A Novel Endonucleolytic Mechanism to Generate the CCA 3′ Termini of tRNA Molecules in Thermotoga maritima
2004; Elsevier BV; Volume: 279; Issue: 15 Linguagem: Inglês
10.1074/jbc.m313951200
ISSN1083-351X
AutoresAsako Minagawa, Hiroaki Takaku, Masamichi Takagi, Masayuki Nashimoto,
Tópico(s)Genomics and Phylogenetic Studies
ResumoThe tRNA 3′-terminal CCA sequence is essential for aminoacylation of the tRNAs and for translation on the ribosome. The tRNAs are transcribed as larger precursor molecules containing 5′ and 3′ extra sequences. In the tRNAs that do not have the encoded CCA, the 3′ extra sequence after the discriminator nucleotide is usually cleaved off by the tRNA 3′ processing endoribonuclease (3′ tRNase, or RNase Z), and the 3′-terminal CCA residues are added thereto. Here we analyzed Thermotoga maritima 3′ tRNase for enzymatic properties using various pre-tRNAs from T. maritima, in which all 46 tRNA genes encode CCA with only one exception. We found that the enzyme has the unprecedented activity that cleaves CCA-containing pre-tRNAs precisely after the CCA sequence, not after the discriminator. The assays for pre-tRNA variants suggest that the CA residues at nucleotides 75 and 76 are required for the enzyme to cleave pre-tRNAs after A at nucleotide 76 and that the cleavage occurs after nucleotide 75 if the sequence is not CA. Intriguingly, the pre-tRNAMet that is the only T. maritima pre-tRNA without the encoded CCA was cleaved after the discriminator. The kinetics data imply the existence of a CCA binding domain in T. maritima 3′ tRNase. We also identified two amino acid residues critical for the cleavage site selection and several residues essential for the catalysis. Analysis of cleavage sites by 3′ tRNases from another eubacteria Escherichia coli and two archaea Thermoplasma acidophilum and Pyrobaculum aerophilum corroborates the importance of the two amino acid residues for the cleavage site selection. The tRNA 3′-terminal CCA sequence is essential for aminoacylation of the tRNAs and for translation on the ribosome. The tRNAs are transcribed as larger precursor molecules containing 5′ and 3′ extra sequences. In the tRNAs that do not have the encoded CCA, the 3′ extra sequence after the discriminator nucleotide is usually cleaved off by the tRNA 3′ processing endoribonuclease (3′ tRNase, or RNase Z), and the 3′-terminal CCA residues are added thereto. Here we analyzed Thermotoga maritima 3′ tRNase for enzymatic properties using various pre-tRNAs from T. maritima, in which all 46 tRNA genes encode CCA with only one exception. We found that the enzyme has the unprecedented activity that cleaves CCA-containing pre-tRNAs precisely after the CCA sequence, not after the discriminator. The assays for pre-tRNA variants suggest that the CA residues at nucleotides 75 and 76 are required for the enzyme to cleave pre-tRNAs after A at nucleotide 76 and that the cleavage occurs after nucleotide 75 if the sequence is not CA. Intriguingly, the pre-tRNAMet that is the only T. maritima pre-tRNA without the encoded CCA was cleaved after the discriminator. The kinetics data imply the existence of a CCA binding domain in T. maritima 3′ tRNase. We also identified two amino acid residues critical for the cleavage site selection and several residues essential for the catalysis. Analysis of cleavage sites by 3′ tRNases from another eubacteria Escherichia coli and two archaea Thermoplasma acidophilum and Pyrobaculum aerophilum corroborates the importance of the two amino acid residues for the cleavage site selection. Every single tRNA molecule ends with the sequence CCA (1Sprinzl M. Horn C. Brown M. Ioudovitch A. Steinberg S. Nucleic Acids Res. 1998; 26: 148-153Crossref PubMed Scopus (818) Google Scholar). This 3′-terminal sequence is essential for aminoacylation of the tRNAs (2Tamura K. Nameki N. Hasegawa T. Shimizu M. Himeno H. J. Biol. Chem. 1994; 269: 22173-22177Abstract Full Text PDF PubMed Google Scholar) and for translation on the ribosome (3Green R. Noller H.F. Annu. Rev. Biochem. 1997; 66: 679-716Crossref PubMed Scopus (425) Google Scholar) in all organisms. The tRNAs are transcribed as larger precursor molecules, which subsequently undergo various processing steps such as removal of 5′ and 3′ extra sequences to generate mature tRNAs (4Deutscher M.P. Nucleic Acids Res. Mol. Biol. 1990; 39: 209-240Crossref PubMed Scopus (105) Google Scholar). Because generally eukaryotic tRNA genes do not encode the CCA sequence, the eukaryotic tRNAs are supplemented with the CCA residues by tRNA nucleotidyltransferase (4Deutscher M.P. Nucleic Acids Res. Mol. Biol. 1990; 39: 209-240Crossref PubMed Scopus (105) Google Scholar, 5Schurer H. Schiffer S. Marchfelder A. Morl M. Biol. Chem. 2001; 382: 1147-1156Crossref PubMed Scopus (71) Google Scholar). It is believed that the discriminator nucleotide that protrudes from the aminoacyl stem, to which CCA is added, is generated by removing the 3′ extra sequence primarily with tRNA 3′ processing endoribonuclease (3′ tRNase, or RNase Z) 1The abbreviations used are: 3′ tRNase, tRNA 3′ processing endoribonuclease; nt, nucleotide(s); ATPγS, adenosine 5′-O-(3-thiotriphosphate). (6Castano J.G. Tobian J.A. Zasloff M. J. Biol. Chem. 1985; 260: 9002-9008Abstract Full Text PDF PubMed Google Scholar, 7Oommen A. Li X.Q. Gegenheimer P. Mol. Cell. Biol. 1992; 12: 865-875Crossref PubMed Scopus (33) Google Scholar, 8Nashimoto M. Nucleic Acids Res. 1997; 25: 1148-1155Crossref PubMed Scopus (73) Google Scholar, 9Levinger L. Bourne R. Kolla S. Cylin E. Russell K. Wang X. Mohan A. J. Biol. Chem. 1998; 273: 1015-1025Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 10Nashimoto M. Tamura M. Kaspar R.L. J. Mol. Biol. 1999; 287: 727-740Crossref PubMed Scopus (26) Google Scholar, 11Mohan A. Whyte S. Wang X. Nashimoto M. Levinger L. RNA (N. Y.). 1999; 5: 245-256Crossref PubMed Scopus (54) Google Scholar, 12Schiffer S. Rosch S. Marchfelder A. EMBO J. 2002; 21: 2769-2777Crossref PubMed Scopus (152) Google Scholar, 13Takaku H. Minagawa A. Takagi M. Nashimoto M. Nucleic Acids Res. 2003; 31: 2272-2278Crossref PubMed Scopus (152) Google Scholar, 14Schiffer S. Rosch S. Marchfelder A. Biol. Chem. 2003; 384: 333-342Crossref PubMed Scopus (23) Google Scholar) and possibly in some circumstances with some unidentified exoribonucleases (15Papadimitriou A. Gross H.J. Eur. J. Biochem. 1996; 242: 747-759Crossref PubMed Scopus (24) Google Scholar, 16Yoo C.J. Wolin S.L. Cell. 1997; 89: 393-402Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). In contrast, the CCA sequences of all Escherichia coli tRNAs are encoded in its genome, and the six exoribonucleases RNase BN, RNase II, polynucleotide phosphorylase, RNase PH, RNase D, and RNase T are involved in the removal of 3′ trailers to generate the CCA termini (17Li Z. Deutscher M.P. Cell. 1996; 86: 503-512Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar, 18Deutscher M.P. Li Z. Prog. Nucleic Acids Res. Mol. Biol. 2001; 66: 67-105Crossref PubMed Scopus (120) Google Scholar). RNase II and polynucleotide phosphorylase, however, prefer unstructured RNAs such as mRNAs as substrates, so that their roles in tRNA maturation would probably be limited. In the other eubacteria and archaea, percentages of the CCA-coding tRNA genes vary with species from 0 to 100% (Table I). From the above precedents, it was assumed that prokaryotes containing 0 and 100% CCA-coding tRNA genes would primarily utilize the eukaryote-type and E. coli-type systems, respectively, to generate the CCA termini, and that the other prokaryotes would make use of both systems depending on the presence or absence of the encoded CCA sequence.Table IGenes for tRNAs, 3′ tRNase, and exoribonucleasesSpeciesCCA/totalaThe number of CCA-containing tRNA genes versus the number of the total tRNA genes.EndoBNIIPNPPHDTBorrelia burgdorferi0/32+−+−−−−Chlamydophila pneumoniae0/38+−++−−−Chlamydophila trachomatis1/45+−++−−−Treponema pallidum10/31+−++−−−Buchnera sp.15/45+−+−++−Mycobacterium leprae15/45+−+−++−Staphylococcus aureus N31537/61+++−−−−Bacillus subtilis63/86+++++−−Aquifex aeolicus32/43+−+++−−Bacillus halodurans63/78+++−+−+Deinococcus radiodurans48/49+−+++−−Haemophilus influenzae55/56−++++++Thermotoga maritima45/46+−++−−−Campylobacter jejuni42/42−+++−−−Caulobacter crescentus51/51+−+++++Escherichia coli86/86+++++++Helicobacter pylori 2669536/36−+++−−−Mycoplasma genitalium35/35−−−+−−−Mycoplasma penetrans36/36−−−−−−−Patteurella multocida51/51+++++++Rickettsia prowazekii32/32−++−++−Pseudomonas aeruginosa62/62+++−+++Ureaplasma urealyticum29/29−−−+−−−Vibrio cholerae98/98+++++++Xylella fastidiosa49/49−++++++Archaeoglobus fulgidus0/46+−−+−−−Halobacterium sp.0/45+−−−+−−Thermoplasma volcanium0/45+−−−+−−Sulfolobus solfataricus1/45+−−−+−−Sulfolobus tokodaii1/45+−−−+−−Thermoplasma acidophilum1/45+−−−+−−Methanobacterium thermoautotrophicum1/39+−−−+−−Pyrobaculum aerophilum19/46+−−−+−−Methanococcus jannaschii25/36+−−−−−−Pyrococcus abyssi44/46+−−−+−−Pyrococcus furiosus46/46+−−−+−−Pyrococcus horikoshii46/46+−−−+−−Aeropyrum pernix46/46+−−−+−−a The number of CCA-containing tRNA genes versus the number of the total tRNA genes. Open table in a new tab In the course of compilation of tRNA, 3′ tRNase, and exoribonuclease genes from available prokaryote genome data, however, we became aware that the Thermotoga maritima genome (19Nelson K.E. Clayton R.A. Gill S.R. Gwinn M.L. Dodson R.J. Haft D.H. Hickey E.K. Peterson J.D. Nelson W.C. Ketchum K.A. McDonald L. Utterback T.R. Malek J.A. Linher K.D. Garrett M.M. Stewart A.M. Cotton M.D. Pratt M.S. Phillips C.A. Richardson D. Heidelberg J. Sutton G.G. Fleischmann R.D. Eisen J.A. White O. Salzberg S.L. Smith H.O. Venter J.C. Fraser C.M. Nature. 1999; 399: 323-329Crossref PubMed Scopus (1212) Google Scholar) encodes orthologues to 3′ tRNase, RNase II, and polynucleotide phosphorylase but no orthologues to RNase BN, RNase PH, RNase D, and RNase T, although its 46 tRNA genes encode CCA with only one exception (Table I). If T. maritima 3′ tRNase is responsible for removal of 3′ extra sequences from the pre-tRNAs containing the CCA residues, the reason why the genome preserves CCA in the tRNA genes is a mystery, because 3′ tRNases so far characterized are believed to cleave pre-tRNAs immediately after the discriminator (6Castano J.G. Tobian J.A. Zasloff M. J. Biol. Chem. 1985; 260: 9002-9008Abstract Full Text PDF PubMed Google Scholar, 7Oommen A. Li X.Q. Gegenheimer P. Mol. Cell. Biol. 1992; 12: 865-875Crossref PubMed Scopus (33) Google Scholar, 8Nashimoto M. Nucleic Acids Res. 1997; 25: 1148-1155Crossref PubMed Scopus (73) Google Scholar, 9Levinger L. Bourne R. Kolla S. Cylin E. Russell K. Wang X. Mohan A. J. Biol. Chem. 1998; 273: 1015-1025Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 10Nashimoto M. Tamura M. Kaspar R.L. J. Mol. Biol. 1999; 287: 727-740Crossref PubMed Scopus (26) Google Scholar, 11Mohan A. Whyte S. Wang X. Nashimoto M. Levinger L. RNA (N. Y.). 1999; 5: 245-256Crossref PubMed Scopus (54) Google Scholar, 12Schiffer S. Rosch S. Marchfelder A. EMBO J. 2002; 21: 2769-2777Crossref PubMed Scopus (152) Google Scholar, 13Takaku H. Minagawa A. Takagi M. Nashimoto M. Nucleic Acids Res. 2003; 31: 2272-2278Crossref PubMed Scopus (152) Google Scholar, 14Schiffer S. Rosch S. Marchfelder A. Biol. Chem. 2003; 384: 333-342Crossref PubMed Scopus (23) Google Scholar). It should be noted, however, that in some cases additional cleavages were observed in vitro 1-nt upstream, or 1- or 2-nt downstream. To solve this enigma, we analyzed T. maritima 3′ tRNase for enzymatic properties using various pre-tRNAs. Here we show that T. maritima 3′ tRNase has the unprecedented activity that cleaves CCA-containing pre-tRNAs precisely after the CCA sequence, not after the discriminator. We also identify essential residues in substrate and enzyme for the cleavage site selection and the catalysis. The mechanism for 3′ tRNase to select the cleavage site must have co-evolved with the gain or loss of the CCA sequence in tRNA genes. Construction of Expression Plasmids for 3′ tRNases from T. maritima, Thermoplasma acidophilum, and Pyrobaculum aerophilum—Twelve DNA fragments were chemically synthesized to produce the double-stranded DNA encoding T. maritima 3′ tRNase, in which the codons are optimized for translation in E. coli. The full-length DNA for 3′ tRNase (data not shown) was created by PCR with the primer pair 5′Tm/3′Tm (Table II) using Pyrobest DNA polymerase (Takara Shuzo) and cloned between the SphI and SalI sites of the expression vector pQE-80L (Qiagen). The resulting plasmid pQE/Tm(WT) was designed to produce 3′ tRNase containing N-terminal histidines.Table IIPCR primers used for cloning and site-directed mutagenesisNameSequence (5′ to 3′)5′TmACATGCATGCATGAACATCATTGGCTTTAG3′TmCCGCTCGAGTTACATTTC5′EcCGGGATCCATGGAATTAATTTTTTTAGG3′EcCCGCTCGAGTTAAACGTTAAACACGGTG5′TaCGCGGATCCATGATGGCTTCGAATATAAGG3′TaCCGCTCGAGTTAATCAACGTCTCTTCTTACCTT5′PaCGCGGATCCATGCCAATAGTAAAACTAGTT3′PaCCGCTCGCGTTAAAGCTTGACGAGAAGAGTTTCD25A(sense)ATTCTGTTTGCTGCGGGCGAAD25A(antisense)TTCGCCCGCAGCAAACAGAATG27A(sense)TTTGATGCGGCCGAAGGCGTGG27A(antisense)CACGCCTTCGGCCGCATCAAAV30T(sense)GGCGAAGGCACGAGCACCACCV30T(antisense)GGTGGTGCTCGTGCCTTCGCCS31Q(sense)GAAGGCGTGCAAACCACCCTGS31Q(antisense)CAGGGTGGTTTGCACGCCTTCT33Q(sense)GTGAGCACCCAACTGGGCAGCT33Q(antisense)GCTGCCCAGTTGGGTGCTCACV38A(sense)GGCAGCAAAGCGTATGCGTTTV38A(antisense)AAACGCATACGCTTTGCTGCCH48A(sense)TTTCTGACCGCTGGCCATGTGH48A(antisense)CACATGGCCAGCGGTCAGAAAG49L(sense)CTGACCCATCTCCATGTGGATG49L(antisense)ATCCACATGGAGATGGGTCAGH50A(sense)ACCCATGGCGCTGTGGATCATH50A(antisense)ATGATCCACAGCGCCATGGGTV51G(sense)CATGGCCATGGGGATCATATTV51G(antisense)AATATGATCCCCATGGCCATGD52A(sense)GGCCATGTGGCTCATATTGCGD52A(antisense)CGCAATATGAGCCACATGGCCH53A(sense)CATGTGGATGCTATTGCGGGCH53A(antisense)GCCCGCAATAGCATCCACATGA55L(sense)GATCATATTCTGGGCCTGTGGA55L(antisense)CCACAGGCCCAGAATATGATCG49L/V51G(sense)CTGACCCATCTCCATGGGGATCATAG49L/V51G(antisense)TATGATCCCCATGGAGATGGGTCAG43LTR44(sense)AAATATCTGACCCGCGTGTTTCTGACCCATGGC43LTR44(antisense)GCCATGGGTCAGAAACACGCGGGTCAGATATTT Open table in a new tab The full-length 3′ tRNase coding regions of E. coli (915 bp), T. acidophilum (921 bp), and P. aerophilum (861 bp) were PCR-amplified from their genomes. The primer pairs 5′Ec/3′Ec, 5′Ta/3′Ta, and 5′Pa/3′Pa (Table II) were used for the amplification of E. coli, T. acidophilum, and P. aerophilum genes, respectively. Each amplified gene was cloned between the BamHI and SalI sites of pQE-80L (Qiagen). We confirmed that the insert regions of pQE/Ec, pQE/Ta, and pQE/Pa are the same as the sequences previously published (GenBank™ accession numbers Q47012, NP_394611, and NP_560582, respectively). Construction of Expression Plasmids for T. maritima 3′ tRNase Variants—Based upon pQE/Tm(WT), we constructed its 15 derivatives to express in E. coli 15 different T. maritima 3′ tRNase variants: pQE/Tm(D25A) for the enzyme containing a D25A substitution, pQE/Tm-(G27A) for the enzyme containing a G27A substitution, pQE/Tm(V30T) for the enzyme containing a V30T substitution, pQE/Tm(S31Q) for the enzyme containing a S31Q substitution, pQE/Tm(T33Q) for the enzyme containing a T33Q substitution, pQE/Tm(V38A) for the enzyme containing a V38A substitution, pQE/Tm(H48A) for the enzyme containing a H48A substitution, pQE/Tm(G49L) for the enzyme containing a G49L substitution, pQE/Tm(H50A) for the enzyme containing a H50A substitution, pQE/Tm(V51G) for the enzyme containing a V51G substitution, pQE/Tm(D52A) for the enzyme containing a D52A substitution, pQE/Tm(H53A) for the enzyme containing a H53A substitution, pQE/Tm(A55L) for the enzyme containing an A55L substitution, pQE/Tm-(G49L/V51G) for the enzyme containing G49L and V51G substitutions, and pQE/Tm(43LTR44) for the enzyme containing LTR insertions between residues 43 and 44. These pQE/Tm(WT) derivatives were generated by site-directed mutagenesis by overlap extension using PCR (13Takaku H. Minagawa A. Takagi M. Nashimoto M. Nucleic Acids Res. 2003; 31: 2272-2278Crossref PubMed Scopus (152) Google Scholar, 20Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6850) Google Scholar, 21Nashimoto M. Nashimoto C. Tamura M. Kaspar R.L. Ochi K. J. Mol. Biol. 2001; 312: 975-984Crossref PubMed Scopus (17) Google Scholar) and by the conventional DNA recombination technique with DNA restriction enzymes and DNA ligase. The primer pairs used for the mutagenesis are listed in Table II. We confirmed that the insert sequences are changed correctly by DNA sequencing. Expression and Purification of Recombinant Proteins—E. coli strain DH5α that harbors a pQE expression plasmid derivative (Qiagen) for prokaryotic 3′ tRNase was incubated at 37 °C in a 250-ml LB medium containing 50 μg/ml ampicillin until the A600 of the culture reached 0.6. At this point, the histidine-tagged protein was induced by adding 0.1 mm isopropyl-β-d-thiogalactopyranoside. After further incubation at 37 °C for 1 h, the cells were harvested by centrifugation. Cell pellets were resuspended in a 10-ml lysis buffer (50 mm Tris-HCl, pH 8.0, 100 mm NaCl, 5% glycerol, 5 mm β-mercaptoethanol) containing 1 mm imidazole. The cells were sonicated and centrifuged at 9500 × g for 30 min. The cleared lysate was incubated with 0.2-ml nickel-agarose beads at 4 °C for 1 h. After exhaustive washing, the retained proteins were eluted from the beads with 1 ml of the lysis buffer containing 200 mm imidazole. All of the purification steps were carried out at 4 °C. Pre-tRNA Synthesis—The pre-tRNAs were synthesized in vitro with T7 RNA polymerase (Takara Shuzo) from the synthetic pre-tDNAs containing its promoter. The transcription reactions were carried out in the presence or absence of [α-32P]UTP (Amersham Biosciences) under the conditions recommended by the manufacturer (Takara Shuzo), and the transcribed pre-tRNAs were gel-purified. The unlabeled pre-tRNAs were subsequently labeled with fluorescein according to the manufacturer's protocol (Amersham Biosciences). Briefly, after the removal of the 5′-phosphates of the transcripts with bacterial alkaline phosphatase (Takara Shuzo), the transcripts were phosphorylated with ATPγS using T4 polynucleotide kinase (Takara Shuzo). Then a single fluorescein moiety was appended onto the 5′-phosphorothioate site. The resulting pre-tRNAs with fluorescein were gel-purified before assays. In Vitro tRNA 3′ Processing Assay—The 3′ processing reactions for 32P-labeled or fluorescein-labeled pre-tRNA were performed with 3′ tRNases of various origins in a mixture (6 μl) containing 10 mm Tris-HCl (pH 8), 1.5 mm dithiothreitol, 25 mm NaCl, and 10 mm MgCl2 (or 0.2 mm MnCl2 in kinetic assays) at 60 °C. The assays for 3′ tRNases from other species than T. maritima were carried out at 50 °C. After resolution of the reaction products on a 10% polyacrylamide-8 m urea gel, the gel was autoradiographed using an intensifying screen at -80 °C, or analyzed with a Typhoon 9210 (Amersham Biosciences). RNA Sequencing—Unlabeled pre-tRNA (2 pmol) was reacted with T. maritima 3′ tRNase (50 ng) under the standard assay conditions at 60 °C for 10 min, extracted with phenol/chloroform, and precipitated with ethanol. The reaction products dissolved in water were 3′-end-labeled with T4 ligase (Takara Shuzo) and [5′-32P]pCp (Amersham Biosciences) at 4 °C for 10 h. The 5′ cleavage product was gel-purified, and its 3′-terminal sequence was determined by the chemical RNA sequencing method (22Peattie D.A. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 1760-1764Crossref PubMed Scopus (841) Google Scholar). The gel was autoradiographed using an intensifying screen at -80 °C. T. maritima 3′ tRNase Cleaves Pre-tRNAs after CCA—First of all, we chemically synthesized DNA fragments to produce the double-stranded DNA encoding T. maritima 3′ tRNase (GenBank™ accession number NP_228673), in which the codons are optimized for translation in E. coli. The full-length DNA for 3′ tRNase (data not shown) was created by PCR using proof-readable DNA polymerase and cloned into the expression vector pQE-80L. The resulting plasmid pQE/Tm(WT), which is designed to produce 3′ tRNase containing N-terminal histidines, was introduced into E. coli DH5α cells. The enzyme was overexpressed in the cells and purified with nickel-agarose. We examined the recombinant 3′ tRNase for in vitro processing of arginine, methionine, and phenylalanine pre-tRNAs from T. maritima, which contain both 5′ leader and 3′ trailer (Fig. 1A). Uniformly 32P-labeled pre-tRNAs were synthesized in vitro with T7 RNA polymerase from the synthetic tDNA templates. T. maritima 3′ tRNase cleaved pre-tRNAArg(CCA), pre-tRNAMet(CCA), and pre-tRNAPhe(CCA) endonucleolytically (Fig. 1B). To determine the exact cleavage site, we performed the 3′ tRNase cleavage reactions for unlabeled pre-tRNAs and subsequently 3′-end-labeled the products with [5′-32P]pCp. Each 5′ cleavage product was subjected to chemical RNA sequencing. Surprisingly, the T. maritima enzyme cleaved off 3′ trailers precisely after the CCA residues in all three pre-tRNAs (Fig. 1C). Nucleotides at 75 and 76 Determine the Cleavage Site—To elucidate which nucleotides are the determinant for the cleavage after CCA, we tested for cleavage the three pre-tRNAPhe variants pre-tRNAPhe(UCA), pre-tRNAPhe(CUA), and pre-tRNAPhe(CCG), which contain UCA, CUA, and CCG, respectively, instead of CCA. These variants were also processed by T. maritima 3′ tRNase with the exception of pre-tRNAPhe(CCG) (Fig. 2A). Each cleavage site was determined as above. Interestingly, the cleavage site was shifted to 1-nt upstream in pre-tRNAPhe(CUA), whereas the cleavage site of pre-tRNAPhe-(UCA) was not changed. Furthermore, three variants, pre-tRNAArg(CCG), pret-RNAArg(GUG), and pre-tRNAMet(CCG), were examined. Pre-tRNAArg(CCG) and pre-tRNAArg(GUG) were cleaved after nt 75, whereas cleavage of pre-tRNAMet(CCG) was not detected (Fig. 2B). These results suggest that the CA residues at nt 75 and 76 are required for T. maritima 3′ tRNase to cleave pre-tRNAs precisely after A at nt 76 and that otherwise the cleavage occurs after nt 75. Cleavage of Pre-tRNAMet(UAG) after the Discriminator—We also tested for 3′ tRNase cleavage another pre-tRNAMet(UAG) that is the only pre-tRNA without the encoded CCA. Intriguingly, this exceptional pre-tRNA was cleaved after the discriminator (Fig. 3). This makes sense because pre-tRNAs without the CCA termini need to be cleaved after the discriminator at nt 73, to which tRNA nucleotidyltransferase adds the CCA residues, like eukaryotic pre-tRNAs. The reason why only pre-tRNAMet(UAG) among the other pre-tRNAs tested was cleaved after the discriminator may be because this pre-tRNA contains CCA residues at nt 71-73. T. maritima 3′ tRNase may be able to recognize these CCA residues as the cleavage site determinant as discussed below. A CCA Binding Domain in T. maritima 3′ tRNase—The T. maritima enzyme shows its highest activity in 100 mm NaCl at pH 9 at 60 °C in the presence of 10 mm MgCl2 or 0.5 mm MnCl2 (data not shown). The kinetic parameters Km and kcat for pre-tRNAArg(CCA) and pre-tRNAArg(GUG) were determined in the presence of MgCl2 or MnCl2 (Table III). The Km values for pre-tRNAArg(CCA) in the presence of MgCl2 and MnCl2 were 0.3- and 0.4-fold, respectively, smaller than those for pre-tRNAArg(GUG). This suggests that a specific domain for CCA binding exists in the enzyme. On the other hand, the kcat values for pre-tRNAArg(CCA) were 0.4- and 0.6-fold, respectively, smaller than those for pre-tRNAArg(GUG). This may reflect slower release of the CCA-containing product following the chemical cleavage step. As a result, the cleavage efficiency values kcat/Km for pre-tRNAArg(CCA) were ∼1.4-fold as large as those for pre-tRNAArg(GUG) in both conditions.Table IIIKinetic parameters for pre-tRNA cleavage by T. maritima 3′ tRNaseSubstrateIonKmkcatkcat/Kmμmmin−1Pre-tRNAArg(CCA)Mg2+2.80.70.25Pre-tRNAArg(GUG)Mg2+10.61.80.17Pre-tRNAArg(CCA)Mn2+2.81.90.68Pre-tRNAArg(GUG)Mn2+6.53.10.48 Open table in a new tab Two Amino Acid Residues Critical for the Cleavage Site Selection—Next we investigated which amino acid residues are responsible for making T. maritima 3′ tRNase cleave after CCA. We assumed that such residues should be in well conserved regions and be different from residues in the other enzymes that cleave after the discriminator. We selected six residues to be examined; i.e. Val-30, Ser-31, Thr-33, Gly-49, Val-51, and Ala-55 (Fig. 4A). Expression plasmids for single or double amino acid-substituted variants, Tm(V30T), Tm(S31Q), Tm(T33Q), Tm(G49L), Tm(V51G), Tm(G49L/V51G), and Tm(A55L), were constructed by site-directed mutagenesis with PCR based on pQE/Tm(WT). The 3′ tRNase variants were overexpressed in E. coli and purified as histidine-tagged proteins (Fig. 4B). These recombinant enzymes were tested for cleavage of pre-tRNAArg(CCA) and pre-tRNAArg(GUG), which were 5′-end-labeled with fluorescein. The reaction products were analyzed on a sequencing gel with an alkaline ladder to determine the cleavage sites. We found that the wild-type enzyme can cleave pre-tRNAArg(CCA) at the additional minor site between nt 75 and 76 (Fig. 5A). The ratio of the minor to major products increased with the reaction time (data not shown), suggesting that this additional product is generated by the second cut of the original product and is an in vitro artifact. All the above variants cleaved both pre-tRNAs, although the cleavage efficiency varied (Fig. 5, A and B). Among these variants, only Tm(S31Q) clearly changed the cleavage sites. In pre-tRNAArg(CCA), the major cleavage site was shifted to 2-nt downstream, and some portion of the molecules were cleaved after the discriminator. In pre-tRNAArg(GUG), about a half of the molecules were cleaved 1-nt downstream. With respect to Tm(T33Q), the cleavage of pre-tRNAArg(CCA) after nt 75 was more dominant than that after nt 76. In addition, the cleavage was also detected after nt 74. Pre-tRNAArg(GUG) was cleaved slightly after nt 74 as well as after nt 75. These results suggest that Ser-31 is a critical residue for selecting the cleavage site and that Thr-33 is also involved in the site selection. These results also predict that, if 3′ tRNases contain glutamines at the positions corresponding to residues 31 and 33, the enzymes would cleave pre-tRNAs after the discriminator. Indeed, ELAC1-type short 3′ tRNases so far characterized have the corresponding two glutamines with the exception of the Arabidopsis thaliana enzyme, which contains a histidine and an alanine instead of glutamines (Fig. 4A). This exceptional case may be due to the lack of eight residues before the histidine motif. Because three amino acids are missing in between residues 43 and 44 of T. maritima 3′ tRNase compared with the other enzymes that cleave after the discriminator, we also thought that this difference could be partly responsible for the differential cleavage site selection. We tested the variant Tm(43LTR44), which contains three additional residues, LTR, in between Tyr-43 and Val-44, but no cleavage was observed (Fig. 5, A and B). Additionally, a variant, Tm(V38A), that contains a single amino acid substitution in a non-conserved region, was tested as a control. As expected, it cleaved both pre-tRNAsArg, but cleavage sites were not shifted (Fig. 5, A and B). Essential Residues for the Catalysis—We also examined how substitutions of conserved amino acids affect the cleavage by 3′tRNase. Tm(H48A), Tm(H50A), and Tm(H53A), in which the histidines in the histidine motif were substituted with alanines, were found not to cleave both pre-tRNAsArg at all (Fig. 5, A and B). Likewise, Tm(D25A) and Tm(D52A) did not process both substrates. In contrast, cleavages by Tm(G27A) were observed at the original sites like the wild-type enzyme. These results suggest that the three histidines and one aspartate in the histidine motif and the aspartate at residue 25 are essential components for the catalysis. Furthermore, it should be noted that the percent cleavage by Tm(G49L) and Tm(G49L/V51G) decreased significantly (Fig. 5), suggesting that the glycine at residue 49 in the histidine motif is important for the T. maritima 3′ tRNase activity. Cleavage Site Selection by Other Prokaryotic 3′ tRNases—To corroborate the above notion on the cleavage site selection, we investigated properties of 3′ tRNases from another eubacteria E. coli and two archaea T. acidophilum and P. aerophilum (Fig. 4A). These enzymes were purified as histidine-tagged proteins (Fig. 6A), and assayed for in vitro tRNA 3′ processing of T. maritima pre-tRNAArg(CCA), pre-tRNAArg(GUG), and human pre-tRNAArg(GUG). The E. coli enzyme cleaved human pre-tRNAArg(GUG) primarily after the discriminator (Fig. 6D). This is consistent with the notion that the two glutamines are critical determinants for the cleavage after the discriminator (Fig. 4A). The T. maritima pre-tRNAArg(CCA) and pre-tRNAArg(GUG) were not substrates for this enzyme (Fig. 6, B and C). The T. acidophilum enzyme, which has two glutamines as the site selection residues, cleaved human pre-tRNAArg(GUG) after the discriminator and after G at nt 74 (Fig. 6D). Although T. maritima pre-tRNAArg(CCA) was not a substrate, T. maritima pre-tRNAArg-(GUG) was cleaved after G at nt 74 (Fig. 6, B and C). 3′ tRNase from P. aerophilum, which contains an arginine at 33 (in the numbering system of T. maritima 3′ tRNase) instead of the second glutamine (Fig. 4A), processed only T. maritima pre-tRNAArg(CCA), and the cleavage site was after C at nt 75 (Fig. 6B). On the whole, these results agree with the notion as to the cleavage site selection. The Role of 3′ tRNase in T. maritima Cells—To the best of our knowledge, T. maritima 3′ tRNase is the only endoribonuclease so far identified that can cleave pre-tRNAs after CCA. We showed that this enzyme can cleave three T. maritima pre-tRNAs, pre-tRNAArg(CCA), pre-tRNAMet(CCA), and pre-tRNAPhe(CCA), after the CCA residues. This implies that the enzyme can also cleave the other 42 CCA-containing pre-tRNAs after CCA. The exceptional pre-tRNAMet(UAG) was shown to be processed at the discriminator site, and the resulting pre-tRNA would be a good substrate for the CCA-adding enzyme. Thus, in theory, the CCA termini of all 46 T. maritima tRNAs should be able to be generated by these two enzymes. This consideration suggests that T. maritima cells probably utilize this novel mechanism to generate the CCA 3′-termini of tRNA molecules. RNase II and polynucleotide phosphorylase may be involved in shortening of long 3′ trailers in the same fashion as E. coli (23Li Z. Deutscher M.P. RNA (N. Y.). 2002; 8: 97-109Crossref PubMed Scopus (166) Google Scholar). T. maritima 3′ tRNase processed pre-tRNAs both with and without 7-nt 5′ leaders (Figs. 1 and 6D) like the mammalian enzyme (24Nashimoto M. Wesemann D.R. Geary S. Tamura M. Kaspar R.L. Nucleic Acids Res. 1999; 27: 2770-2776Crossref PubMed Scopus (31) Google Scholar). Although we have currently no information about how long the cellular 5′ leaders are, if they are less than 7 nt, T. maritima 3′ tRNase would cleave off 3′ trailers regardless of 5′ processing by RNase P (25Paul R. Lazarev D. Altman S. Nucleic Acids Res. 2001; 29: 880-885Crossref PubMed Scopus (20) Google Scholar). Possible Conformational Change of Pre-tRNAMet(UAG)—The reason why the pre-tRNAMet(UAG) containing UAG instead of CCA at nt 74-76 was cleaved after the discriminator by T. maritima 3′ tRNase (Fig. 3B) may be because the enzyme can recognize the CCA residues at nt 71-73 as the cleavage site determinant in some way. One possible mechanism is that the enzyme would recognize an alternative conformation of the pre-tRNAMet(UAG), in which the CCA residues at nt 71-73 protrude from the acceptor stem and G at nt 70 shifts to the discriminator position (Fig. 3A). The T. maritima enzyme would recognize this form of the pre-tRNAMet(UAG) containing a distorted T-stem-loop in the same fashion as normal CCA-containing pre-tRNAs and would cleave it after A at nt 73. This supposition needs to be tested by examining pre-tRNA variants containing base substitutions that affect the stability of each conformer for 3′ tRNase cleavage and structure probing. The Interactions of T. maritima 3′ tRNase with Pre-tRNAs—The crystal structure of Bacillus cereus β-lactamase suggested that the histidine motif forms a part of the active site (26Carfi A. Pares S. Duee E. Galleni M. Duez C. Frere J.M. Dideberg O. EMBO J. 1995; 14: 4914-4921Crossref PubMed Scopus (404) Google Scholar). Consistently, our data suggest that the histidine motif in T. maritima 3′ tRNase forms an essential part of the catalytic core and that especially the three histidines and one aspartate play a central role for the catalysis. Pig 3′ tRNase clearly discriminates the nucleotide C from the others at nt 74 (8Nashimoto M. Nucleic Acids Res. 1997; 25: 1148-1155Crossref PubMed Scopus (73) Google Scholar, 11Mohan A. Whyte S. Wang X. Nashimoto M. Levinger L. RNA (N. Y.). 1999; 5: 245-256Crossref PubMed Scopus (54) Google Scholar). In addition, the very short 3′ trailers 74CC75, 74CCA76, and 74CCA76 plus one or two additional 3′ nt can be distinguished by this enzyme from the other trailers, suggesting that the pig enzyme has a binding domain for the CCA residues. From the present kinetics data (Table III), a CCA binding domain also appears to exist in the T. maritima enzyme. Whether 3′ tRNase cleaves pre-tRNAs after the discriminator or after the CCA residues may be determined by the relative position between the catalytic core and the CCA-binding domain. The amino acid residues at 31 and 33 (in the numbering system of T. maritima 3′ tRNase) appear to be critical for this positioning. When these two residues are glutamines, the active site may be located in the vicinity of the first C binding site, and the cleavage may occur after the discriminator. When the residues are other amino acids such as serine and threonine than glutamine, the catalytic site may be positioned near the A binding site, and pre-tRNAs may be cleaved after CCA. The hydroxyl groups of the serine and threonine residues may be critical for this positioning. Human ELAC2-type long 3′ tRNase, which has a phenylalanine and a glutamine at the corresponding sites, cleaves pre-tRNAs after the discriminator, and Saccharomyces cerevisiae ELAC2-type long 3′ tRNase, which contains a leucine and a threonine at the corresponding sites, also cleaves pre-tRNAs after the discriminator (13Takaku H. Minagawa A. Takagi M. Nashimoto M. Nucleic Acids Res. 2003; 31: 2272-2278Crossref PubMed Scopus (152) Google Scholar, 27Tavtigian S.V. Simard J. Teng D.H. Abtin V. Baumgard M. Beck A. Camp N.J. Carillo A.R. Chen Y. Dayananth P. Desrochers M. Dumont M. Farnham J.M. Frank D. Frye C. Ghaffari S. Gupte J.S. Hu R. Iliev D. Janecki T. Kort E.N. Laity K.E. Leavitt A. Leblanc G. McArthur-Morrison J. Pederson A. Penn B. Peterson K.T. Reid J.E. Richards S. Schroeder M. Smith R. Snyder S.C. Swedlund B. Swensen J. Thomas A. Tranchant M. Woodland A.M. Labrie F. Skolnick M.H. Neuhausen S. Rommens J. Cannon-Albright L.A. Nat. Genet. 2001; 27: 172-180Crossref PubMed Scopus (477) Google Scholar). Compared with ELAC1-type short 3′ tRNases, the human and yeast long 3′ tRNases contain 5 and 6 more residues, respectively, between the site selection residues and the histidine motif, and the yeast enzyme also has several additional residues before the site selection residues (27Tavtigian S.V. Simard J. Teng D.H. Abtin V. Baumgard M. Beck A. Camp N.J. Carillo A.R. Chen Y. Dayananth P. Desrochers M. Dumont M. Farnham J.M. Frank D. Frye C. Ghaffari S. Gupte J.S. Hu R. Iliev D. Janecki T. Kort E.N. Laity K.E. Leavitt A. Leblanc G. McArthur-Morrison J. Pederson A. Penn B. Peterson K.T. Reid J.E. Richards S. Schroeder M. Smith R. Snyder S.C. Swedlund B. Swensen J. Thomas A. Tranchant M. Woodland A.M. Labrie F. Skolnick M.H. Neuhausen S. Rommens J. Cannon-Albright L.A. Nat. Genet. 2001; 27: 172-180Crossref PubMed Scopus (477) Google Scholar). This could be the reason why the selection rule for short 3′ tRNases does not seem to hold in long 3′ tRNases. Cleavage of pre-tRNAs containing bases other than CA at nt 75 and 76 occurs after nt 75 (Fig. 2). This may be because these bases do not fit the CCA-binding domain well, and the catalytic core cannot be placed properly. Non- or inefficient cleavage of the CCG-containing pre-tRNAs (Fig. 2) may be attributed to somehow unfavorable interaction with the CCA-binding domain. Discrimination of Pre-tRNA Species by Prokaryotic 3′ tRNases and Their Roles in the Cells—The four prokaryotic 3′ tRNases tested here differed in substrate specificities and cleavage sites. If we can find out a rule to discriminate pre-tRNA substrates, this would become a clue to elucidation of the physiological roles of each enzyme in the cells. E. coli 3′ tRNase cleaved only human pre-tRNAArg(GUG) after the discriminator (Fig. 6). The property that this enzyme cannot cleave T. maritima pre-tRNAArg(CCA) makes sense, because removal of the CCA residues would be wasteful. The physiological roles of 3′ tRNase in E. coli cells are not clear, because the exoribonucleases are sufficient for tRNA 3′ processing. This gene thus might have been preserved for a backup system in case of occasional mutagenesis in the CCA-coding regions. