Structural and Functional Characterization of Falcipain-2, a Hemoglobinase from the Malarial Parasite Plasmodium falciparum
2006; Elsevier BV; Volume: 281; Issue: 35 Linguagem: Inglês
10.1074/jbc.m603776200
ISSN1083-351X
AutoresTanis Hogg, Krishna Nagarajan, Saskia Herzberg, Lili Chen, Xu Shen, Hualiang Jiang, Maria Wecke, Christoph J. Blohmke, Rolf Hilgenfeld, C. L. Schmidt,
Tópico(s)Hemoglobinopathies and Related Disorders
ResumoMalaria is caused by protozoan erythrocytic parasites of the Plasmodium genus, with Plasmodium falciparum being the most dangerous and widespread disease-causing species. Falcipain-2 (FP-2) of P. falciparum is a papain-family (C1A) cysteine protease that plays an important role in the parasite life cycle by degrading erythrocyte proteins, most notably hemoglobin. Inhibition of FP-2 and its paralogues prevents parasite maturation, suggesting these proteins may be valuable targets for the design of novel antimalarial drugs, but lack of structural knowledge has impeded progress toward the rational discovery of potent, selective, and efficacious inhibitors. As a first step toward this goal, we present here the crystal structure of mature FP-2 at 3.1 Å resolution, revealing novel structural features of the FP-2 subfamily proteases including a dynamic β-hairpin hemoglobin binding motif, a flexible N-terminal α-helical extension, and a unique active-site cleft. We also demonstrate by biochemical methods that mature FP-2 can proteolytically process its own precursor in trans at neutral to weakly alkaline pH, that the binding of hemoglobin to FP-2 is strictly pH-dependent, and that FP-2 preferentially binds methemoglobin over hemoglobin. Because the specificity and proteolytic activity of FP-2 toward its multiple targets appears to be pH-dependent, we suggest that environmental pH may play an important role in orchestrating FP-2 function over the different life stages of the parasite. Moreover, it appears that selectivity of FP-2 for methemoglobin may represent an evolutionary adaptation to oxidative stress conditions within the host cell. Malaria is caused by protozoan erythrocytic parasites of the Plasmodium genus, with Plasmodium falciparum being the most dangerous and widespread disease-causing species. Falcipain-2 (FP-2) of P. falciparum is a papain-family (C1A) cysteine protease that plays an important role in the parasite life cycle by degrading erythrocyte proteins, most notably hemoglobin. Inhibition of FP-2 and its paralogues prevents parasite maturation, suggesting these proteins may be valuable targets for the design of novel antimalarial drugs, but lack of structural knowledge has impeded progress toward the rational discovery of potent, selective, and efficacious inhibitors. As a first step toward this goal, we present here the crystal structure of mature FP-2 at 3.1 Å resolution, revealing novel structural features of the FP-2 subfamily proteases including a dynamic β-hairpin hemoglobin binding motif, a flexible N-terminal α-helical extension, and a unique active-site cleft. We also demonstrate by biochemical methods that mature FP-2 can proteolytically process its own precursor in trans at neutral to weakly alkaline pH, that the binding of hemoglobin to FP-2 is strictly pH-dependent, and that FP-2 preferentially binds methemoglobin over hemoglobin. Because the specificity and proteolytic activity of FP-2 toward its multiple targets appears to be pH-dependent, we suggest that environmental pH may play an important role in orchestrating FP-2 function over the different life stages of the parasite. Moreover, it appears that selectivity of FP-2 for methemoglobin may represent an evolutionary adaptation to oxidative stress conditions within the host cell. At the end of 2004, about 3.2 billion people in the world were estimated to be at risk of contracting malaria (1WHO World Malaria Report. WHO, Geneva2005Google Scholar). The estimated worldwide number of annual clinical malaria episodes is 350–500 million, mostly caused by the erythrocytic parasites Plasmodium falciparum and Plasmodium vivax, and the global annual death toll of the disease exceeds one million people (1WHO World Malaria Report. WHO, Geneva2005Google Scholar). Efforts to reduce these numbers are being complicated by the rapid development of resistance by Plasmodium species against the currently available antimalarial drugs. Depending on the geographical region, up to 85% of clinical malaria cases cannot be cured by chloroquine, which was the standard drug only a few decades ago. Furthermore, more than 50% of the Plasmodium infections in sub-Saharan Africa and in some regions of Asia are insensitive to sulfametoxine-pyrimethamine treatment, which otherwise shows a good efficacy against chloroquine-resistant P. falciparum strains. Of the malaria cases observed in Asia (Myanmar, Thailand, and Cambodia), 10–15% do not respond to treatment with mefloquine, which emerged as a successor to chloroquine in the 1980s. Resistance of P. falciparum to primaquine has also been reported (2Baird J.K. Wiady I. Sutanihardja A. Suradi Purnomo Basri H. Sekartuti Ayomi E. Fryauff D.J. Hoffman S.L. Am. J. Trop. Med. Hyg. 2002; 66: 659-660Crossref PubMed Scopus (26) Google Scholar), and widespread resistance of P. vivax against standard primaquine therapy is suspected (3Baird J.K. Hoffman S.L. Clin. Infect. Dis. 2004; 39: 1336-1345Crossref PubMed Scopus (355) Google Scholar). Even though quinine is the oldest anti-malarial drug, it still shows relatively high efficacies in Asia and South America, i.e. 95 and 67%, respectively. However, severe side effects like hemolytic anemia, coma, and respiratory arrest unfortunately limit the wider application of this compound (4Baird J.K. N. Engl. J. Med. 2005; 352: 1565-1577Crossref PubMed Scopus (288) Google Scholar). The only currently available antimalarial drugs without known resistance are artemisinin (from Artemisia annua) and its hemisynthetic derivatives (4Baird J.K. N. Engl. J. Med. 2005; 352: 1565-1577Crossref PubMed Scopus (288) Google Scholar). Recently, however, the occurrence of mutations that could lead to artemisinin resistance has been reported (5Jambou R. Legrand E. Niang M. Khim N. Lim P. Volney B. Ekala M.T. Bouchier C. Esterre P. Fandeur T. Mercereau-Puijalon O. Lancet. 2005; 366: 1960-1963Abstract Full Text Full Text PDF PubMed Scopus (425) Google Scholar). Consequently, the WHO has called for a halt of artemisinin mono-therapies to curtail the emergence of resistance against this compound (WHO News Release 19-01-2006). Given the inexorable speed of the development of drug resistance and lack of an efficient vaccine, the search for effective, safe, and affordable drugs for malaria treatment is one of the most pressing health priorities worldwide (6Robert A. Benoit-Vical F. Dechy-Cabaret O. Meunier B. Pure Appl. Chem. 2001; 73: 1173-1188Crossref Scopus (80) Google Scholar). Plasmodium infections are exclusively transmitted by anopheline mosquito bites. The sexual stage of the parasite life cycle is restricted to the insect host, whereas asexual reproduction and gametocyte development take place in the human host, where the parasite infects and multiplies within hepatocytes and erythrocytes. The primary infection of liver cells is not associated with the typical symptoms of malaria, yet the liver stages (schizonts and hypnozoites) are of particular importance since they are insensitive to many drugs (4Baird J.K. N. Engl. J. Med. 2005; 352: 1565-1577Crossref PubMed Scopus (288) Google Scholar) and are responsible for the well known relapses of plasmodial infections. Gametocyte reproduction and development occur within erythrocytes, and the massive, systemic rupture of infected red blood cells at the end of this phase causes the clinical symptoms of malaria. During intraerythrocytic replication, the parasites utilize cytosolic proteins of the host cell as a food source. To digest hemoglobin and other cytosolic proteins, Plasmodia have developed a specialized acidic (pH 5–6) organelle, termed the food vacuole, which contains a set of specific proteases. These include several aspartic proteases called plasmepsins (7Kesavulu M.M. Prakasha Gowda A.S. Ramya T.N. Surolia N. Suguna K. J. Pept. Res. 2005; 66: 211-219Crossref PubMed Scopus (8) Google Scholar, 8Silva A.M. Lee A.Y. Gulnik S.V. Majer P. Collins J. Bhat T.N. Collins P.J. Cachau R.E. Luker K.E. Gluzman I.Y. Francis S.E. Oksman A. Goldberg D.E. Erickson J.W. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10034-10039Crossref PubMed Scopus (274) Google Scholar), which perform the initial cleavage of hemoglobin. The cysteine proteases falcipain-2 and falcipain-3 (9Rosenthal P.J. Kim K. McKerrow J.H. Leech J.H. J. Exp. Med. 1987; 166: 816-821Crossref PubMed Scopus (77) Google Scholar, 10Rosenthal P.J. McKerrow J.H. Aikawa M. Nagasawa H. Leech J.H. J. Clin. Investig. 1988; 82: 1560-1566Crossref PubMed Scopus (312) Google Scholar, 11Sijwali P.S. Brinen L.S. Rosenthal P.J. Protein Expression Purif. 2001; 22: 128-134Crossref PubMed Scopus (99) Google Scholar, 12Sijwali P.S. Shenai B.R. Gut J. Singh A. Rosenthal P.J. Biochem. J. 2001; 360: 481-489Crossref PubMed Scopus (198) Google Scholar) as well as the very recently discovered falcipain-2B (13Goh L.L. Sim T.S. Biochem. Biophys. Res. Commun. 2005; 335: 762-770Crossref PubMed Scopus (12) Google Scholar) (which appears to be identical to falcipain-2′ (14Singh N. Sijwali P.S. Pandey K.C. Rosenthal P.J. Exp. Parasitol. 2006; 112: 187-192Crossref PubMed Scopus (60) Google Scholar)), further degrade the plasmepsin cleavage products. The short peptides produced by the falcipains are finally degraded by the metalloprotease falcilysin (15Murata C.E. Goldberg D.E. J. Biol. Chem. 2003; 278: 38022-38028Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 16Murata C.E. Goldberg D.E. Mol. Biochem. Parasitol. 2003; 129: 123-126Crossref PubMed Scopus (21) Google Scholar). During the late trophozoite and schizont stages, falcipain-2 is also involved in the degradation of erythrocyte-membrane skeletal proteins including ankyrin and the band 4.1 protein (17Hanspal M. Dua M. Takakuwa Y. Chishti A.H. Mizuno A. Blood. 2002; 100: 1048-1054Crossref PubMed Scopus (107) Google Scholar). This activity displays a pH optimum in the range of 7.0–7.5 and is thought to contribute to destabilization of the erythrocyte membrane, leading to host cell rupture and release of the mature merozoites. The autoproteolytic processing of its own precursor at neutral pH has been suggested as a third function of falcipain-2 (18Shenai B.R. Sijwali P.S. Singh A. Rosenthal P.J. J. Biol. Chem. 2000; 275: 29000-29010Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 19Dahl E.L. Rosenthal P.J. Mol. Biochem. Parasitol. 2005; 139: 205-212Crossref PubMed Scopus (71) Google Scholar). Falcipain-2 is synthesized during the trophozoite stage as a membrane-bound proenzyme comprising 484 amino acid residues (18Shenai B.R. Sijwali P.S. Singh A. Rosenthal P.J. J. Biol. Chem. 2000; 275: 29000-29010Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 20Pandey K.C. Sijwali P.S. Singh A. Na B.K. Rosenthal P.J. J. Biol. Chem. 2004; 279: 3484-3491Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). The proenzyme is transported to the food vacuole through the endoplasmic reticulum/Golgi system, and during this process the N-terminal 243 residues containing the membrane anchor are proteolytically removed. An autoproteolytic processing mechanism was suggested on the basis of inhibitor studies (19Dahl E.L. Rosenthal P.J. Mol. Biochem. Parasitol. 2005; 139: 205-212Crossref PubMed Scopus (71) Google Scholar) and from the observation that the recombinant proenzyme undergoes spontaneous processing during in vitro refolding (18Shenai B.R. Sijwali P.S. Singh A. Rosenthal P.J. J. Biol. Chem. 2000; 275: 29000-29010Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 21Sijwali P.S. Shenai B.R. Rosenthal P.J. J. Biol. Chem. 2002; 277: 14910-14915Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). It remains unclear how falcipain-2 can perform the diverse activities of self-processing, hemoglobin degradation, and cytoskeletal degradation at different pH optima during the various stages of parasite development. Disruption of the falcipain-2 gene results in reduced hemoglobin degradation in the trophozoite stage and accumulation of undegraded hemoglobin within the parasite food vacuole but seems to be compensated for by overexpression of falcipain-2B and falcipain-3 in later stages of the Plasmodium life cycle (22Sijwali P.S. Rosenthal P.J. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 4384-4389Crossref PubMed Scopus (254) Google Scholar). This suggests an overlapping function and the need for an effective inhibitor that simultaneously inhibits the falcipains. In contrast to falcipain-2, -2B, and -3, falcipain-1 does not digest hemoglobin but plays a role in host cell invasion (23Greenbaum D.C. Baruch A. Grainger M. Bozdech Z. Medzihradszky K.F. Engel J. DeRisi J. Holder A.A. Bogyo M. Science. 2002; 298: 2002-2006Crossref PubMed Scopus (263) Google Scholar) and may also be involved in oocyst production within the anopheles mosquito vector (24Eksi S. Czesny B. Greenbaum B.D. Bogyo M. Williamson K.C. Mol. Microbiol. 2004; 53: 243-250Crossref PubMed Scopus (79) Google Scholar). Based on their primary structures, the falcipains have been classified as members of the papain family of cysteine proteases (C1A) (12Sijwali P.S. Shenai B.R. Gut J. Singh A. Rosenthal P.J. Biochem. J. 2001; 360: 481-489Crossref PubMed Scopus (198) Google Scholar, 18Shenai B.R. Sijwali P.S. Singh A. Rosenthal P.J. J. Biol. Chem. 2000; 275: 29000-29010Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 25Pandey K.C. Wang S.X. Sijwali P.S. Lau A.L. McKerrow J.H. Rosenthal P.J. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9138-9143Crossref PubMed Scopus (119) Google Scholar). Previous studies have demonstrated that inhibition of the plasmodial aspartic or cysteine proteases (26Rosenthal P.J. Wollish W.S. Palmer J.T. Rasnick D. J. Clin. Investig. 1991; 88: 1467-1472Crossref PubMed Scopus (181) Google Scholar, 27Gelhaus C. Vicik R. Hilgenfeld R. Schmidt C.L. Leippe M. Schirmeister T. Biol. Chem. 2004; 385: 435-438Crossref PubMed Scopus (28) Google Scholar) inhibits the development of the parasites in vitro and can cure parasitic infection in a mouse model (28Semenov A. Olsen J.E. Rosenthal P.J. Antimicrob. Agents Chemother. 1998; 42: 2254-2258Crossref PubMed Google Scholar). Moreover, the recent discovery of an essential ∼14-residue hemoglobin binding motif near the C terminus of falcipain-2 and related plasmodial cysteine proteases (25Pandey K.C. Wang S.X. Sijwali P.S. Lau A.L. McKerrow J.H. Rosenthal P.J. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9138-9143Crossref PubMed Scopus (119) Google Scholar) points toward the possibility of designing peptidomimetic drugs that block falcipain activity by disrupting critical protein-protein interactions with its hemoglobin target. Hence, the falcipain-2 subfamily of plasmodial proteases is among the prime targets for discovery of novel anti-malarial drugs. Toward this goal, here we present the x-ray structure of falcipain-2, crystallized in the presence of the irreversible cysteine-protease inhibitor iodoacetamide, at 3.1 Å of resolution. The structure reveals unique features of the falcipain-2 subfamily proteases. The four copies of the enzyme in the crystallographic asymmetric unit provide individual snapshots of the dynamic and adaptable hemoglobin binding motif and the flexible N-terminal helical extension. A comparative structural analysis of the falcipain-2 active site with that of cruzain (cruzipain) from Trypanosoma cruzi suggests that existing vinyl sulfone inhibitors designed against cruzipain may be useful starting compounds for further chemical elaboration and rational design of novel antimalarials. We also demonstrate that mature, recombinant falcipain-2 can proteolytically process its own precursor in trans at a neutral to weakly alkaline pH and that the binding of hemoglobin to falcipain-2 is dependent on the pH of the medium and the oxidation state of the heme iron. Based on our results, we propose that methemoglobin is the preferred substrate for falcipain-2 within the acidic food vacuole and that the pH-modulated activity of falcipain-2 toward its various substrates may help to orchestrate critical events in the life cycle of the parasite. Construction of Inactive Falcipain-2 Mutants—A pQE-30 plasmid (Qiagen) containing the DNA sequence coding for residues 211–484 of the falcipain-2 precursor with an N-terminal His tag (MRGSHHHHHHGSG) was kindly provided by Prof. T. Schirmeister (Würzburg). The expression plasmid for an inactive mutant form of the truncated falcipain-2 precursor containing an alanine residue instead of the active-site cysteine (pFPc285a) was constructed by PCR mutagenesis. The primers FPsen (TGGGCCTTTAGTAGTATAGGTTC) and FPantiA (GGCAGATCCACAATTTTTTTGATCCTTT) were used to amplify the entire plasmid, and the PCR product was purified by chloroform extraction and desalting with a Montage™ PCR filter device (Millipore). The plasmid was ligated using the Perfectly Blunt® Kit (Novagen) and transformed into NovaBlue competent cells (Novagen). Individual clones were selected, and pFPc285a was isolated and verified by DNA sequencing (MWG Biotech) followed by transformation into M15 (pRep4) competent cells (Qiagen) and test expression in 10-ml cultures. A plasmid for the expression of mature, inactive falcipain-2 was constructed by amplifying the DNA sequence encoding amino acid residues 245–484 from pFPc285a using the primers PmutA (ATGAATTATGAAGAAGTTATAAAAAAATATAGA) and PmutAanti (ATTAGCTTATTCAATTAATGGAATGAA). The PCR product was purified, ligated into pETBlue-1 (Novagen), and transformed into Nova Blue competent cells as described above. Plasmids isolated from individual clones that contained the insert in the correct orientation as indicated by restriction mapping, termed pFPc285aM, were verified by DNA sequencing, transformed into RosettaBlue™ (DE3) cells (Novagen), and tested for expression in small cultures (10 ml). Large Scale Expression, Purification, and Refolding of Wild-type and Mutant Falcipain-2—Bacteria containing pFPc285a or pFPc285aM were grown in 2–6-liter batches at 37 °C on YT or Luria-Bertani (LB) medium containing 100 μg/ml carbenicillin (plus 25 μg/ml kanamycin in the case of the M15 (pRep4)-derived strains). Recombinant gene expression was induced by the addition of 0.5 mm isopropyl 1-thio-β-d-galactopyranoside to the liquid cultures at an optical density of 0.6–0.7 (measured at 546 nm). The cultures were incubated for another 3 h at 37 °C and harvested by centrifugation. The cells were washed with 1/10th of the culture volume