The Mouse Na+-Sulfate Cotransporter GeneNas1
2000; Elsevier BV; Volume: 275; Issue: 16 Linguagem: Inglês
10.1074/jbc.275.16.11880
ISSN1083-351X
AutoresLaurent Beck, Daniel Markovich,
Tópico(s)Plant Stress Responses and Tolerance
ResumoNaSi-1 is a Na+-sulfate cotransporter expressed on the apical membrane of the renal proximal tubule and plays an important role in sulfate reabsorption. To understand the molecular mechanisms that mediate the regulation of NaSi-1, we have isolated and characterized the mouse NaSi-1 cDNA (mNaSi-1), gene (Nas1), and promoter region and determinedNas1 chromosomal localization. The mNaSi-1 cDNA encodes a protein of 594 amino acids with 13 putative transmembrane segments, inducing high affinity Na+-dependent transport of sulfate in Xenopus oocytes. Three different mNaSi-1 transcripts derived from alternative polyadenylation and splicing were identified in kidney and intestine. The Nas1 gene is a single copy gene comprising 15 exons spread over 75 kilobase pairs that maps to mouse chromosome 6. Transcription initiation occurs from a single site, 29 base pairs downstream to a TATA box-like sequence. The promoter is AT-rich (61%), contains a number of well characterizedcis-acting elements, and can drive basal transcriptional activity in opossum kidney cells but not in COS-1 or NIH3T3 cells. We demonstrated that 1,25-dihydroxyvitamin D3 stimulated the transcriptional activity of the Nas1 promoter in transiently transfected opossum kidney cells. This study represents the first characterization of the genomic organization of a Na+-sulfate cotransporter gene. It also provides the basis for a detailed analysis of Nas1 gene regulation and the tools required for assessing Nas1 role in sulfate homeostasis using targeted gene manipulation in mice. NaSi-1 is a Na+-sulfate cotransporter expressed on the apical membrane of the renal proximal tubule and plays an important role in sulfate reabsorption. To understand the molecular mechanisms that mediate the regulation of NaSi-1, we have isolated and characterized the mouse NaSi-1 cDNA (mNaSi-1), gene (Nas1), and promoter region and determinedNas1 chromosomal localization. The mNaSi-1 cDNA encodes a protein of 594 amino acids with 13 putative transmembrane segments, inducing high affinity Na+-dependent transport of sulfate in Xenopus oocytes. Three different mNaSi-1 transcripts derived from alternative polyadenylation and splicing were identified in kidney and intestine. The Nas1 gene is a single copy gene comprising 15 exons spread over 75 kilobase pairs that maps to mouse chromosome 6. Transcription initiation occurs from a single site, 29 base pairs downstream to a TATA box-like sequence. The promoter is AT-rich (61%), contains a number of well characterizedcis-acting elements, and can drive basal transcriptional activity in opossum kidney cells but not in COS-1 or NIH3T3 cells. We demonstrated that 1,25-dihydroxyvitamin D3 stimulated the transcriptional activity of the Nas1 promoter in transiently transfected opossum kidney cells. This study represents the first characterization of the genomic organization of a Na+-sulfate cotransporter gene. It also provides the basis for a detailed analysis of Nas1 gene regulation and the tools required for assessing Nas1 role in sulfate homeostasis using targeted gene manipulation in mice. diastrophic dysplasia sulfate transporter brush-border membrane rapid amplification of cDNA ends untranslated region opossum kidney reverse transcriptase-polymerase chain reaction long and accurate PCR 25-(OH)2D3, 1α,25-dihydroxyvitamin D3 direct repeat vitamin D receptor vitamin D-responsive element human retinoid X receptor α thyroid hormone-responsive elements glucocorticoid-responsive element expressed sequence tag base pair kilobase pair 1,4-piperazinediethanesulfonic acid Sulfate is the fourth most abundant anion in mammalian plasma, is present in nearly all cell types, and is essential for a variety of metabolic and cellular processes (1.Tallgren L. Acta Med. Scand. 1980; 640 (suppl.): 1-100Google Scholar). The largest group of sulfoconjugates in mammals is sulfated proteoglycans, which are required for normal structure and function of bone and cartilage. Accordingly, three human congenital chondrodysplasias were recently shown to be caused by mutations in a sulfate transport protein gene (DTDST),1 leading to undersulfation of proteoglycans in the extracellular matrix of bone and cartilage, and associated developmental abnormalities (2.Hastbacka J. de la Chapelle A. Mahtani M.M. Clines G. Reeve-Daly M.P. Daly M. Hamilton B.A. Kusumi K. Trivedi B. Weaver A. et al.Cell. 1994; 78: 1073-1087Abstract Full Text PDF PubMed Scopus (622) Google Scholar, 3.Hastbacka J. Superti-Furga A. Wilcox W.R. Rimoin D.L. Cohn D.H. Lander E.S. Am. J. Hum. Genet. 1996; 58: 255-262PubMed Google Scholar, 4.Superti-Furga A. Hastbacka J. Wilcox W.R. Cohn D.H. van der Harten H.J. Rossi A. Blau N. Rimoin D.L. Steinmann B. Lander E.S. Gitzelmann R. Nat. Genet. 1996; 12: 100-102Crossref PubMed Scopus (187) Google Scholar). Considering the importance of sulfate at a cellular and biochemical level, it is likely that mechanisms regulating the serum sulfate levels are essential for the maintenance of normal physiology. However, little is established about the molecular factors that regulate sulfate homeostasis, and the physiological consequence of a disturbance in sulfate homeostasis is mostly unknown. In mammals, the regulation of sulfate homeostasis is largely determined by the kidney with the majority of the filtered sulfate load reabsorbed in the proximal segment of the nephron. Transepithelial transport of sulfate from the renal lumen to the blood compartment involves entry through the brush-border membrane (BBM) by a Na+-dependent transport system, translocation across the cell and efflux across the basolateral membrane by an anion exchange system (5.Murer H. Manganel M. Roch-Ramel F. Winhager E. Handbook of Physiology. 2. Oxford University Press, Oxford1992: 2165-2188Google Scholar). Early transport studies in BBM vesicles suggested that Na+-sulfate cotransport across the BBM is the rate-limiting step in the overall sulfate reabsorptive process (6.Besseghir K. Roch-Ramel F. Renal Physiol. 1987; 10: 221-241PubMed Google Scholar, 7.Frick A. Durasin I. Pfluegers Arch. 1986; 407: 541-546Crossref PubMed Scopus (14) Google Scholar). By expression cloning, we isolated a cDNA (NaSi-1) from rat kidney encoding a high affinity Na+-dependent sulfate transporter (8.Markovich D. Forgo J. Stange G. Biber J. Murer H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8073-8077Crossref PubMed Scopus (145) Google Scholar). NaSi-1 mRNA is expressed in kidney and small intestine and encodes a glycosylated protein (8.Markovich D. Forgo J. Stange G. Biber J. Murer H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8073-8077Crossref PubMed Scopus (145) Google Scholar) that has been localized by immunohistochemistry to the BBM of proximal tubular cells (9.Lotscher M. Custer M. Quabius E.S. Kaissling B. Murer H. Biber J. Pfluegers Arch. Eur. J. Physiol. 1996; 432: 373-378Crossref PubMed Scopus (48) Google Scholar). Recently, factors known to regulate renal Na+-sulfate reabsorption were found to regulate NaSi-1 expression in the kidney. Vitamin D was shown to modulate concomitantly serum sulfate concentration, renal sulfate handling, and the expression (mRNA and protein levels) and activity of the NaSi-1 cotransporter (10.Fernandes I. Hampson G. Cahours X. Morin P. Coureau C. Couette S. Prie D. Biber J. Murer H. Friedlander G. Silve C. J. Clin. Invest. 