Structural and Functional Analysis of a Glycoside Hydrolase Family 97 Enzyme from Bacteroides thetaiotaomicron
2008; Elsevier BV; Volume: 283; Issue: 52 Linguagem: Inglês
10.1074/jbc.m806115200
ISSN1083-351X
AutoresMomoyo Kitamura, Masayuki Okuyama, Fumiko Tanzawa, Haruhide Mori, Yu Kitago, Nobuhisa Watanabe, Atsuo Kimura, Isao Tanaka, Min Yao,
Tópico(s)Microbial Metabolites in Food Biotechnology
ResumoSusB, an 84-kDa α-glucoside hydrolase involved in the starch utilization system (sus) of Bacteroides thetaiotaomicron, belongs to glycoside hydrolase (GH) family 97. We have determined the enzymatic characteristics and the crystal structures in free and acarbose-bound form at 1.6Å resolution. SusB hydrolyzes the α-glucosidic linkage, with inversion of anomeric configuration liberating the β-anomer of glucose as the reaction product. The substrate specificity of SusB, hydrolyzing not only α-1,4-glucosidic linkages but also α-1,6-, α-1,3-, and α-1,2-glucosidic linkages, is clearly different from other well known glucoamylases belonging to GH15. The structure of SusB was solved by the single-wavelength anomalous diffraction method with sulfur atoms as anomalous scatterers using an in-house x-ray source. SusB includes three domains as follows: the N-terminal, catalytic, and C-terminal domains. The structure of the SusB-acarbose complex shows a constellation of carboxyl groups at the catalytic center; Glu532 is positioned to provide protonic assistance to leaving group departure, with Glu439 and Glu508 both positioned to provide base-catalyzed assistance for inverting nucleophilic attack by water. A structural comparison with other glycoside hydrolases revealed significant similarity between the catalytic domain of SusB and those of α-retaining glycoside hydrolases belonging to GH27, -36, and -31 despite the differences in catalytic mechanism. SusB and the other retaining enzymes appear to have diverged from a common ancestor and individually acquired the functional carboxyl groups during the process of evolution. Furthermore, sequence comparison of the active site based on the structure of SusB indicated that GH97 included both retaining and inverting enzymes. SusB, an 84-kDa α-glucoside hydrolase involved in the starch utilization system (sus) of Bacteroides thetaiotaomicron, belongs to glycoside hydrolase (GH) family 97. We have determined the enzymatic characteristics and the crystal structures in free and acarbose-bound form at 1.6Å resolution. SusB hydrolyzes the α-glucosidic linkage, with inversion of anomeric configuration liberating the β-anomer of glucose as the reaction product. The substrate specificity of SusB, hydrolyzing not only α-1,4-glucosidic linkages but also α-1,6-, α-1,3-, and α-1,2-glucosidic linkages, is clearly different from other well known glucoamylases belonging to GH15. The structure of SusB was solved by the single-wavelength anomalous diffraction method with sulfur atoms as anomalous scatterers using an in-house x-ray source. SusB includes three domains as follows: the N-terminal, catalytic, and C-terminal domains. The structure of the SusB-acarbose complex shows a constellation of carboxyl groups at the catalytic center; Glu532 is positioned to provide protonic assistance to leaving group departure, with Glu439 and Glu508 both positioned to provide base-catalyzed assistance for inverting nucleophilic attack by water. A structural comparison with other glycoside hydrolases revealed significant similarity between the catalytic domain of SusB and those of α-retaining glycoside hydrolases belonging to GH27, -36, and -31 despite the differences in catalytic mechanism. SusB and the other retaining enzymes appear to have diverged from a common ancestor and individually acquired the functional carboxyl groups during the process of evolution. Furthermore, sequence comparison of the active site based on the structure of SusB indicated that GH97 included both retaining and inverting enzymes. Bacteroides thetaiotaomicron, the genome of which has been fully sequenced (1Xu J. Bjursell M. Himrod J. Deng S. Carmichael L. Chiang H. Hooper L. Gordon J. Science. 