of cold 50 mm Tris-HCl (pH 7.5), 1 mm EDTA, resuspended in 1/100th of the culture volume of the same buffer, and either stored at –20 °C or immediately broken by sonication. Recovery of recombinant wild-type falcipain-2 and the inactive mutants, which were all produced as inclusion bodies, was achieved by collection of the insoluble cell lysate fraction after centrifugation for 20 min at 20,000 × g. Inclusion bodies of the His-tagged falcipain-2 mutants were washed and dissolved, and the recombinant protein was purified by nickel nitrilotriacetic acid chromatography essentially as described by Sijwali et al. (11Sijwali P.S. Brinen L.S. Rosenthal P.J. Protein Expression Purif. 2001; 22: 128-134Crossref PubMed Scopus (99) Google Scholar). Purified protein was refolded as described (11Sijwali P.S. Brinen L.S. Rosenthal P.J. Protein Expression Purif. 2001; 22: 128-134Crossref PubMed Scopus (99) Google Scholar) with only minor modifications; protein concentration in the nickel nitrilotriacetic acid elution fractions was estimated using a theoretical extinction coefficient of 44,640 m–1·cm–1 at 279 nm (29Gasteiger E. Hoogland C. Gattiker A. Duvaud S. Wilkins M.R. Appel R.D. Bairoch A. Walker J.M. The Proteomics Protocols Handbook. Humana Press, Inc., Totowa, NJ2005: 571-607Crossref Google Scholar), and the ratio of protein solution to refolding buffer was reduced to 1:50. The refolded protein was desalted on a HighTrap™ column (Amersham Biosciences) equilibrated with 20 mm Tris/HCl (pH 7.5), and eluted in the same buffer. The desalted protein was further purified on a Poros 20HQ 4.6/10 anion exchange column (PerSeptive Biosystems) equilibrated with 20 mm Tris/HCl, pH 7.5, and eluted with a gradient of 0–500 mm NaCl. For the purification of the wild-type protein, 10 mm iodoacetamide was included in the desalting and ion-exchange buffers. Expression of mature, inactive falcipain-2 (FPc285aM) was the same as described above; however, since this protein could not be purified by metal affinity chromatography, the inclusion bodies were more intensely washed; twice with buffer A (2 m urea, 2.5% (w/v) Triton X-100, 20 mm Tris/HCl (pH 8.0)) and twice with buffer B (20% (w/v) sucrose, 20 mm Tris/HCl (pH 8.0)). After each centrifugation step, the inclusion bodies were resuspended by sonication. Inclusion bodies from a 6-liter culture were resuspended in 5 ml of buffer B plus 10 mm MgCl2 and 125 units of benzonase (Merck). The suspension was stirred overnight at 4 °C followed by the addition of 25 ml of buffer B, centrifugation, and solubilization in 17 ml of denaturing buffer (8 m urea, 1 m imidazole, 20 mm Tris/HCl (pH 8.0)). Protein concentration was measured using a theoretical extinction coefficient of 40,605 m–1·cm–1 at 279 nm (29Gasteiger E. Hoogland C. Gattiker A. Duvaud S. Wilkins M.R. Appel R.D. Bairoch A. Walker J.M. The Proteomics Protocols Handbook. Humana Press, Inc., Totowa, NJ2005: 571-607Crossref Google Scholar). This solution was either stored at –20 °C or directly subjected to refolding and ion-exchange purification. General Activity Assay—The chromogenic substrate Z-Phe-Arg-pNA 3The abbreviations used are: Z-Phe-Arg-pNA, benzoyl-Phe-Arg-p-nitroanilide; NCS, non-crystallographic symmetry; r.m.s.d., root mean square deviation; Bis-Tris-propane, 1,3-bis[tris(hydroxymethyl)methylamino]propane; AMC, 7-amino-4-methylcoumarin. (Bachem AG) was used for routine activity assays. The assay mixture contained protein sample in 50 μm Z-Phe-Arg-pNA, 10 mm dithiothreitol, and 100 mm sodium acetate (pH 5.5) in a final volume of 700 μl. The absorbance at 405 nm was measured against a blank consisting of protein-free assay mixture. The activity was calculated using an extinction coefficient of 10,500 m–1·cm–1. The pH dependence of the reaction was tested using BisTris-propane/HCl buffer in place of sodium acetate. Hemoglobinase Assay—Hemoglobin-degrading activity was assayed by incubating human hemoglobin (Sigma, H7379) with varying concentrations of recombinant falcipain-2. Falcipain-2 was added to a mixture consisting of 0.2 mg/ml hemoglobin, 100 mm sodium acetate (pH 5.5), and 10 mm dithiothreitol. The assay mixture was incubated for 10–120 min at 37 °C, and 20 μl aliquots were extracted at fixed time points, mixed immediately with 10 μl of denaturing SDS-PAGE loading buffer, heated for 5 min at 95 °C, and analyzed by SDS-PAGE. To test the pH dependence of hemoglobin degradation, the sodium acetate buffer was replaced by 100 mm BisTris-propane/HCl at the indicated pH. Self-processing Assay—The same procedure as described for the hemoglobinase assay was used to study the processing of inactive, truncated falcipain-2 precursor (FPc285a) by active, refolded falcipain-2. The assay mixture contained 0.2 mg/ml refolded FPc285a instead of hemoglobin. Binding Studies—The binding of hemoglobin to mature, inactive falcipain-2 was studied by surface plasmon resonance using a Biacore® 3000 system at room temperature. Inactive falcipain-2 was immobilized to the carboxymethylated dextran matrix of a CM5 research-grade sensor chip (Biacore) by the standard primary-amine coupling reaction in HBS-EP buffer (10 mm HEPES/NaOH, pH 7.5, 150 mm NaCl, 3 mm EDTA). The flow cell was activated for 7 min with a 1:1 mixture of 0.2 m N-hydroxysuccinimide and 50 mm N-ethyl-N′-(3-diethylaminopropyl)-carbodiimide) at a flow rate of 5 μl/min at 25 °C. Inactive, mature falcipain-2 (FPc285aM) at a concentration of 0.066 mg/ml in 10 mm sodium acetate (pH 3.9) was injected for 7 min at 5 μl/min, yielding a final immobilization level of 600 response units. The surface of the flow cell was subsequently blocked with a 7-min injection of 1 m ethanolamine (pH 8.5). Finally, 50 mm NaOH was injected for 10 s to remove any non-covalently bound protein. The control flow cell was activated and immediately blocked without immobilizing any protein to prevent nonspecific binding of the analyte to the sensor surface of the reference cell. Equilibration of the base line was carried out by a continuous flow of HBS-EP buffer (pH 6.0) through the chip for at least 3 h. Human hemoglobin (methemoglobin (Sigma H7379) or ferrous stabilized hemoglobin (Sigma H0267)) in 20 mm Na2HPO4/NaH2PO4, 150 mm NaCl, 3 mm EDTA buffer of the indicated pH was injected at a flow rate of 30 μl/min for 120 s at 25 °C. After each hemoglobin injection, the chip was regenerated by two injections of 50 mm NaOH at a flow rate of 50 μl/min for 6 s. Individual rate constants were determined using the Biacore software. Alternatively, the equilibrium dissociation constants were determined by plotting the intensity of the steady-state response (response units) against the hemoglobin concentration. The data were fitted to the standard formula of the absorption isotherm using the program KaleidaGraph 3.6 (Synergy Software). Crystallization and Diffraction Data Collection—Wild-type, mature falcipain-2 was crystallized in the presence of the irreversible inhibitor iodoacetamide. Crystals were obtained at room temperature using the hanging-drop vapor diffusion method by equilibrating a mixture containing 5 μl of protein solution (2 mg/ml falcipain-2, 20 mm Tris-HCl (pH 7.5), 10 mm iodoacetamide, 150–200 mm NaCl) and an equivolume of precipitant solution (0.4–0.8 m (NH4)2SO4, 100 mm sodium citrate, pH 4.5–5.0) over reservoirs containing 1 ml of precipitant. Crystals appeared after 3–4 days and reached maximum dimensions of ∼250 × 50 × 50 μm within 10 days. Crystals generally diffracted anisotropically to a minimum Bragg spacing (dmin) of ∼10.0–6.0 Å, possibly due to their very high solvent content (see below). Only a few of the >50 crystals screened diffracted to a resolution of better than 3.5 Å, the best of which we report in this paper. Crystals were briefly soaked in a cryoprotectant consisting of precipitant solution with 25% (v/v) ethylene glycol and cooled to 100 K in a nitrogen-gas stream. The C-centered orthorhombic cell had dimensions a = 145.83 Å, b = 168.28 Å, and c = 178.09 Å. X-ray diffraction data were collected at 100 K and with an incident wavelength of 0.8045 Å at the Joint University of Hamburg-IMB Jena-EMBL Beamline X13, DESY (Hamburg). Crystal indexing and integration of reflection intensities were performed with Mosflm 6.2.4 (30Steller I. Bolotovsky R. Rossmann M.G. J. Appl. Crystallogr. 1997; 30: 1036-1040Crossref Scopus (178) Google Scholar, 31Leslie A.G.W. Acta Crystallogr. Sect. D Biol. Crystallogr. 2006; 62: 48-57Crossref PubMed Scopus (976) Google Scholar), with subsequent data scaling and merging carried out with Scala 3.2.5 of the CCP4 software suite (32Evans P. Acta Crystallogr. Sect. D Biol. Crystallogr. 2006; 62: 72-82Crossref PubMed Scopus (3882) Google Scholar, 33Collaborative Computational Project Number 4 Acta Crystallogr. Sect. D. 1994; 50: 760-763Crossref PubMed Scopus (19878) Google Scholar). Structure Determination and Refinement—Structure determination by molecular replacement phasing was implemented with Phaser 1.3 (34Storoni L.C. McCoy A.J. Read R.J. Acta Crystallogr. Sect. D. 2004; 60: 432-438Crossref PubMed Scopus (1112) Google Scholar) using a "mixed-model" (35Schwarzenbacher R. Godzik A. Grzechnik S.K. Jaroszewski L. Acta Crystallogr. Sect. D. 2004; 60: 1229-1236Crossref PubMed Scopus (155) Google Scholar) derived from residues 4–218 of the crystal structure of KDEL-tailed cysteine endopeptidase (36Than M.E. Helm M. Simpson D.J. Lottspeich F. Huber R. Gietl C. J. Mol. Biol. 2004; 336: 1103-1116Crossref PubMed Scopus (45) Google Scholar), which displays 43% sequence identity with falcipain-2. The correct solution, consisting of four falcipain-2 monomers in the crystallographic asymmetric unit (∼76% solvent content) was found in space group C2221 and yielded a log-likelihood gain (the difference between the log-likelihoods of the molecular replacement model and a random distribution of atoms) of 927 in the 40.0-3.5 Å resolution range. An initial σA-weighted electron density map (37Read R.J. Acta Crystallogr. A. 1986; 42: 140-149Crossref Scopus (2053) Google Scholar) calculated from the molecular replacement phases and measured amplitudes was subjected to prime-and-switch phasing with 4-fold non-crystallographic symmetry (NCS) averaging, as implemented in Resolve 2.05 (38Terwilliger T.C. Acta Crystallogr. Sect. D. 2004; 60: 2144-2149Crossref PubMed Scopus (61) Google Scholar), to reduce bias arising from the model-based phases. The NCS-averaged prime-and-switch electron density map was used to construct an initial model of falcipain-2 with the molecular graphics program Coot (39Emsley P. Cowtan K. Acta Crystallogr. Sect. D. 2004; 60: 2126-2132Crossref PubMed Scopus (24320) Google Scholar). Early rounds of crystallographic refinement were performed in CNS 1.1 (40Brünger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.-S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. Sect. D. 1998; 54: 905-921Crossref PubMed Scopus (17024) Google Scholar) using anisotropic bulk solvent correction, torsion-angle simulated annealing, positional, and grouped B-factor protocols with strict 4-fold NCS constraints. The model was subjected to iterative rounds of building into σA-weighted 3Fo – 2Fc and Fo – Fc maps, and crystallographic refinement with relaxed 4-fold NCS restraints was initiated at
Referência(s)