1997; 100: 2196-2203Crossref PubMed Scopus (55) Google Scholar). High sulfate intake in rats led to a reduction in both NaSi-1 mRNA and protein (11.Markovich D. Murer H. Biber J. Sakhaee K. Pak C. Levi M. J. Am. Soc. Nephrol. 1998; 9: 1568-1573Crossref PubMed Google Scholar), whereas low sulfate intake (reduced methionine diet) led to an increase in both NaSi-1 mRNA and protein (12.Sagawa K. DuBois D.C. Almon R.R. Murer H. Morris M.E. J. Pharmacol. Exp. Ther. 1998; 287: 1056-1062PubMed Google Scholar). Thyroid hormone, growth hormone, heavy metals, potassium intake, and anti-inflammatory agents were also found to regulate NaSi-1 expression (13.Puttaparthi K. Markovich D. Halaihel N. Wilson P. Zajicek H.K. Wang H. Biber J. Murer H. Rogers T. Levi M. Am. J. Physiol. 1999; 276: C1398-C1404Crossref PubMed Google Scholar, 14.Sagawa K. Han B. DuBois D.C. Murer H. Almon R.R. Morris M.E. J. Pharmacol. Exp. Ther. 1999; 290: 1182-1187PubMed Google Scholar, 15.Markovich D. Knight D. Am. J. Physiol. 1998; 274: F283-F289PubMed Google Scholar, 16.Markovich D. Wang H. Puttaparthi K. Zajicek H. Rogers T. Murer H. Biber J. Levi M. Kidney Int. 1999; 55: 244-251Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 17.Sagawa K. Benincosa L.J. Murer H. Morris M.E. J. Pharmacol. Exp. Ther. 1998; 287: 1092-1097PubMed Google Scholar). It is suggested that these modulators could alter serum sulfate levels via the regulation of NaSi-1 expression in vivo, suggesting that sulfate homeostasis is controlled, at least in part, by NaSi-1. However, the underlying mechanisms involved in the regulation of NaSi-1 expression by these factors, as well as NaSi-1 contribution to body sulfate homeostasis, have yet to be defined. In order to provide insights into the molecular mechanisms underlying tissue-specific and hormonal regulation of NaSi-1 and its role in sulfate homeostasis, we have cloned and characterized the mouse NaSi-1 cDNA and its corresponding gene. This study represents the first characterization of the genomic structure of a Na+-coupled sulfate transporter gene. We have also determined the pattern of NaSi-1 expression in mouse adult tissues, identified the existence of alternative transcripts, determined its chromosomal localization, and demonstrated that the transcriptional activity of the promoter region is elevated in response to 1,25-(OH)2D3stimulation in a transiently transfected renal cell line. Oligonucleotides used during this study are listed in Table I. The mouse NaSi-1 (designated mNaSi-1) cDNA coding sequence was cloned using RT-PCR. Total RNA (5 μg) isolated from mouse kidney cortex was reverse-transcribed and PCR-amplified using primers derived from the rat NaSi-1 cDNA (designated rNaSi-1) coding sequence (8.Markovich D. Forgo J. Stange G. Biber J. Murer H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8073-8077Crossref PubMed Scopus (145) Google Scholar). The PCR products were subcloned into pCR 2.1 vector (Invitrogen) and sequenced in both directions. Semi-quantitative PCR amplification of mNaSi-1 was performed by comparing its abundance to β-actin. Preliminary optimization of the conditions showed that coamplification of mNaSi-1 and β-actin transcripts was occurring linearly through cycles 23–30. Total RNA treated with RNase-free DNase I enzyme was reverse-transcribed, and PCR amplification (30 cycles) was performed using 0.4 μm mNaSi-1 primers (FN252 and RN1220) and 0.1 μm β-actin primers. The identity of the mNaSi-1 PCR-amplified products in each tissue was confirmed by restriction enzyme digestion. Fluorescence from ethidium bromide staining of each mNaSi-1 signal was compared with that of β-actin, by calculating the ratio (fluorescence units of mNaSi-1/fluorescence units of β-actin). Dye-termination sequencing was performed using the Big DyeTM Termination kit (Perkin-Elmer) following the manufacturer's protocol, and gel separation was performed at the Australian Genome Research Facility, the University of Queensland.Table IOligonucleotidesNameSequenceaPrimers were designed either from the rat or the mouse NaSi-1 cDNA sequences and are written from the 5′ to 3′ direction.PositionbThe number indicated refers to the nucleotide position within the mNaSi-1 cDNA sequence (A of ATG initiation codon defined as +1) where the 5′ end of the primer will anneal.StrandSense Nas1-specific primersFN-24TGTTGAAGGCACCTGCTCAGG−24SenseFN17ATGCTTTGGTCTATCGCCGCTTTC17SenseFN110GTGCCTACATCCTCTTTGTTATTG110SenseFN252CTTTCACCTTCTGCTAATTGGA252SenseFN390CACTGCCTTCTTATCTATGTGG390SenseFN665CAGTCACAGGAGCAAAATATCGG665SenseFN823GAATGTCGCTGCCTCCACTTTGG823SenseFN1386TCCTCTAGGTTCATTACCAGTTTG1386SenseFN1547TGCCTTCCACTCTCTGTACCTCA1547SenseAntisense Nas1-specific primersRN44AGGAGAAAGCGGCGATAGAC44AntisenseRN88TGATGAGAGGGAGTGGCAAGA88AntisenseRN137ATGGCAATAACAAAGAGGATGT137AntisenseRN226GTGAAGAACGCATGATCCCAAA226AntisenseRN308TTCCATTTCTCTATTGATGTTGCT308AntisenseRN535GGGCGGCAGATTCATTGAAATA535AntisenseRN687CCGATATTTTGCTCCTGTGACTG687AntisenseRN909GAGCCAAATCCAAGACAAAAGTAG909AntisenseRN1020CCCAAGTTTTTCATATTCTT1020AntisenseRN1220GTCATTTTTGTCAGTTTCTTGGC1220AntisenseRN1647CATGTCAATGACTTTCAGGTGG1647AntisenseRN1989AGGCGGGTAGATGCTCTTTGATTG1989Antisensea Primers were designed either from the rat or the mouse NaSi-1 cDNA sequences and are written from the 5′ to 3′ direction.b The number indicated refers to the nucleotide position within the mNaSi-1 cDNA sequence (A of ATG initiation codon defined as +1) where the 5′ end of the primer will anneal. Open table in a new tab The 5′- and 3′ end of mNaSi-1 cDNA were isolated using 5′- and 3′-RACE techniques, respectively, essentially as described by Chen (18.Chen Z. Trends Genet. 1996; 12: 87-88Abstract Full Text PDF PubMed Scopus (35) Google Scholar). For 5′-RACE, primer RN137 was used to reverse-transcribe mouse kidney total RNA and for a first round of PCR amplification. After nested amplification using primer RN88, PCR products were obtained and subcloned into pCR 2.1 vector. For 3′-RACE, kidney total RNA was reverse-transcribed using SuperScript II (Life Technologies, Inc.) and an oligo(dT)/adapter primer. PCR amplification using Taq DNA polymerase (Biotech International) was carried out using primer FN1547. The 3′-RACE technique was also used for identifying mNaSi-1 variants. In this case, total RNA from mouse kidney was reverse-transcribed using display THERMO-RTTM (Display Systems Biotech) reverse transcriptase, and PCR amplifications were performed using a 16:1 blend of Taq and Pfu(Promega) DNA polymerases with primers FN-24, FN110, FN823, or FN1547. The 5′-RACE technique was also used to confirm the position of the transcription start site (see below). In this case, primer RN535 was used for reverse transcription and first round of PCR, and primer RN226 was used for nested amplification. In addition, the display THERMO-RTTM reverse transcriptase was used to permit the utilization of high temperatures (42 °C for 40 min and 65 °C for 15 °C) avoiding an artificial termination due to the secondary structure of mRNA. Methods for handling of oocytes, in vitro transcription, and transport assay have been described previously (8.Markovich D. Forgo J. Stange G. Biber J. Murer H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8073-8077Crossref PubMed