2003; 299: 2074-2076Crossref PubMed Scopus (1005) Google Scholar), is a bacterial symbiont that is a dominant member of the intestinal microbiota of humans and other mammals. The number of glycoside hydrolases encoded by B. thetaiotaomicron is much greater than reported for any other sequenced bacterium (2Comstock L. Coyne M. BioEssays. 2003; 25: 926-929Crossref PubMed Scopus (69) Google Scholar), in accordance with the fact that this bacterium is known to salvage energy from nutrients, particularly carbohydrates, which are otherwise nondigestible by the host. According to CAZy (3Henrissat B. Biochem. J. 1991; 280: 309-316Crossref PubMed Scopus (2589) Google Scholar, 4Henrissat B. Bairoch A. Biochem. J. 1993; 293: 781-788Crossref PubMed Scopus (1758) Google Scholar, 5Henrissat B. Bairoch A. Biochem. J. 1996; 316: 695-696Crossref PubMed Scopus (1178) Google Scholar), the genome of B. thetaiotaomicron encodes 230 glycoside hydrolases. The B. thetaiotaomicron proteome includes 172 glycoside hydrolases, 163 outer membrane polysaccharide-binding proteins, and 20 sugar-specific transporters (2Comstock L. Coyne M. BioEssays. 2003; 25: 926-929Crossref PubMed Scopus (69) Google Scholar). Therefore, studies regarding these enzymes may lead to the discovery of new enzymatic specificities and contribute to the development of enzyme chemistry.The well known polysaccharide utilization system of B. thetaiotaomicron is the starch utilization system (sus) operon (6Hooper L. Midtvedt T. Gordon J. Annu. Rev. Nutr. 2002; 22: 283-307Crossref PubMed Scopus (1159) Google Scholar). The sus operon contains transcriptional regulator (SusR) (7Cho K. Cho D. Wang G. Salyers A. J. Bacteriol. 2001; 183: 7198-7205Crossref PubMed Scopus (35) Google Scholar, 8D'Elia J. Salyers A. J. Bacteriol. 1996; 178: 7180-7186Crossref PubMed Scopus (86) Google Scholar) and seven genes, the products of which are involved in binding (SusC–F) (9Reeves A. Wang G. Salyers A. J. Bacteriol. 1997; 179: 643-649Crossref PubMed Scopus (147) Google Scholar) and hydrolyzing (SusA, -B, and -G) starch (10D'Elia J. Salyers A. J. Bacteriol. 1996; 178: 7173-7179Crossref PubMed Scopus (90) Google Scholar). Genetic and biochemical analyses indicated that SusC and SusD are required for starch binding in the outer membrane of the bacterium. SusE and SusF are dispensable for starch utilization, but they contribute to stabilization of the starch-binding complex. SusA and SusG show similarity with neopullulanases, which are typical starch-hydrolyzing enzymes. Disruption of susA and susG markedly influences the growth rate of B. thetaiotaomicron (10D'Elia J. Salyers A. J. Bacteriol. 1996; 178: 7173-7179Crossref PubMed Scopus (90) Google Scholar, 11Smith K. Salyers A. J. Bacteriol. 1991; 173: 2962-2968Crossref PubMed Google Scholar). Neopullulanase is a member of the α-amylase family, glycoside hydrolase (GH) 2The abbreviations used are: GHglycoside hydrolasepNPGp-nitrophenyl α-d-glucopyranosideHPLChigh pressure liquid chromatographyMES4-morpholineethanesulfonic acidPDBProtein Data Bank 2The abbreviations used are: GHglycoside hydrolasepNPGp-nitrophenyl α-d-glucopyranosideHPLChigh pressure liquid chromatographyMES4-morpholineethanesulfonic acidPDBProtein Data Bank family 13, and both this and related enzymes have been studied extensively (12Lee H. Kim M. Cho H. Kim J. Kim T. Choi J. Park