalian cells, we expressed a mutant of IKK in which the critical lysine in the catalytic site is mutated to alanine (βKA); this IKK was inactive as assessed by immunoprecipitation/kinase assay (Fig. 1C). The IKKα, IKKβ, and IKKγ that were used for yeast expression have identical HA tags at their N termini. This allowed us to determine the ratio of regulatory to catalytic subunits in the complex. Supernatant from yeast co-expressing human IKKβ and IKKγ was partially purified by gel filtration to remove any subunits that were not incorporated into the large complex. The 900-kDa fraction was analyzed by Western blot using antibodies directed against HA. As shown in Fig.2A, there is roughly an equal amount of IKKβ and IKKγ in this complex. Densitometric analysis indicates that the ratio of γ to β is between 1.2 and 1.5. Similarly, when IKKα·β·γ was partially purified by gel filtration and analyzed by Western using antibodies against HA, the ratio of IKK(α+β) to IKKγ was 1:1. We attempted to use the HA immunoblot to quantify the ratio of IKKα to IKKβ, but unfortunately, the tagged proteins are inseparable, even with a large 7.5% SDS-PAGE gel (Fig. 2B). It was previously shown (by Coomassie Blue staining) that the IKK complex contains roughly equal amounts of IKKα and IKKβ (13Rothwarf D.M. Zandi E. Natoli G. Karin M. Nature. 1998; 395: 297-300Crossref PubMed Scopus (853) Google Scholar). Therefore, the core subunit composition of IKKα·β·γ complex is α1β1γ2, and the core subunit composition of IKKβ·γ is β2γ2. In terms of activity, we predicted two possible scenarios: 1) that the complex would be low activity (similar to or lower than IKK activity from nonstimulated HeLa cells), or 2) that the complex would have high activity (similar to IKK from TNF-stimulated cells). IKK activity from yeast expressing IKKα·β·γ (partially purified by gel filtration) was compared with nonstimulated and TNF-stimulated HeLa cell extracts (S100); for these studies, the complexes were all immunoprecipitated using specific antibodies against IKKα (the subunit that was limiting in the yeast). The results (Fig.3A) indicate that the activity of yhIKKα·β·γ is intermediate to nonstimulated and TNF-stimulated HeLa cells. The activity of TNF-stimulated HeLa cells was ∼15–20-fold higher than the activity from nonstimulated HeLa cells, and the activity of IKKα·β·γ expressed in yeast was ∼4-fold higher than the activity from nonstimulated HeLa cells (Fig.3B). To verify that the IKK complex reconstituted in yeast is specific for the regulatory serines in IκBα, we tested the activity of this enzyme toward a mutant form of IκBα in which the regulatory serines are substituted with alanines (AA). Similar to the enzyme from HeLa cells, IKKα·β·γ made in yeast phosphorylates wild-type IκBα1–54 but not the AA mutant (Fig.3C). We also compared the various recombinant IKK complexes expressed in yeast to each other. Fig. 3D compares the activities of IKKα, IKKα·γ, and IKKα·β·γ. The 900-kDa complexes of IKKα·γ and IKKα·β·γ were partially purified by gel filtration before immunoprecipitation to eliminate complexes not containing γ, whereas IKKα was immunoprecipitated directly from the S100. (Samples were adjusted to contain similar amounts of IKKα in this experiment. Because the stoichiometry of IKKα·β·γ is 1:1:2, and the stoichiometry of α·γ is 2:2, the IKKα·β·γ sample contained approximately twice as many total IKK complexes as IKKα or IKKα·γ.) The results indicate that IKKα and IKKα·γ have very low kinase activity toward GST-IκBα1–54 whereas IKKα·β·γ has much higher kinase activity. The activity of IKKα·γ was over twice the activity of IKKα alone. The activity of IKKα·β·γ was 10–13-fold higher than that of IKKα·γ. Next, we compared the activities of IKKβ, IKKβ·γ, and IKKα·β·γ complexes reconstituted in yeast and partially purified by gel filtration. As shown in Fig. 3E, the activity of IKKβ was lower than the IKK activity of the complexes containing IKKβ·γ or IKKα·β·γ. The activity of IKKβ·γ and IKKα·β·γ was ∼7–15-fold higher than that of IKKβ alone. These data suggest that IKKγ plays a role in allowing the kinase to self-activate. The kinase-stimulating effect of co-expression of IKKγ with IKKβ was observed in completely different yeast clones and preparations, indicating that the effect is a general phenomenon (data not shown). Moreover, the higher activities of IKKβ·γ and IKKα·β·γ than IKKβ alone was observed over a range of IκBα concentrations, indicating that the substrate was not limiting (Fig. 3F). Finally, we compared the activity of IKKβ·γ expressed in yeast to IKKβ expressed in Sf9 by immunoprecipitation/kinase assay; the results (Fig.3G) indicate that the enzyme expressed in Sf9 cells is over twice as active as the enzyme expressed in yeast. To further explore the role of IKKγ on the activity of IKK, we generated IKKα and IKKβ constructs in which the γBD at the C terminus (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar) has been deleted. IKKβΔγBD was transformed alone and along with IKKγ and IKKγ plus IKKαΔγBD intoS. cerevisiae and the interaction of IKKγ with these mutants was assessed by immunoprecipitation and by gel filtration. As previously shown by affinity pull-down analysis (24May M.J. D'Acquisto F. Madge L.A. Glockner J. Pober J.S. Ghosh S. Science. 