PRMT7, a New Protein Arginine Methyltransferase That Synthesizes Symmetric Dimethylarginine
2004; Elsevier BV; Volume: 280; Issue: 5 Linguagem: Inglês
10.1074/jbc.m405295200
ISSN1083-351X
AutoresJin-Hyung Lee, Jeffry R. Cook, Zhihong Yang, Olga Mirochnitchenko, Samuel Gunderson, Arthur M. Felix, Nicole Herth, Ralf Hoffmann, Sidney Pestka,
Tópico(s)Epigenetics and DNA Methylation
ResumoThe cDNA for PRMT7, a recently discovered human protein-arginine methyltransferase (PRMT), was cloned and expressed in Escherichia coli and mammalian cells. Immunopurified PRMT7 actively methylated histones, myelin basic protein, a fragment of human fibrillarin (GAR) and spliceosomal protein SmB. Amino acid analysis showed that the modifications produced were predominantly monomethylarginine and symmetric dimethylarginine (SDMA). Examination of PRMT7 expressed in E. coli demonstrated that peptides corresponding to sequences contained in histone H4, myelin basic protein, and SmD3 were methylated. Furthermore, analysis of the methylated proteins showed that symmetric dimethylarginine and relatively small amounts of monomethylarginine and asymmetric dimethylarginine were produced. SDMA was also formed when a GRG tripeptide was methylated by PRMT7, indicating that a GRG motif is by itself sufficient for symmetric dimethylation to occur. Symmetric dimethylation is reduced dramatically compared with monomethylation as the concentration of the substrate is increased. The data demonstrate that PRMT7 (like PRMT5) is a Type II methyltransferase capable of producing SDMA modifications in proteins. The cDNA for PRMT7, a recently discovered human protein-arginine methyltransferase (PRMT), was cloned and expressed in Escherichia coli and mammalian cells. Immunopurified PRMT7 actively methylated histones, myelin basic protein, a fragment of human fibrillarin (GAR) and spliceosomal protein SmB. Amino acid analysis showed that the modifications produced were predominantly monomethylarginine and symmetric dimethylarginine (SDMA). Examination of PRMT7 expressed in E. coli demonstrated that peptides corresponding to sequences contained in histone H4, myelin basic protein, and SmD3 were methylated. Furthermore, analysis of the methylated proteins showed that symmetric dimethylarginine and relatively small amounts of monomethylarginine and asymmetric dimethylarginine were produced. SDMA was also formed when a GRG tripeptide was methylated by PRMT7, indicating that a GRG motif is by itself sufficient for symmetric dimethylation to occur. Symmetric dimethylation is reduced dramatically compared with monomethylation as the concentration of the substrate is increased. The data demonstrate that PRMT7 (like PRMT5) is a Type II methyltransferase capable of producing SDMA modifications in proteins. Protein methylation has been shown to occur in a diverse number of biological processes such as signal transduction (1Mowen K.A. Tang J. Zhu W. Schurter B.T. Shuai K. Herschman H.R. David M. Cell. 2001; 104: 731-741Abstract Full Text Full Text PDF PubMed Scopus (396) Google Scholar, 2Abramovich C. Yakobson B. Chebath J. Revel M. EMBO J. 1997; 16: 260-266Crossref PubMed Scopus (153) Google Scholar), chromatin remodeling (3Sims R.J. II I Nishioka K. Reinberg D. Trends Genet. 2003; 19: 629-639Abstract Full Text Full Text PDF PubMed Scopus (537) Google Scholar), RNA splicing (4Brahms H. Raymackers J. Union A. de Keyser F. Meheus L. Luhrmann R. J. Biol. Chem. 2000; 275: 17122-17129Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar, 5Friesen W.J. Paushkin S. Wyce A. Massenet S. Pesiridis G.S. Van Duyne G. Rappsilber J. Mann M. Dreyfuss G. Mol. Cell. Biol. 2001; 21: 8289-8300Crossref PubMed Scopus (314) Google Scholar), RNA decay (6Bouveret E. Rigaut G. Shevchenko A. Wilm M. Seraphin B. EMBO J. 2000; 19: 1661-1671Crossref PubMed Scopus (306) Google Scholar, 7Tharun S. He W. Mayes A.E. Lennertz P. Beggs J.D. Parker R. Nature. 