C. Oh B. Park K. J. Biol. Chem. 2002; 277: 21891-21897Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 13Park K. Kim T. Cheong T. Kim J. Oh B. Svensson B. Biochim. Biophys. Acta. 2000; 1478: 165-185Crossref PubMed Scopus (181) Google Scholar, 14Kim J. Cha S. Kim H. Kim T. Ha N. Oh S. Cho H. Cho M. Kim M. Lee H. Kim J. Choi K. Park K. Oh B. J. Biol. Chem. 1999; 274: 26279-26286Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar, 15Kamitori S. Kondo S. Okuyama K. Yokota T. Shimura Y. Tonozuka T. Sakano Y. J. Mol. Biol. 1999; 287: 907-921Crossref PubMed Scopus (110) Google Scholar, 16Hondoh H. Kuriki T. Matsuura Y. J. Mol. Biol. 2003; 326: 177-188Crossref PubMed Scopus (118) Google Scholar). These enzymes hydrolyze α-1,4- and α-1,6-glucosidic linkages, of the substrates such as amylose, pullulan, and cyclomaltodextrins, and also catalyze transglycosylation to form α-1,4- and α-1,6-glucosidic linkages.Much less is known about the biochemical characteristics of SusB, i.e. neither its three-dimensional structure nor its catalytic properties are known. SusB has been reported to function in the breakdown of oligosaccharides released by SusA and SusG into glucose units (10D'Elia J. Salyers A. J. Bacteriol. 1996; 178: 7173-7179Crossref PubMed Scopus (90) Google Scholar). Disruption of susB showed no residual α-glucoside hydrolase activity in the cell-free extract (10D'Elia J. Salyers A. J. Bacteriol. 1996; 178: 7173-7179Crossref PubMed Scopus (90) Google Scholar). The molecular mass (80 kDa) and pI (5.7) of a partially purified enzyme with α-glucoside hydrolase activity from B. thetaiotaomicron was close to the molecular mass of 84 kDa and pI of 6.0 estimated from the amino acid sequence of SusB. Therefore, SusB has been regarded as an α-glucosidase (10D'Elia J. Salyers A. J. Bacteriol. 1996; 178: 7173-7179Crossref PubMed Scopus (90) Google Scholar). However, α-glucoside hydrolases are definitively divided into two groups of enzymes, α-glucosidases (EC 3.2.1.20) and glucoamylases (EC 3.2.1.3), which have different catalytic mechanisms; α-glucosidases hydrolyze α-glucosidic linkages with a retaining mechanism, whereas glucoamylases hydrolyze these linkages with an inverting mechanism. Moreover, SusB has no significant sequence similarity to any known α-glucosidases belonging to GH4, -13, or -31, or to glucoamylases belonging to GH15 or -63. The catalytic mechanism of action of SusB is still unclear. Recently, it has been experimentally clarified that a sequence homolog of SusB from Tannerella forsythensis (Bacteroides forsythus), with 83% similarity and 71% identity, has the ability to hydrolyze 4-methylumbelliferyl α-d-glucoside (17Hughes C. Malki G. Loo C. Tanner A. Ganeshkumar N. Oral Microbiol. Immunol. 2003; 18: 309-312Crossref PubMed Scopus (34) Google Scholar). Based on this study, a new glycoside hydrolase family, GH97, was created by CAZy, and 77 sequences including SusB are now categorized as members.In this study, we clarified the enzymatic characteristics of SusB from B. thetaiotaomicron, which indicated it to be an inverting α-glucoside hydrolase. The three-dimensional structures of free and acarbose-bound SusB have also been determined at 1.6 Å resolution as a first structure of GH97 family. The structure revealed not only the catalytic mechanism but also molecular evolution of this enzyme; SusB shows considerable structural similarity with α-retaining glycosidases even though it catalyzes hydrolysis by an inverting mechanism. Furthermore, we discovered that GH97 family includes both retaining and inverting enzymes.EXPERIMENTAL PROCEDURESMaterials—B. thetaiotaomicron ATCC 29148 was obtained from American Type Culture Collection (Manassas, VA). Isomaltose, kojibiose, and nigerose were