Scopus (145) Google Scholar, 19.Markovich D. Bissig M. Sorribas V. Hagenbuch B. Meier P.J. Murer H. J. Biol. Chem. 1994; 269: 3022-3026Abstract Full Text PDF PubMed Google Scholar). Stages V and VI oocytes were injected with either 50 nl of water (control) or 5 ng of mNaSi-1 cRNA using a Nanoject automatic oocyte injector (Drummond Scientific Co.). Northern analysis of total RNA (25 μg) from mouse tissues (Fig. 5) was performed as described previously (20.Beck L. Soumounou Y. Martel J. Krishnamurthy G. Gauthier C. Goodyer C.G. Tenenhouse H.S. J. Clin. Invest. 1997; 99: 1200-1209Crossref PubMed Scopus (253) Google Scholar). Full-length mNaSi-1 cDNA was32P-labeled by random priming and used as a probe. After stripping, the membranes were rehybridized with a32P-labeled 1.3-kb mouse β-actin cDNA probe. Mouse genomic DNA (10 μg) prepared from mouse liver was digested with restriction enzymes (Fig. 3), separated on 0.7% agarose gels, and capillary transferred to positively charged nylon membranes (Hybond XL, Amersham Pharmacia Biotech). After UV-cross linking, the membranes were hybridized (16–18 h at 65 °C) with a full-length32P-labeled mNaSi-1 cDNA probe in Church's buffer (0.5mNa2HPO4/NaH2PO4, pH 7.2, 7% SDS, 10 mm EDTA). The membranes were then washed to high stringency and exposed to Kodak X-Omat AR5 film at −80 °C for 48 h.Figure 3Southern blot analysis of mouse genomic DNA. Mouse liver DNA (10 μg) was digested with BamHI,EcoRI, EcoRV, HindIII, orPstI, as indicated, electrophoresed on a 0.7% agarose gel, transferred to a nylon membrane, and hybridized with a full-length32P-labeled mNaSi-1 cDNA probe.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The genomic clones were isolated from a λ FIX II mouse (129sv strain) genomic DNA library (Stratagene) using the method described by Lardelli and Lendahl (21.Lardelli M. Lendahl U. BioTechniques. 1994; 16: 420-422PubMed Google Scholar). Five positive λ clones were purified and further analyzed. Some large introns were isolated from mouse genomic DNA using LA-PCR, as described elsewhere (22.Cheng S. Fockler C. Barnes W.M. Higuchi R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 5695-5699Crossref PubMed Scopus (574) Google Scholar). Introns 1, 2, and 6–8 were amplified using primer pairs FN17/RN226, FN110/RN308, FN390/RN687, FN665/RN909, and FN823/RN1020, respectively. Identity and further characterization of the λ clones and PCR products were confirmed by Southern analysis and/or direct sequencing of the coding regions. Exon sizes were determined by nucleotide sequencing, and intron sizes were determined by either nucleotide sequencing or estimated from the size of corresponding PCR-generated DNA fragments using exon-specific primers. Location of and sequences at intron/exon boundaries of the Nas1 gene were determined by direct sequencing using Nas1-specific oligonucleotides. Primer extension analysis was performed using protocols and reagents provided by Promega (primer extension system). Briefly, two Nas1-specific primers located in exon 1 (RN44 and RN88) were end-labeled using T4 polynucleotide kinase and [γ-32P]dATP. Total RNA (10 μg) was mixed with 0.1 pmol of the labeled primer, denatured 5 min at 90 °C, and incubated at 55 °C for 16 h in hybridization buffer (0.4 m NaCl, 1 mm EDTA, 40 mm PIPES, pH 6.4, 80% formamide). After reverse transcription using avian myeloblastosis virus-reverse transcriptase, the labeled cDNAs were separated through a 6% polyacrylamide gel.HinfI-φx174-digested DNA was end-labeled and used as a molecular weight marker. The gel was dried and exposed to Kodak X-Omat AR5 film for 48 h at −80 °C. Fine mapping of Nas1 was undertaken using the T-31 Radiation Hybrid Panel of the mouse genome (Research Genetics). Primers used for screening were FN1386 and RN1647, generating an intense 1.5-kb band from mouse genomic DNA and a faint 950-bp band from Chinese hamster DNA. The panel was screened twice using these primers and a third time using primers FN1547 and RN1989. Data analysis was performed by the Jackson Laboratory Mouse Radiation Hybrid Data Base. Three fragments containing 3229, 1203, and 457 bp of Nas1 5′-flanking sequence, respectively, were PCR-amplified from the λP2 clone (Fig. 4 A), subcloned into pCR2.1 vector, and sequenced. These fragments were then inserted upstream of a luciferase reporter gene in a promoterless luciferase expression vector (pGL3-Basic, Promega) by restriction enzyme digestion and ligation. Plasmids were designated pNas1-3229, pNas1-1203, and pNas1-457, respectively. The 1203-bp promoter fragment was also cloned in reverse orientation and designated pNas1-1203R. Correct insertion and sequence were verified by enzyme restriction digestion and sequencing. COS-1 and NIH3T3 cells were cultured in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) with 10% (v/v) fetal bovine serum (Life Technologies, Inc.). OK cells were maintained in Ham's F12/Dulbecco's modified Eagle's medium (1:1) containing 10% fetal bovine serum. At 80% confluence, cells were cotransfected using LipofectAMINETM 2000 reagent (Life Technologies, Inc.), with 0.8 μg of the Nas1 gene promoter-luciferase reporter plasmid and 0.8 μg of pRSVβGal plasmid (gift of Dr. M. Waters, University of Queensland) as an internal control for transfection efficiency. Incubation with plasmids and LipofectAMINE was carried out for 24 h in normal growth medium, as recommended by the manufacturer. Controls were performed by transfection with pGL3-Basic (promoter-less plasmid) and pGL3-Control (containing the SV40 promoter). In experiments involving vitamin D, cells were cotransfected with 0.2 μg of a VDR expression vector alone or together with 0.2 μg of a human RXRα expression vector (VDR/pSG5 and RXR/pSG5 plasmids, respectively; generous gift from Dr. John White, McGill University). The VDR and hRXRα expression plasmids were cotransfected to ensure that a sufficient concentration of receptor was available for binding to the overexpressed Nas1 gene. Incubation with plasmids and LipofectAMINE was carried out for 24 h, after which the medium was replaced by fresh Dulbecco's modified Eagle's medium containing 10% fetal bovine serum with varying concentrations of 1,25-(OH)2D3 for an additional 24 h. Cells were then harvested in cell lysis buffer, and the lysate was assayed for luciferase and β-galactosidase activities using protocols and reagents provided by Roche Molecular Biochemicals. Luciferase activity was measured using a Trilux 1450 Microbeta (Wallac) luminometer. Data are shown as means ± S.D. Statistical significance was determined by unpaired Student's t test, with p < 0.05 considered significant. For the transport kinetic studies in oocytes, the Michaelis-Menten and generalized Hill equations were used to calculateK m and V max values using non-linear regression. The mouse Na+-sulfate cotransporter cDNA, mNaSi-1, was cloned using a combination of RT-PCR and 5′- and 3′-RACE techniques. The mNaSi-1 cDNA is 2246 bp long, with 28 bases of 5′-UTR, an open reading frame of 1782 bases, and 436 bases of 3′-UTR. The 3′-UTR contains a polyadenylation signal (AATAAA) at position 2180. The open reading frame encodes a protein of 594 amino acids (Fig.1 A) with a calculated molecular mass of 66.1 kDa, containing 13 putative transmembrane domains, predicted by the TopPred2 program (23.von Heijne G. J. Mol. Biol. 1992; 225: 487-494Crossref PubMed Scopus (1402) Google Scholar). The mNaSi-1 protein contains one potential protein kinase A (Thr404) and five potential protein kinase C (Ser213, Thr218, Ser230, Thr322, and Thr422) phosphorylation sites (Fig. 1 A). Consensus sequences forN-glycosylation were found at Asn positions 140, 174, and 590 (Fig. 1 A). Alignment of the mouse and rat NaSi-1 amino acid sequences shows 93.6% identity and 96% similarity. Nucleotide sequence identity is 91% between mouse and rat NaSi-1. When this work was initiated, no ESTs with homology to mNaSi-1 were identified. At the submission of this manuscript, a search in the EST data base identified approximately 50 murine ESTs from kidney, all identical to mNaSi-1. Homology searches using BLAST (24.Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (70747) Google Scholar) and PSI-BLAST (25.Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59926) Google Scholar) revealed significant homology to 22 other proteins (Fig. 1 B), although the closest relatives are the recently reported human Na+-sulfate cotransporter SUT-1 (49% identity (26.Girard J.P. Baekkevold E.S. Feliu J. Brandtzaeg P. Amalric F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12772-12777Crossref PubMed Scopus (53) Google Scholar)) and the Na+-dicarboxylate transporters sharing ∼32–43% protein sequence identity with mNaSi-1. Of particular interest is a consensus pattern previously established for Na+-coupled symporters (PROSITE PS01271) known as the Na+-sulfate signature, present at amino acids 522–538 in the mNaSi-1 protein containing a very high degree of homology with other related proteins (Fig. 1 B). To determine the functionality of the isolated clone, we injected mNaSi-1 cRNA into Xenopus oocytes followed by [35S]sulfate radiotracer uptake assay. Sulfate uptake in mNaSi-1-cRNA-injected oocytes was Na+-dependent and showed typical Michaelis-Menten saturation, with a calculatedK m value for sulfate of 0.20 ± 0.06 mm and V max of 49.2 ± 4.1 pmol/h (data not shown), in agreement with the BBM Na+-sulfate cotransporter (5.Murer H. Manganel M. Roch-Ramel F. Winhager E. Handbook of Physiology. 2. Oxford University Press, Oxford1992: 2165-2188Google Scholar). mNaSi-1 mRNA expression was screened by RT-PCR in 23 murine tissues (Fig.2). An amplified mNaSi-1 fragment was obtained in RNA from kidney, duodenum/jejunum, ileum, and colon. Lower levels of mNaSi-1 mRNA expression were observed in cecum, testis, adrenal, and adipose tissue. By normalizing the mNaSi-1 mRNA signal to β-actin, the relative abundance of mNaSi-1 in kidney and ileum was found to be similar and approximately twice as high as those found in duodenum/jejunum and colon (Fig. 2 B; n = 3). The physiological importance of the low level of expression of mNaSi-1 found in testis, adrenal, and adipose tissue remains to be determined. Southern blotting was used to estimate the size and complexity of the gene encoding mNaSi-1, designatedNas1 (Fig. 3). Results show that the estimated size of the Nas1 gene was approximately 45 kb, which was lower than the actual size of the Nas1 gene determined from genomic cloning (see below). This was due both to the presence of comigrating bands and large introns that did not hybridize with the cDNA probe. Blots washed at both high and low stringency gave similar results, suggesting that Nas1 is a single copy gene. Screening of a genomic λ phage library led to the isolation of five λ Nas1 clones containing the 5′-flanking region and most of the Nas1-coding region (Fig.4 A). Introns 1, 2, and 6–8 not present in the λ clones were obtained using LA-PCR (Fig.4 A). The λ clones and PCR-amplified introns overlapped, covering a 80-kb region comprising the entire Nas1 gene (Fig. 4 A). Southern analysis of the Nas1 genomic clones was consistent with the data obtained from Southern blotting of mouse genomic DNA and confirmed that Nas1 is a single copy gene. The resulting exon-intron organization of the mouseNas1 gene is shown in Fig. 4 B. TheNas1 spans ∼75 kb and contains 15 exons. The translation initiation site is present in exon 1. Exon sizes range from 49 to 188 bp, except for exon 15, which is 555 bp and contains the TGA stop codon (Fig. 4 C and Table II). Intron sizes range from 70 bp to 15 kb (Table II). All exon-intron boundaries conform to canonical splice donor and acceptor consensus sequences, and the codon phase usage is mainly 0 or II (Table II). Comparison of predicted protein transmembrane domains to exon border structure showed that each predicted transmembrane segment is encoded by a separate exon, with the exception of transmembrane domains 10 and 11, which are encoded by the same exon (exon 13). In addition, splicing mostly occurred near membrane/aqueous transitions (Fig. 4 D).Table IIExon/intron organization of the mouse Nas1 geneIntron numberLocation5′ splice donoraExon sequences are indicated by uppercase letters and intron sequences by lowercase letters.Intron sizebIntron size was determined by restriction analysis, direct sequencing for small introns, and by estimating the size of PCR amplification products for large introns.3′ splice acceptoraExon sequences are indicated by uppercase letters and intron sequences by lowercase letters.Amino acidcAmino acids encoded at the splice sites are indicated.Codon phasedIntrons that do not split codon triplets are indicated by phase 0, interruption after the first nucleotide by phase I, and interruption after the second nucleotide by phase II.Exon numberExon sizebpbp199ACCAAG/gtaagcaagc…15,000…ccctttgcag/GAAGCALys011272228TCACAG/gtaacataat…12,500…gcaatttcag/GTGGCTGln021293365AGCCTG/gtgagtatta…2,500…ctcgtttcag/GCTGACTrpII31374553TTGATG/gtatcatgta…600…tatcttacag/AAACTGGlu I41885611TCCAGG/gtaaagacta…70…tatgtttcag/AAGCAGGlyII5586660GAAAAG/gtacattaca…13,500…ttgattacag/AATGCALys06497794GATCTT/gtataaagct…10,000…cttattgcag/CTCTGAPheII71348932ATTCGA/gtaagtagac…3,500…tctctttcag/CTTTAAAspII813891028AATGAG/gttaaaattg…560…tcttccacag/GTATCAArgII996101130TTCAGA/gttgagtatc…3,100…tatttttcag/GTACCCGluII10102111237AAATTA/gttgagtatc…2,400…tattttgcag/TTGCTTIle I11107121347TGTCAG/gtaatgctca…4,800…tgtattgtag/GTATCAGln012110131509CCTTTG/gtgagtatga…1,250…tccatgccag/GCTGAALeu013162141647GACATG/gtaagtcagc…1,500…tgttactaag/GTTAAAMet01413815555a Exon sequences are indicated by uppercase letters and intron sequences by lowercase letters.b Intron size was determined by restriction analysis, direct sequencing for small introns, and by estimating the size of PCR amplification products for large introns.c Amino acids encoded at the splice sites are indicated.d Introns that do not split codon triplets are indicated by phase 0, interruption after the first nucleotide by phase I, and interruption after the second nucleotide by phase II. Open table in a new tab Nas1was mapped by analysis of the data from the T-31 Radiation Hybrid panel in The Jackson Laboratory Mouse Radiation Hybrid data base. The data placedNas1 on mouse chromosome 6 in the most likely position between marker D6Mit170 (LOD score 20.8) and D6Mit380 (LOD score 11.2).Nas1 is 2.3 centi-rays distal to D6Mit170, which has been assigned map positions of 4.4 centimorgans (MIT) and 4.0 centimorgans (MGD and Chromosome Committee). The Nas1 gene maps very close to the calcitonin receptor gene, which has been assigned a position of 4.5 centimorgans (MGD and Chromosome Committee) in mouse and 7q21.3-q21.3 in human. By using Northern blot analysis, two major transcr
Referência(s)