2000; 404: 515-518Crossref PubMed Scopus (333) Google Scholar), gene regulation (8Fabbrizio E. El Messaoudi S. Polanowska J. Paul C. Cook J.R. Lee J.H. Negre V. Rousset M. Pestka S. Le Cam A. Sardet C. EMBO Rep. 2002; 3: 641-645Crossref PubMed Scopus (183) Google Scholar, 9McBride A.E. Silver P.A. Cell. 2001; 106: 5-8Abstract Full Text Full Text PDF PubMed Scopus (397) Google Scholar), nuclear export of proteins (10Shen E.C. Henry M.F. Weiss V.H. Valentini S.R. Silver P.A. Lee M.S. Genes Dev. 1998; 12: 679-691Crossref PubMed Scopus (251) Google Scholar), inhibition of oncogenic ras signal transduction (11Chie L. Cook J.R. Chung D. Hoffmann R. Yang Z. Kim Y. Pestka S. Pincus M.R. Ann. Clin. Lab. Sci. 2003; 33: 200-207PubMed Google Scholar), and bacterial chemotaxis (12Ninfa E.G. Stock A. Mowbray S. Stock J. J. Biol. Chem. 1991; 266: 9764-9770Abstract Full Text PDF PubMed Google Scholar, 13Stock A. Schaeffer E. Koshland Jr., D.E. Stock J. J. Biol. Chem. 1987; 262: 8011-8014Abstract Full Text PDF PubMed Google Scholar). The methylation of protein substrates is catalyzed by enzymes that transfer a methyl group from S-adenosylmethionine to a protein acceptor, a process that occurs in many organisms. The residues that are modified by methylation include arginine, histidine, lysine, and aspartic acid. Protein-arginine methyltransferases (PRMTs) 1The abbreviations used are: PRMT, protein-arginine methyltransferase; ADMA, asymmetric dimethylarginine; SDMA, symmetric dimethylarginine; MMA, monomethylarginine; MBP, myelin basic protein; GST, glutathione S-transferase; PBS, phosphate-buffered saline; Fmoc, N-(9-fluorenyl)methoxycarbonyl. catalyze the formation of methylarginine residues. Four types of protein arginine methyltransferases have been described (14Clarke S. Curr. Opin. Cell Biol. 1993; 5: 977-983Crossref PubMed Scopus (200) Google Scholar). Type I PRMTs form ω-NG-monomethylarginine and asymmetric ω-NG,NG-dimethylarginine (ADMA) residues; type II PRMTs form ω-NG-monomethylarginine and symmetric ω-NG,NG′-dimethylarginine (SDMA) residues; type III and type IV PRMTs synthesize only ω-NG-monomethylarginine (MMA) and δ-NG-monomethylarginine, respectively. Although the presence of SDMA in eukaryotic cells has been known for a number of years (4Brahms H. Raymackers J. Union A. de Keyser F. Meheus L. Luhrmann R. J. Biol. Chem. 2000; 275: 17122-17129Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar, 15Baldwin G.S. Carnegie P.R. Science. 1971; 171: 579-581Crossref PubMed Scopus (147) Google Scholar), an enzyme that could synthesize SDMA was first identified by Pollack et al. (16Pollack B.P. Kotenko S.V. He W. Izotova L.S. Barnoski B.L. Pestka S. J. Biol. Chem. 1999; 274: 31531-31542Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar) and subsequently characterized (17Lee J.H. Cook J.R. Pollack B.P. Kinzy T.G. Norris D. Pestka S. Biochem. Biophys. Res. Commun. 2000; 274: 105-111Crossref PubMed Scopus (53) Google Scholar, 18Branscombe T.L. Frankel A. Lee J.H. Cook J.R. Yang Z. Pestka S. Clarke S. J. Biol. Chem. 2001; 276: 32971-32976Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar) and designated PRMT5. PRMT5 was found to methylate histones H2A and H4, myelin basic protein (MBP), and several spliceosomal Sm proteins (SmD1, SmD3 and SmB) in vitro (4Brahms H. Raymackers J. Union A. de Keyser F. Meheus L. Luhrmann R. J. Biol. Chem. 2000; 275: 17122-17129Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar, 5Friesen W.J. Paushkin S. Wyce A. Massenet S. Pesiridis G.S. Van Duyne G. Rappsilber J. Mann M. Dreyfuss G. Mol. Cell. Biol. 2001; 21: 8289-8300Crossref PubMed Scopus (314) Google Scholar, 16Pollack B.P. Kotenko S.V. He W. Izotova L.S. Barnoski B.L. Pestka S. J. Biol. Chem. 1999; 274: 31531-31542Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 17Lee J.H. Cook J.R. Pollack B.P. Kinzy T.G. Norris D. Pestka S. Biochem. Biophys. Res. Commun. 2000; 274: 105-111Crossref PubMed Scopus (53) Google Scholar, 18Branscombe T.L. Frankel A. Lee J.H. Cook J.R. Yang Z. Pestka S. Clarke S. J. Biol. Chem. 2001; 276: 32971-32976Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 19Rho J. Choi S. Seong Y.R. Cho W.K. Kim S.H. Im D.S. J. Biol. Chem. 2001; 276: 11393-11401Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 20Brahms H. Meheus L. de Brabandere V. Fischer U. Luhrmann R. RNA (N. Y.). 2001; 7: 1531-1542Crossref PubMed Scopus (300) Google Scholar, 21Meister G. Eggert C. Buhler D. Brahms H. Kambach C. Fischer U. Curr. Biol. 2001; 11: 1990-1994Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar). Methylation of spliceosomal components by PRMT5 is a prerequisite for their assembly into the spliceosome (20Brahms H. Meheus L. de Brabandere V. Fischer U. Luhrmann R. RNA (N. Y.). 2001; 7: 1531-1542Crossref PubMed Scopus (300) Google Scholar, 21Meister G. Eggert C. Buhler D. Brahms H. Kambach C. Fischer U. Curr. Biol. 2001; 11: 1990-1994Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 22Friesen W.J. Massenet S. Paushkin S. Wyce A. Dreyfuss G. Mol. Cell. 2001; 7: 1111-1117Abstract Full Text Full Text PDF PubMed Scopus (293) Google Scholar). PRMT5 also has been shown to be associated with the cyclin E gene and to be involved with other transcriptional events as well (8Fabbrizio E. El Messaoudi S. Polanowska J. Paul C. Cook J.R. Lee J.H. Negre V. Rousset M. Pestka S. Le Cam A. Sardet C. EMBO Rep. 2002; 3: 641-645Crossref PubMed Scopus (183) Google Scholar, 23Kwak Y.T. Guo J. Prajapati S. Park K.J. Surabhi R.M. Miller B. Gehrig P. Gaynor R.B. Mol. Cell. 2003; 11: 1055-1066Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar). Although a large number of proteins have been found to contain SDMA residues (24Boisvert F.M. Cote J. Boulanger M.C. Richard S. Mol. Cell. Proteomics. 2003; 2: 1319-1330Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar), for several years PRMT5 was the only known Type II PRMT. Here we report the discovery of another Type II protein arginine methyltransferase, PRMT7, that can synthesize SDMA. This protein was initially characterized in hamster cells as a protein that modulates drug sensitivity to DNA-damaging agents (25Gros L. Delaporte C. Frey S. Decesse J. Saint-Vincent B.R. Cavarec L. Dubart A. Gudkov A.V. Jacquemin-Sablon A. Cancer Res. 2003; 63: 164-171PubMed Google Scholar). Plasmid Constructs—The cDNA of PRMT7 was cloned with primers specific to the open reading frame of FLJ10640, a cDNA we identified with homology to PRMT5 and other PRMTs (Fig. 1 and Table I). Of the three splice variants of this cDNA, the longest variant was chosen. The cDNA was amplified by PCR at 95 °C for 2 min followed by 30 cycles of denaturing at 95 °C for 45 s and then annealing at 55 °C for 45 s and elongation at 72 °C for 2 min. After 30 cycles, the reactions were then incubated at 72 °C for 10 min. The PCR product was digested with EcoRI and XbaI restriction endonucleases, gel-purified, and ligated at 16 °C for 21 h into vector pEF2 (16Pollack B.P. Kotenko S.V. He W. Izotova L.S. Barnoski B.L. Pestka S. J. Biol. Chem. 1999; 274: 31531-31542Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar), which had been digested with EcoRI and XbaI restriction endonucleases. The primers used were 5′-GGAATTCCATGGACTACAAGGACGACGATGACAAGAAGAAGATCTTCTGCAG-TCGGGCC and 5′-GCTCTAGAGCTCAGTCTGGGGTATCTGCATGC. The first primer encodes the FLAG epitope. The template for the PCR reaction was a plasmid obtained from the American Type Culture Collection (ATCC, Manassas, VA; catalog number MGC-5331) that contains the FLJ10640 cDNA. The FLJ10640 open reading frame was also amplified by PCR and digested with EcoRI restriction endonucleases and cloned into pGEX-3X at the EcoRI site to form pGEX-PRMT7. The primers used were 5′-GGAATTCCGATGAAGATCTTCTGCAGTC and 5′-GGAATTCTCAGTCTGGGGTATCTGCATG. PCR conditions were described above.Table IHomologies of human PRMTs PRMTs were compared two at a time with the Bestfit program (GCG). The percentages of identity and similarity (in parentheses) are shown in the table. Comparisons were made with full-length sequences for each PRMT. Accession numbers of PRMTs are noted in Fig. 1.Identity (similarity)PRMT1PRMT2PRMT3PRMT4PRMT5PRMT6PRMT7PRMT110038.1 (52.0)52.0 (63.9)37.4 (47.7)33.9 (43.5)36.0 (47.3)28.3 (38.2)PRMT238.1 (52.0)10038.8 (52.8)40.1 (49.1)30.5 (38.6)39.7 (49.0)27.0 (38.3)PRMT352.0 (63.9)38.8 (52.8)10036.7 (49.4)26.6 (37.7)37.0 (49.2)25.6 (36.1)PRMT437.4 (47.7)40.1 (49.1)36.7 (49.4)10032.4 (40.1)40.8 (49.8)35.7 (45.0)PRMT533.9 (43.5)30.5 (38.6)26.6 (37.7)32.4 (40.1)10030.8 (37.6)26.3 (37.2)PRMT636.0 (47.3)39.7 (49.0)37.0 (49.2)40.8 (49.8)30.8 (37.6)10030.5 (43.7)PRMT728.3 (38.2)27.0 (38.3)25.6 (36.1)35.7 (45.0)26.3 (37.2)30.5 (43.7)100 Open table in a new tab To create the plasmid pEF2-Myc-PRMT7, the pEF2-FLAG-PRMT7 plasmid was amplified by PCR at 95 °C for 2 min followed by 20 cycles of denaturing at 95 °C for 45 s, annealing at 55 °C for 45 s, and elongation at 72 °C for 10 min with primers that encode the Myc epitope: 5′-GTAACGGCCGCCAGTGTGCTGGGACATGAAGATCTTCTGCAGTCGGGCC and 5′-GGCCCGACTGCAGAAGATCTTCATGTCCTCCTCAGAGATCAGCTTCTGCTCTTCCATGGAATTCCAGCACACTGGCGGCCGTTAC. The reactions were then incubated at 72 °C for 10 min. The PCR product was digested with KpnI and XbaI restriction endonucleases, gel-purified, and ligated into the vector pEF2-FLAG-PRMT7, which had been digested with KpnI and XbaI. Purification of GST-PRMT7—Selected Escherichia coli transformants in the Rosetta strain (Novagen) were grown in TB medium (11.8 g of SELECT Peptone 140 (pancreatic digest of casein), 23.6 g of yeast extract, 9.4 g of dipotassium hydrogen phosphate, and 2.2 g of potassium dihydrogen phosphate; Invitrogen) plus 150 μg/ml ampicillin to an optical density at A600 of 0.5 at which time isopropyl 1-thio-β-d-galactopyranoside was added to a final concentration of 1 mm. The GST-PRMT7 fusion protein was purified with glutathione-Sepharose 4B beads (Amersham Biosciences) as described (16Pollack B.P. Kotenko S.V. He W. Izotova L.S. Barnoski B.L. Pestka S. J. Biol. Chem. 1999; 274: 31531-31542Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar). The bound protein was eluted with 10 mm glutathione, 50 mm Tris-HCl, pH 8.0, and 5 mm EDTA. Protein was quantified with the Bio-Rad protein assay. The SDS-PAGE of the GST-PRMT7 fusion protein is shown in Fig. 2. Immunopurification of FLAG-PRMT7—Dishes of adherent HeLa or COS cells transfected with pEF2-FLAG-PRMT7 as described (26Tang M.X. Redemann C.T. Szoka Jr., F.C. Bioconjugate Chem. 1996; 7: 703-714Crossref PubMed Scopus (855) Google Scholar, 27Sussman D.J. Milman G. Mol. Cell. Biol. 1984; 4: 1641-1643Crossref PubMed Scopus (124) Google Scholar) were washed twice with ice-cold PBS and scraped with a silicone policeman in 1 ml of lysis buffer containing 50 mm sodium phosphate, pH 7.6, 1% Nonidet P-40, 0.8 mm phenylmethylsufonyl fluoride, 1 μg/ml leupeptin, 2 μg/ml antipain, 10 μg/ml benzamidine, 104 KIU/ml of aprotinin, 1 μg/ml chymostatin, and 1 μg/ml pepstatin. The cells were incubated on ice for 30 min and then centrifuged at 14,000 rpm for 10 min in a microcentrifuge at 4 °C. Supernatants were transferred to a new 1.5-ml microcentrifuge tube. To immunoprecipitate epitope-tagged PRMT7, 1.0 μg of the anti-FLAG monoclonal antibody M2 (Sigma) was added to 1 ml of each lysate (supernatant) that was then incubated at 4 °C overnight with rocking. Thirty μl of Protein A/G Plus beads (Santa Cruz Biotechnology) were then added, and the mixture was incubated for an additional 3–4 h at 4 °C with rocking. The beads were pelleted and then washed three times with 1 ml of ice-cold 50 mm sodium phosphate buffer, pH 7.6. The beads with attached immunopurified protein were stored at -80 °C until used. Preparation of Monomethylarginine (ω-NG-Monomethylarginine)— Conversion of Fmoc-OCOCl to Fmoc-OSu was performed as described (28Paquet A. Can. J. Chem. 1976; 54: 733-737Crossref Google Scholar, 29Sigler G.F. Fuller W.D. Chuturverdi N.C. Goodman M. Verlander M. Biopolymers. 1983; 22: 2157-2162Crossref Scopus (83) Google Scholar). HOSu (0.633 g, 5.5 mmol) was added to a solution of Fmoc-OCOCl (1.29 g, 5.0 mmol) in dioxane (12.5 ml) in a 50-ml round-bottomed flask with a magnetic stirrer. It was cooled in an ice bath, and triethylamine (0.70 ml, 5.0 mmol) was added over a 5-min period with stirring. Stirring then continued at room temperature for 2 h. The precipitated triethylamine hydrochloride was filtered off (weight = 0.63 g), and the filtrate was evaporated to ∼5 ml and added portionwise to an Erlenmeyer flask containing 25 ml of diethyl ether. An oil separated out and was placed in the refrigerator overnight. The next day the supernatant solution was decanted and separated from the oil. This filtrate immediately began to crystallize and afforded 430 mg of white crystals (26% yield). Additional product left in the oil was not isolated. The product had an m.p. 143–144 °C (uncorrected) (theory: m.p. 150–153 °C) and was used directly in the next step. Preparation of Fmoc-Arg(Me)-OH—A solution of NG-methyl-l-arginine (acetate salt) (124 mg, 0.50 mmol, ICN Biomedicals, Inc., catalog number 155470) in water (1 ml) in a 10-ml round-bottomed flask was treated with triethylamine (140 μl, 2.0 eq) followed by the addition of Fmoc-OSu (152 mg, 0.45 mmol, 0.90 eq) in acetonitrile (1 ml). An additional 0.30 ml of acetonitrile was required for rinsing. Magnetic stirring continued at room temperature for 30 min, and the pH was maintained at pH 8–9 by addition of triethylamine. The resultant clear solution was evaporated to dryness with a rotary evaporator, and a white tacky semisolid residue was obtained. Water was added (5 ml), and the pH was determined to be 6–7 and then the mixture was placed in the refrigerator overnight (4 °C). The oily product that solidified overnight was isolated by filtration, washed with water, and dried in vacuo. Further drying in the dessicator gave 60 mg (32% yield) of white solid. The product was insoluble in water and ethyl acetate; soluble in acetonitrile and N,N-dimethylformamide. Deprotection of an aliquot with 15% piperidine in N,N-dimethylformamide followed by a ninhydrin test was positive and in agreement with the expected structure. The peptide, SGRMeGKGGKGLGKGGAKRHRK, was prepared by solid phase synthesis as described below for the other peptides (RMe represents ω-NG-monomethylarginine). Peptides—The following peptides were synthesized chemically as substrates for PRMT7: P-SmD3, AGRGRGKAAILKAQVAARGRGRG-MGRGN-NH2; P-MBP, SQGKGRGLSLSRFSWGAE-NH2; M1, SGRGKGGKGLGKGGAKRHRK-NH2; GRG; M8, SGAGKGGKGLGKGGAKAHAK-NH2 with all arginines substituted with alanine; MM, SGRMeGKGGKGLGKGGAKRHRK-NH2 (RMe, monomethylarginine). Briefly, the peptides were prepared on solid phase by the Fmoc/t-butyl-strategy and O-benzotriazole-N,N,N′,N′-tetramethyluronium hexafluorophosphate-activation on a SYRO multiple peptide synthesizer (MultiSynTech GmbH, Witten, Germany) as reported (30Pipkorn R. Boenke C. Gehrke M. Hoffmann R. J. Pept. Res. 2002; 59: 105-114Crossref PubMed Scopus (15) Google Scholar). The methylated peptide MM was synthesized until the previous glycine (position 4 of peptide MM) on a 433A batch synthesizer (Applied Biosystems, Weiterstadt, Germany), and the remaining three residues were coupled manually with 20 mg of peptide resin. After cleavage with trifluoroacetic acid the crude peptides were purified by reversed-phase high pressure liquid chromatography with an aqueous acetonitrile gradient with 0.1% trifluoroacetic acid. The purified peptides were characterized by matrix-assisted laser desorption/ionization mass spectrometry and stored dry at -20 °C until used. In Vitro Methylation Reactions—The 30-μl reaction mixtures included 1–10 μg of substrate protein or peptide as noted in the figure legends, 5 μl of [3H]S-adenosylmethionine (81 Ci/mmol, PerkinElmer Life Sciences), 0.1–1 μg of GST-PRMT7, or 15 μl of protein A/G PLUS beads (containing the immunopurified FLAG-PRMT7 isolated from ∼1 × 107 HeLa or COS cells), plus buffer (50 mm sodium phosphate, pH 7.6) to make the final concentration 8.3 mm sodium phosphate, pH 7.6. The 30-μl reaction mixtures were incubated at 37 °C for 5–21 h as described in the figure legends. To determine the incorporation, aliquots of the reaction mixtures were precipitated with cold 10% trichloroacetic acid onto 0.45 μm nitrocellulose filters (HA, Millipore) as described (31Pestka S. J. Biol. Chem. 1972; 247: 4669-4678Abstract Full Text PDF PubMed Google Scholar). Gel Electrophoresis of Methylated Proteins—Aliquots of the in vitro methylation reactions were electrophoresed on precast 15% polyacrylamide gels (Novex, Invitrogen). Gels were stained with 50% methanol, 10% acetic acid, and 0.25% Coomassie Brilliant Blue in water and destained with 30% methanol and 10% acetic acid in water and then dried and exposed to Biomax film at -80 °C for 14 days. TLC—In vitro methylation reactions (30 μl) were hydrolyzed with 250 μl of 6 n HCl at 110 °C for 21 h in a sealed glass ampule. The hydrolyzed amino acids were dried in an oven after opening the ampule. Thirty μl of water was added to the dried residue, and then 10 μl of the solution was applied to each lane of a Silica 60 TLC plate (Whatman). The solvent of 30% ammonium hydroxide, chloroform, methanol, and water (2:0.5:4.5:1) was used for the chromatographic separations of the amino acids (5Friesen W.J. Paushkin S. Wyce A. Massenet S. Pesiridis G.S. Van Duyne G. Rappsilber J. Mann M. Dreyfuss G. Mol. Cell. Biol. 2001; 21: 8289-8300Crossref PubMed Scopus (314) Google Scholar). Color was developed with a ninhydrin spray (Sigma). Standards (MMA, ADMA, and SDMA) were purchased from Calbiochem. Chromatographs were coated with three applications of EN3HANCE Spray (PerkinElmer Life Sciences) and then exposed to film at -80 °C for 7–21 days. Analysis of the Distribution of PRMT7 in Cells—COS-1 cells were plated at 3 × 104 cells per chamber in LabTek II 4-well chamber slides (VWR) on the day before transfection. Plasmid pEF2-Myc-PRMT7 was transfected into COS-1 cells with Superfectamine transfection reagent (Qiagen) as described above under "Immunopurification of FLAG-PRTM7." Plasmid pEF2-Myc-PRMT5 or pEF2-Myc vector was transfected at the same time as positive and negative controls, respectively. 24–36 h after transfection, the cells were washed three times with PBS, pH 7.4 and fixed in 3.7% formaldehyde in PBS for 15 min at room temperature (32Spector D.L. Smith H.C. Exp. Cell Res. 1986; 163: 87-94Crossref PubMed Scopus (74) Google Scholar). The cells were then washed three times in PBS and permeabilized in 0.2% Triton X-100 plus 1% normal goat serum in PBS for 5 min on ice. The cells were washed three times in PBS plus 1% normal goat serum and incubated in 1:200 diluted rabbit anti-Myc antibody (Santa Cruz Biotechnology, Inc.) for 1 h at room temperature. The cells were then washed three times in PBS plus 1% normal goat serum followed by incubation in rhodamine-conjugated goat anti-rabbit antibody (Santa Cruz Biotechnology, Inc.) at a dilution of 1:150 for 1 h at room temperature. The cells were subsequently washed three times in PBS. The chamber was removed from the slide and then mounting medium (Vector Laboratories, Inc., Burlingame, CA) containing 4′,6-diamidino-2-phenylindole was added to cells. A coverslip was placed over the cells on the slide and sealed with clear nail polish. The stained cells were visualized under a Nikon eclipse TE200 microscope with ×200 magnification, and photographs were taken by a CoolSNAP Pro digital camera (Media Cybernetics, Houston, TX) with Image Pro Plus software. The Sequence Motif Search Program (Kyoto University) was used to search for proteins containing consensus S-adenosylmethionine binding sites. One protein identified was encoded by the cDNA designated FLJ10640, which contained a motif for an S-adenosylmethionine binding site and other methyltransferase motifs suggesting that it might be a PRMT. We designated the protein encoded by the FLJ10640 cDNA PRMT7. When the protein sequence of PRMT7 was compared with the other known human PRMTs, PRMT7 seemed to be a member of the human PRMT family (Fig. 1). Table I shows a summary of the homology of all the known protein arginine methyltransferases (PRMT1 through PRMT7) with respect to each other. PRMT7 is most similar to PRMT4. To determine whether PRMT7 contains methyltransferase activity, FLAG-PRMT7 was expressed in HeLa cells and immunopurified with anti-FLAG antibody. The immunopurified protein was assayed in vitro for methylation activity with four different substrate proteins. Fig. 3A shows that the FLAG-PRMT7 preparation has significant methyltransferase activity with histones, MBP, GAR (a fragment of human fibrillarin), and SmB (a spliceosomal Sm protein) as substrates. Fig. 3B shows both a Coomassie Blue-stained gel and the autoradiograph of the proteins methylated in these reactions. Of the five histones (H1, H2A, H2B, H3, and H4) in the preparation that was assayed only two were methylated. Based on their size and the results of a control experiment in which the five histones were methylated individually (data not shown), we concluded that the methylated (labeled) histones are H2A and H4. MBP was also methylated. Although low quantities of GAR and SmB were present in the methylation reactions, their methylation was nevertheless appreciable judging from the intensity of the autoradiographic bands. Because PRMT5 methylates these same proteins in vitro, these data suggested that there might be some functional similarity between PRMT7 and PRMT5 (16Pollack B.P. Kotenko S.V. He W. Izotova L.S. Barnoski B.L. Pestka S. J. Biol. Chem. 1999; 274: 31531-31542Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 18Branscombe T.L. Frankel A. Lee J.H. Cook J.R. Yang Z. Pestka S. Clarke S. J. Biol. Chem. 2001; 276: 32971-32976Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). Alternatively, the similarity of substrates for PRMT5 and PRMT7 could be caused by association of PRMT5 with PRMT7. To rule out this possibility, hemagglutinin-PRMT5 and FLAG-PRMT7 were expressed in COS cells. After the cells were lysed, FLAG-PRMT7 