obtained from Wako Pure Chemicals Co. (Osaka, Japan). Malto-oligosaccharides were purchased from Nihon Shokuhin Kako Co. (Tokyo, Japan). p-Nitrophenyl α-glucopyranoside was obtained from Nacalai Tesque (Kyoto, Japan).Expression of SusB and Mutants—The gene encoding susB (GenBank™ accession number NC_004663) was amplified from the genomic DNA of B. thetaiotaomicron by PCR using the following oligonucleotides: 5′ forward primer 5′-ATA AAT AGA ATG AAA AAG AGA AAG ATT T-3′ and 3′ reverse primer 5′-GTT ATT TCT TTT CCT TAT TAT AAT CTT TTC-3′. PCR amplification was performed for 25 cycles using following conditions: 94 °C, 30 s; 50 °C, 30 s; 74 °C, 2 min. PCR product was used as a template for the next PCR introducing NdeI and XhoI recognition sites. PCR was performed for 25 cycles using following conditions: 98 °C, 10 s; 50 °C, 2 s; 74 °C, 2 min, using the primers listed in Table 1. The resultant DNA fragment was digested with NdeI and XhoI and ligated with pET28a (Novagen, Madison, WI), prior to digestion with NdeI and XhoI. After sequence analysis, a clone without any PCR errors was designated as psusBET28a encoding the SusB protein with His6 and linker sequence at its N terminus (MGSSHHHHHHSSGLVPRGSHM) instead of the predicted signal sequence (1MKKRKILSLIAFLCISFIANA21). The constructed expression vector psusBET28a was transformed into Escherichia coli Rosetta (DE3) (Novagen), and positive colonies were selected. The transformant was first inoculated into 30 ml of LB media containing 30 μgml-1 kanamycin and 50 μgml-1 chloramphenicol at 37 °C with shaking. This overnight culture was diluted in 300 ml of LB media containing 30 μgml-1 kanamycin and further grown at 37 °C up to an A600 of ∼0.7, and then protein production was induced with 0.2 mm isopropyl β-d-thiogalactopyranoside for 14 h at 37 °C. The induced cells were centrifuged at 10,000 × g, and the cell pellet was resuspended in buffer A (50 mm Tris-HCl, pH 8.0, 300 mm NaCl, 5 mm imidazole), including 0.2 mg/ml lysozyme, and incubated at 4 °C for 30 min, followed by sonication. The sonicated lysates were cloned and amplified by overlap extension PCR using the primers listed in Table 1.TABLE 1Primers used for cloning and mutagenesis of SusB NdeI and XhoI sites are underlined.CompoundsPrimersWild typeForward, ATTGCGCATATGCAACAGAAATTAACCTCAReverse, TTTTCCCTCGAGTTATAATCTTTTCAAE508QForward, ATGGTGAATGCACACCAAGCAACCCGCCCTACCReverse, GGTAGGGCGGGTTGCTTGGTGTGCATTCACCATE532QForward, TCCGCCCGCGGTACACAATATGAATCATTCGGAReverse, TCCGAATGATTCATATTGTGTACCGCGGGCGGAE439QForward, ATGATGATGCATCACCAAACTTCCGCTTCTGTAReverse, TACAGAAGCGGAAGTTTGGTGATGCATCATCAT Open table in a new tab Purification of SusB and Mutants—The cell-free extract was applied to 7.5 ml of a nickel-chelating Sepharose fast flow column (Amersham Biosciences), prepared in accordance with the supplier's manual, and equilibrated with buffer A. After the column was washed with buffer B (50 mm Tris-HCl, pH 8.0, 300 mm NaCl) containing 20 mm imidazole, the absorbed fractions were eluted by a linear gradient of 20–500 mm imidazole in buffer B. Next, the fraction containing the SusB protein was loaded onto a Sephadex G-25 column equilibrated with 50 mm sodium acetate, pH 6.0, and 300 mm NaCl to remove imidazole. The protein for crystallization was further purified by DEAE-Sepharose FF (Amersham Biosciences) equilibrated with 20 mm Tris-HCl, pH 8.0. All purification steps were performed at 4 °C.Enzyme Assay—The hydrolytic activity of wild type and mutants was measured in the standard reaction mixture containing 50 mm sodium acetate, pH 6.5, and 2 mm p-nitrophenyl α-d-glucopyranoside (pNPG), and enzyme was diluted in 50 mm sodium acetate, pH 6.5, containing 0.05 mg ml-1 bovine serum albumin at 37 °C. After incubation, the reaction was stopped by adding 2 volumes of 1 m sodium carbonate. The amount of p-nitrophenol released was measured by determining the absorption at 400 nm in a 1-cm cuvette, considering a molar extinction coefficient of 5,560 m-1 cm-1. One unit of enzyme activity was defined as the amount of enzyme that produced 1 μmol of reducing sugar in 1 min under these reaction conditions.The kinetic constants were calculated by fitting to the Michaelis-Menten equation by nonlinear regression using the computer program Kaleidagraph version 3.6 (Synergy Software, Reading, PA), in which initial velocities (v) were measured under 10 substrate concentrations (s) in 40 mm sodium acetate buffer, pH 6.5, at 37 °C using 2.4–12 nm enzyme. The glucose released was quantified by the glucose oxidase method.Ki values for the competitive inhibitors acarbose and Tris(2-aminoethyl)amine were determined with pNPG as the substrate using the equation v = [E]0[S]kcat/([S] + Km(1 + [I]/Ki)), where v is the initial rate of hydrolysis, [E]0 is the total enzyme concentration, and [S] and [I] are the substrate and inhibitor concentrations, respectively.The pH activity dependence was determined using sodium barbital buffer, pH 4.0–9.0, and 2 mm pNPG as the substrate. For pH stability, aliquots of 20 μl of enzyme (6 nm) were kept at 4 °C for 24 h in sodium barbital buffer, pH 2.5–9.0, or 85 mm glycine-NaOH buffer, pH 9.0–12.8. After incubation, 40 μl of 200 mm MES-NaOH buffer, pH 6.5, was added, and remaining pNPG hydrolysis activity was examined under standard conditions, except 80 mm MES-NaOH buffer was used. The effects of temperature on pNPG hydrolysis were examined under standard conditions (0.49 nm enzyme) but at 25–70 °C for 10 min. For determination of thermal stability, the enzyme (4 nm) was kept at various temperatures for 15 min in 60 mm sodium acetate buffer, pH 6.5, containing 0.02 mg/ml bovine serum albumin, and residual activity was measured in the standard assay. To examine the effects of calcium ions, the apo-form of SusB was prepared by gel filtration through a Bio-Gel P-6 column equilibrated with 100 mm EDTA, pH 6.5, and residual activity was measured under the standard conditions.Analysis of the Anomeric Form of the Product—The anomeric form of the hydrolytic product from pNPG was determined by HPLC. The enzyme reaction was performed in 5 mm sodium phosphate buffer, pH 7.0, at 25 °C with an enzyme concentration of 12.5 μm. After incubation for 1 and 20 min, aliquots (10 μl) were loaded onto a TSK-GEL amide-80 column (4.6 × 250 mm; Tosoh, Tokyo, Japan) and eluted with 80% (v/v) acetonitrile at a flow rate of 1.2 ml/min at room temperature, separating the glucose anomers. The products were detected using a light-scattering detector (ELSD model 400; SofTA, Brighton, CO). The retention times of α- and β-glucose were confirmed by loading a solution of α-glucose (Sigma) and β-glucose (Sigma) onto the column.Sequence Alignment—The amino acid sequences of GH97 members were obtained by BLAST search in sequence cluster UniRef50 using SusB as the query sequence. Among the hit sequences, the top 20 scoring sequences were aligned using ClustalW.Crystallization—Initial crystallization trials were performed by the sitting-drop vapor diffusion method in 96-well plates using a series of crystallization kits produced by Hampton Research (Laguna Niguel, CA) and Emerald BioSystems (Bainbridge Island, WA). The crystals appeared under condition number 34 of Wizard II (100 mm imidazole, pH 8.0, 10% (w/v) polyethylene glycol 8000). After optimization of the crystallization conditions (pH, precipitant content and concentration, and protein concentration) using the hanging-drop vapor diffusion method in 24-well plates, well ordered crystals were obtained with 100 mm imidazole, pH 7.6–8.0 and 6–12% (v/v), polyethylene glycol 6000, or 2–8% (v/v) polyethylene glycol 20,000 and enzyme concentrations of 10 mg/ml. These triangle-shaped crystals appeared in 1 day and reached maximum size (0.2 × 0.2 × 0.05 mm) in 4 weeks at room temperature. The crystal of SusB in complex with acarbose (SusB-acarbose complex) was obtained by soaking a crystal in reservoir solution containing 10 mm acarbose for 24 h.Data Collection and Processing—A SAD data set was collected to 2.2 Å resolution on an R-AXIS VII imaging-plate detector using an in-house CrKα (2.29 Å) source (Rigaku FR-E SuperBright with a Cu/Cr dual target). The crystal was transferred to reservoir solution supplemented with 35% (v/v) glycerol as a cryoprotectant, and then mounted using a loop- and buffer-less mount method (18Kitago Y. Watanabe N. Tanaka I. Acta Crystallogr. Sect. D Biol. Crystallogr. 2005; 61: 1013-1021Crossref PubMed Scopus (48) Google Scholar) and flash-cooled under a stream of nitrogen gas at 100 K.Although the high resolution data set (1.6 Å) was collected at beam line AR-NW12 of the Photon Factory (Tsukuba, Japan), the SusB-acarbose complex data were measured on an R-AXIS IV imaging plate diffractometer using in-house CuKα (1.54 Å) source (Rigaku MicroMax 007). For data collection, the native and complex crystals were soaked in reservoir solution supplemented with 30% (v/v) glycerol and 25% (v/v) 2-methyl-2,4-pentanediol, respectively. Subsequently the crystals were mounted in CryoLoop and flash-cooled under a stream of nitrogen gas at 100 K. All data sets were indexed, integrated, scaled, and merged using the HKL2000 program package (19Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref Scopus (38361) Google Scholar). The crystals of SusB belong to the space group P21 with unit cell parameters a = 75.6 Å, b = 112.3 Å, c = 102.5 Å, and β = 100.7° (native data). The Vm value was estimated to be 2.54 Å3/Da with two molecules in an asymmetric unit, which corresponded to a solvent content of 51.5% (20Matthews B.W. J. Mol. Biol. 1968; 33: 491-497Crossref PubMed Scopus (7899) Google Scholar). The statistics of data collection are summarized in Table 2.TABLE 2Statistics of data collection Values in parentheses refer to the highest resolution shell.DataNativeSADSusB-acarbose complexBeam line/diffractometerAR NW12, PFFR-EaFR-E and MicroMax 007 are in-house diffractometers (Rigaku)MicroMax 007aFR-E and MicroMax 007 are in-house diffractometers (Rigaku)Wavelength)1.0033 Å2.2909 Å (CrKα)1.5418 Å (CuKα)Space groupP21Unit cella = 75.6 Å, b = 112.3 Å, c = 102.6 Åa = 75.7 Å, b = 112.4 Å, c = 102.5 Åa = 75.7 Å, b = 112.3 Å, c = 102.5 Åβ = 100.7°β = 100.6°β = 100.6°Resolution50.0-1.60 Å (1.66-1.60 Å)50.0-2.20 Å (2.28-2.20 Å)50.0-1.60 Å (1.66-1.60 Å)No. of reflections220,59785,123217,504Completeness99.7% (97.5%)99.5% (98.5%)98.2% (95.8%)Average redundancy5.5 (4.4)17.4 (15.5)7.4 (7.2)I/σ (I)19.8 (3.0)33.7 (10.8)49.9 (7.9)RsymbRsym = ΣhΣj|〈I〉h – Ih,j|/ΣhΣjIh,j, where 〈I〉h is the mean intensity of symmetry equivalent reflection h6.8% (41.7%)6.8% (19.0%)4.6% (32.8%)a FR-E and MicroMax 007 are in-house diffractometers (Rigaku)b Rsym = ΣhΣj|〈I〉h – Ih,j|/ΣhΣjIh,j, where 〈I〉h is the mean intensity of symmetry equivalent reflection h Open table in a new tab Structure Solution and Refinement—The structure was solved by the SAD method using the anomalous signal of sulfur atoms that exist in natural SusB. The positions of anomalous scatterer atoms were located with the SnB program (21Weeks C.M. Miller R. J. Appl. Crystallogr. 1999; 32: 120-124Crossref Scopus (384) Google Scholar) using the in-house CrKα (2.29 Å) data set. Initial phases were calculated and improved with the SOLVE/RESOLVE program (22Terwilliger T.C. Acta Crystallogr. Sect. D Biol. Crystallogr. 1994; 50: 17-23Crossref PubMed Google Scholar) at 2.2 Å resolution, and then extended to 1.6 Å resolution using the native data set during density modification with the DM program (23Cowtan K.D. Main P. Acta Crystallogr. Sect. D Biol. Crystallogr. 1996; 52: 43-48Crossref PubMed Scopus (288) Google Scholar). The initial model was built automatically to 90% using the ARP/wARP program (24Morris R.J. Perrakis A. Lamzin V.S. Methods Enzymol. 2003; 374: 229-244Crossref PubMed Scopus (471) Google Scholar). Then the structure was refined automatically using the LAFIRE program (25Yao M. Zhou Y. Tanaka I. Acta Crystallogr. Sect. D Biol. Crystallogr. 2006; 62: 189-196Crossref PubMed Scopus (74) Google Scholar) running with the refinement program CNS (26Brünger A.T. Adams P.D. Clore G.M. Delano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.-S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. Sect. D Biol. Crystallogr. 1999; 54: 905-921Crossref Scopus (16929) Google Scholar) to a final R-factor of 17.6% and Rfree factor of 19.3%. The structure of SusB-acarbose complex was determined by rigid-body refinement with CNS using the structure of native SusB as the initial model. The model of acarbose in the complex was built based on Fo - Fc difference Fourier map. The final structure of SusB-acarbose complex was obtained by automatic refinement using LAFIRE with CNS. The refinement statistics are given in Table 3.TABLE 3Statistics of structure refinementSusBSusB-acarbose complexResolution range15 to 1.6 Å20 to 1.6 ÅNo. of used reflections220,497217,407Completeness99.8%98.3%R-factoraR-factor = Σ|Fobs – Fcal|/ΣFobs, where Fobs and Fcal are observed and calculated structure factor amplitudes, respectively17.6%17.1%Rfree factorbRfree-factor value was calculated for R-factor, using a subset (10%) of reflections that were not used for refinement19.3%18.6%Total no. of non-hydrogen atomsProtein11,566 (5,783 × 2 molecules)11,339 (5666, 5673)Water1,4221,523Others2 (1 × 2 molecules)90 (45 × 2 molecules)Averaged B factors (Å2)Protein19.017.4Water24.324.8Others9.814.1Ramachandran plotcRamachandran plot was calculated using PROCHECK (27)Most favored regions86.85%85.9%In addition, allowed regions13.07%13.9%Generously allowed regions0.080.2a R-factor = Σ|Fobs – Fcal|/ΣFobs, where Fobs and Fcal are observed and calculated structure factor amplitudes, respectivelyb Rfree-factor value was calculated for R-factor, using a subset (10%) of reflections that were not used for refinementc Ramachandran plot was calculated using PROCHECK (27Laskowski R.A. Mac Arthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar) Open table in a new tab RESULTS AND DISCUSSIONBiochemical Characteristics of Recombinant SusB—The recombinant SusB was produced in E. coli and purified by His affinity chromatography. The purified enzyme was migrated as a single band, the Mr of which was estimated to be 83,000 on SDS-PAGE. The Mr of 84,380 calculated from the deduced amino acid sequence was consistent with that of 83,000 seen on SDS-PAGE.The effects of pH and temperature on the hydrolytic activities toward pNPG were examined. The pH optimum was 6.5, and the enzyme was stable between pH 4.0 and 12.0 at 4 °C for 24 h. The enzyme was stable at temperatures up to 45 °C for 15 min of heat treatment, and maximum hydrolysis rate was obtained at 45 °C. As described below, the crystal structure of SusB included a calcium ion at the active center. The dependence of the enzyme activity on the calcium ion was examined. The reaction rate was reduced from 80 to 3.8 μmol/min/mg (4.8%) for the apoenzyme compared with calcium-bound enzyme.Inhibition constants, Ki, for acarbose and Tris were measured using pNPG as the substrate. Inhibition was strictly competitive in both compounds, and Ki values were 0.15 ± 0.03 and 37.5E3 ± 1.1E3 μm for acarbose and Tris, respectively. Strong inhibition by acarbose indicated that the reaction pathway of SusB involves an oxocarbenium ion-like transition state similar to standard glycoside hydrolases as acarbose, which possesses the valienamine unit at the nonreducing terminal end, is widely believed to be an oxocarbenium ion-like transition state analog. The kinetic parameters for various substrates with α-glucosidic linkage were investigated. Michaelis constant (Km) and the molecular activity (kcat) are summarized in Table 4. SusB had a wide specificity on various types of α-glucosidic linkage of not only α-1,4- but also α-1,2-, α-1,3-, and α-1,6-linkage in glucobioses. pNPG is the best substrate with a kcat/Km value 6-fold greater than that of maltose. Among the malto-oligosaccharides with various degrees of polymerization (DP), maltotriose was the best substrate. The kcat/Km value for panose (α-d-glucopyranosyl-(1→6)-α-d-glucopyranosyl-(1→4)-d-glucopyranose) was also high even though the value for isomaltose was low, suggesting that SusB shows higher specificity on trisaccharides. The activity was low on longer malto-oligosaccharides (DP ≥ 5). The role of SusB is to hydrolyze disaccharides and trisaccharides produced by neopullulanase, encoded on susA, into glucose units (10D'Elia J. Salyers A. J. Bacteriol. 1996; 178: 7173-7179Crossref PubMed Scopus (90) Google Scholar), and thus the preference for trisaccharides agrees with the role of SusB in vivo. The Km value for soluble starch was almost the same as that for maltotetraose, whereas the Km value for amylase DP17 was higher, suggesting that SusB should prefer amylopectin to amylose. The relationship between substrate specificity and structure of the active site is discussed below.TABLE 4Kinetic constants for hydrolysis of various substrates by SusBComponentsKmkcatkcat/Kmmms–1s–1 mm–1Maltose1.05 ± 0.12182 ± 0.58172Maltotriose0.29 ± 0.01270 ± 5.5943Maltotetraose0.64 ± 0.07321 ± 15504Maltopentaose1.29 ± 0.07434 ± 4.9337Maltohexaose2.71 ± 0.51346 ± 36.5128Maltoheptaose4.58 ± 0.52381 ± 13.583.3Amylose DP176.89 ± 0.45321 ± 9.7146.6Soluble starch0.67 ± 0.06115 ± 2.08172Kojibiose (α-1,2)2.39 ± 0.21141 ± 7.658.9Nigerose (α-1,3)3.14 ± 0.16207 ± 7.666.1Isomaltose (α-1,6)6.34 ± 0.35105 ± 4.616.6Panose (α-1,6→α-1,4)0.31 ± 0.03160 ± 6.5513p-Nitrophenyl α-glucoside0.16 ± 0.01161 ± 4.51,023 Open table in a new tab Anomeric Configuration of Product—SusB hydrolyzes the α-glucosidic linkage in the nonreducing terminal end of the substrate. Such exo-type hydrolases can be divided into two enzymes, glucoamylase (EC 3.2.1.3, 1,4-α-d-glucan glucohydrolase) and α-glucosidase (EC 3.2.1.20, α-d-glucoside glucohydrolase), by anomeric configuration of product, α-glucose or β-glucose. α-Glucosidase produces α-glucose by a retaining mechanism, whereas glucoamylase produces β-glucose by an inverting mechanism. The anomeric composition of the degradation products of pNPG by SusB was examined by HPLC. As shown in Fig. 1, the enzyme produced β-anomer of glucose in the reaction for 1 min, and α-glucose was detected with increasing reaction time. The α-glucose formation could be explained to occur through spontaneous mutarotation of the hydrolytic product, β-glucose. This result strongly suggests that SusB hydrolyzes the nonreducing terminal side of the α-glucosidic linkage of the substrate with an inverting mechanism, i.e. SusB is not an α-glucosidase but a glucoamylase.Overall Structure—The crystal structure of SusB was solved by the SAD method at 2.2 Å resolution. Fifty eight of 116 sulfur atoms
Referência(s)