2000; 289: 1550-1554Crossref PubMed Scopus (618) Google Scholar), the interaction of IKKγ with IKKβΔγBD was very weak compared with the interaction of IKKγ with wild-type IKKβ as assessed by immunoprecipitation (data not shown). However, the interaction of IKKγ with IKKβΔγBD or with IKKαΔγBD+ IKKβΔγBD was not entirely abolished as assessed by gel filtration. As shown in Fig.4A, IKKβΔγBDexpressed alone elutes from the Superose 6 gel filtration column at 158–300 kDa (the same as wild-type IKKβ). However, when co-expressed with IKKγ in the yeast, some of the IKKβΔγBD forms a complex with IKKγ and elutes as a high molecular weight complex. Similarly, some of the IKKαΔγBD+IKKβΔγBD forms a >700-kDa complex with IKKγ. Whereas wild-type IKKβ·γ and wild-type IKKα·β·γ elute predominantly in fractions 10 and 11 (∼900 kDa), the IKKαΔγBD·βΔγBD·γ and IKKβΔγBD·γ complexes eluted predominantly in fractions 11 and 12, suggesting that the size or shape of the complex may be slightly different from wild-type IKK. To investigate the role of the γBD in IKK activity, we compared the activity of these mutant forms to the corresponding wild-types (Fig.4B). IKKβΔγBD alone had a level of activity similar to that of IKKβ wild-type, and as shown previously, the activity of IKKβ alone was much lower than that with IKKγ. We looked at two gel filtration fractions from the IKKβΔγBD·γ extract, fraction 11, in which IKKβΔγBD was complexed with IKKγ, and fraction 14, which was devoid of IKKγ. Fraction 11 had very low activity, indicating that the association of IKKβΔγBD with IKKγ was not enough for IKKγ to allow IKK to self-activate, suggesting that the γBD is required for the self-activation of IKKβ in the absence of stimulation. Fraction 14 had a level of activity that was similar to that of wild-type IKKβ and that of IKKβΔγBD alone. Similar effects were observed when we compared the activity of IKKα·β·γ wild-type to IKKαΔγBD·βΔγBD·γ. Association of IKKγ with the IKKαΔγBD and IKKβΔγBD mutants was not sufficient to allow the complex to self-activate. It appears that the presence of the γBD is needed for IKKγ to allow IKK to self-activate even in the absence of upstream signaling. This may suggest that this interaction is inhibited in resting mammalian cells. Finally, we wanted to investigate whether we could activate IKKβ by the addition of purified IKKγ in vitro. IKKβ (partially purified by gel filtration) was incubated with 0, 10, and 50 ng of pure IKKγ for 30 min on ice before assessment of IKK activity. As shown in Fig. 4C, addition of IKKγ could not activate the kinase. Similarly, incubation of IKKγ with IKKβΔγBD did not change the kinase activity. This suggests that the IKKγ must form a complex with IKKβ in vivo in order to facilitate self-activation. Previous research indicated that S. cerevisiae lacks NF-κB activity (28Epinat J.-C. Whiteside S.T. Rice N.R. Israel A. Yeast. 1997; 13: 599-612Crossref PubMed Scopus (13) Google Scholar), and this report indicates that yeast do not contain IKK subunits as assessed by Western blot and also lack the ability to phosphorylate the regulatory serines on IκBα. Reconstitution of IKK complex containing α, β, and γ subunits turned out to be a useful tool because it allowed production of a large quantity of native complex for structural and mechanistic studies. Similar to mammalian and insect cells, IKK catalytic subunits expressed alone in yeast form relatively small 158–300-kDa complexes, whereas the catalytic subunits co-expressed with IKKγ elute at ∼900 kDa. This indicates that the IKK reconstituted in yeast is native and most likely contains no additional proteins. Through the use of the identical HA tag on each subunit, we were able to show that there is approximately a 1:1 ratio of IKK catalytic subunits to IKKγ. Therefore, the core subunit composition of IKKα·β·γ is α1β1γ2. Both IKKα and IKKα·γ reconstituted in yeast had a much lower level of kinase activity toward GST-IκBα1–54 than IKKα·β·γ when adjusted for equal amounts of IKKα. This was a predicted result because it was previously shown that IKKβ is a more effective kinase for IκBα than IKKα (19Huynh Q.K. Boddupalli H. Rouw S.A. Koboldt C.M. Hall T. Sommers C. Hauser S.D. Pierce J.L. Combs R.G. Reitz B.A. Diaz-Collier J.A. Weinberg R.A. Hood B.L. Kilpatrick B.F. Tripp C.T. J. Biol. Chem. 2000; 275: 25883-25891Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). The activity of reconstituted IKKα·β·γ was higher than an equivalent amount of IKK from nonstimulated HeLa cells but lower than an equivalent amount of IKK from TNF-simulated HeLa cells. In mammalian cells, IKK is regulated by phosphorylation and dephosphorylation, but the exact mechanisms of regulation are still not known. IKK activity is inhibited by PP2A in vitro, indicating that the kinase is activated by phosphorylation (8DiDonato J.A. Hayakawa M. Rothwarf D.M. Zandi E. Karin M. Nature. 1997; 388: 548-554Crossref PubMed Scopus (1913) Google Scholar). Phosphorylation of two sites in the activation loop of IKKβ is essential for activation of IKK by itself or after stimulation with TNF or interleukin 1, although the kinase responsible is unknown (14Delhase M. Hayakawa M. Chen Y. Karin M. Science. 1999; 284: 309-313Crossref PubMed Scopus (752) Google Scholar). Putative upstream kinases of IKK include NF-κB-inducing kinase (29Regnier C.H. Song H.Y. Gao X. Goeddel D.V. Cao Z. Rothe M. Cell. 1997; 90: 373-383Abstract Full Text Full Text PDF PubMed Scopus (1072) Google Scholar), mixed-lineage kinase (30Hehner S.P. Hofmann T.G. Ushmorov A. Dienz O. Leung I.W. Lassam N. Scheidereit C. Droge W. Schmitz M.L. Mol. Cell Biol. 2000; 20: 2556-2568Crossref PubMed Scopus (99) Google Scholar), NF-κB-activating kinase (20Tojima Y. Fujimoto A. Delhase M. Chen Y. Hatakeyama S. Nakayama K.-i. Kaneko Y. Nimura Y. Motoyama N. Ikeda K. Karin M. Nakanishi M. Nature. 2000; 404: 778-782Crossref PubMed Scopus (316) Google Scholar), and DNA-dependent protein kinase (31Chu W.-M. Gong X. Li Z.-W. Takabayashi K. Ouyang H.-H. Chen Y. Lois A. Chen D.J. Li G.C. Karin M. Raz E. Cell. 2000; 103: 909-918Abstract Full Text PDF PubMed Scopus (159) Google Scholar). There is also evidence to suggest that the phosphorylation of T-loop residues may occur through autophosphorylation (15Zandi E. Karin M. Mol. Cell Biol. 1999; 19: 4547-4551Crossref PubMed Scopus (307) Google Scholar), indicating that IKK can self-activate. The partial activation of IKK reconstituted in yeast could be explained if yeast contains a true IKK activator (such as an upstream kinase like mitogen-activated protein kinase kinase kinase) that is only partially active under conditions in which the IKK was being made. Alternatively, the yeast may contain a kinase that is homologous to the true IKK activator but far less capable of activating IKK. On the other hand, it is possible that the partial activity of IKK reconstituted in yeast is due to lack of negative regulation in the yeast. An enzymatic activity or negative regulator using a different mechanism may be preventing IKK self-activation in mammalian cells. This negative regulation may occur through regulation of IKKα·β interaction with IKKγ (see below). IKK reconstituted in yeast will provide a useful system for analyzing putative positive and negative regulators of IKK. The yeast reconstitution system was used to assess the role of IKKγ on IKK activity and to assess the importance of the γBDs found in IKKβ and IKKα. IKKβ expressed in yeast in the absence of IKKγ had much lower IKK activity than IKKβ·γ or IKKα·β·γ. There are two alternative reasons for lower kinase activity in the absence of IKKγ. First, it is possible that IKKγ is needed to allow homologous signaling proteins present in yeast to activate the expressed IKK (to the small extent it was activated). Second, it is also possible that IKK needs to form a large complex in order to autophosphorylate and self-activate and does so through IKKγ. The fact that IKKβΔγBD·γ and IKKαΔγBD·βΔγBD·γ formed large but inactive complexes indicates that IKKγ interacts with different regions of IKKα and IKKβ to hold the complex together, and the interaction of IKKγ with the γBD of IKKα and IKKβ is a dynamic interaction required for activation. The yeast data suggest that this dynamic interaction is somehow prevented in resting mammalian cells. In addition, the 4–5-fold higher activity from TNFα-stimulated cells over IKK expressed in yeast suggests that interaction of IKKγ with the C terminus of IKKα and IKKβ, although required for activation, is not sufficient for full activation of IKK. This in turn suggests that IKK may be regulated by a multistep mechanism. A multistep activation mechanism would provide IKK with the regulatory potential,e.g. being activated at different intensities and kinetics, to respond to the great diversity of NF-κB inducers. The yeast reconstitution system will provide a useful tool for further structural and mechanistic analyses of IKK. Human IKK expressed in yeast can be used for clean mechanistic analysis because there is no background of endogenous IKK proteins. It is also useful for biochemical and regulatory studies, because when the IKK is expressed in yeast and isolated, it is simple to test whether a single molecule or subcellular fraction changes the activity of the enzyme. Finally, it can be used to study the structure and composition of the IKK complexes. We thank Dr. Ami Aronheim, Hugo Lee, and Cindy Feei-Chyong Yen for various reagents.