was immunoprecipitated as described under "Experimental Procedures." The immunoprecipitated FLAG-PRMT7 was analyzed by blotting and probing with anti-hemagglutinin antibody. The results did not show any detectable hemagglutinin-PRMT5 associated with PRMT7, thereby eliminating the possibility that the activity of immunopurified PRMT7 was due to the presence of PRMT5 (Fig. 4).Fig. 4PRMT7 is not associated with PRMT5. COS cells were transfected with the indicated plasmids. After 48 h, the cells were lysed and either lysate (from 1 × 105 cells) or immunoprecipitate (from 1 × 106 cells) was separated by PAGE (12.5%) and blotted. The blots were probed with anti-hemagglutinin antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Next we determined the type of methylation produced by the immunopurified PRMT7. In this experiment, COS cells were transiently transfected with pEF2-FLAG-PRMT7, and the protein was assayed for activity by in vitro methylation. As shown in Fig. 5, SDMA, ADMA, and MMA were not found in detectable quantities in the absence of substrate (lane 1). However, in the presence of histones, SDMA was clearly produced (lane 2). No ADMA or MMA was detectable in this case. When the MBP peptide (P-MBP) was methylated, no detectable SDMA was produced, and the major product was MMA (lane 3). Nevertheless, the formation of SDMA in histone substrates suggested that PRMT7 might be a Type II PRMT. PRMT7 was expressed in E. coli and purified by affinity chromatography as described under "Experimental Procedures." The GST-PRMT7 fusion protein was used to methylate various peptides in vitro. Fig. 6A shows that methylation occurred with peptides M1, P-SmD3, and P-MBP as substrates. Because the GRG tripeptide was not trichloroacetic acid-precipitated because of its small size, it was analyzed with the other peptides after hydrolysis and TLC. As is shown in Fig. 6B (lane 1), GST-PRMT7 alone did not produce SDMA, ADMA, or MMA in detectable quantities. With peptides M1 (lane 2), P-SmD3 (lane 3), P-MBP (lane 4), and GRG (lane 5), however, a large amount of SDMA was generated with relatively much less ADMA and MMA, indicating that PRMT7 is in fact a Type II PRMT. The fact that the GRG tripeptide was methylated by PRMT7 was surprising. Nevertheless, this result demonstrates that the GRG motif is sufficient for methylation by PRMT7. To confirm that SDMA is synthesized by PRMT7, we used GST-PRMT7 produced in E. coli with protein (Fig. 7A) and peptide (Fig. 7B) substrates. GST-PRMT7 methylated the proteins H2A, MBP, and SmD1, although SmD1 was methylated at a low level. GST-PRMT7 also methylated the peptides M1 and MM. Peptide MM contained a G-RMe-G (where RMe is methylarginine) instead of the usual GRG motif present in peptide M1. PRMT7 methylated MM significantly greater than it labeled M1 (Fig. 7B). When TLC was performed to determine the products of the methylation, it was evident that GST-PRMT7 alone produced no detectable SDMA, ADMA or MMA (Fig. 7C, lane 1). However, PRMT7 yielded mostly SDMA with the M1 peptide (lane 2). When the monomethylated peptide (MM) was tested, once again SDMA was synthesized (lane 3), indicating that PRMT7 is a Type II PRMT. When all three of the arginines in peptide M1 were substituted with alanines, this peptide designated M8 was not methylated (lane 4) showing that PRMT7 methylates only arginine residues to synthesize SDMA predominantly. Because Miranda et al. (33Miranda T.B. Miranda M. Frankel A. Clarke S. J. Biol. Chem. 2004; 279: 22902-22907Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar) found that PRMT7 synthesizes MMA but no dimethylarginines with a peptide substrate, we tested the effects of peptide concentration on the rela
Referência(s)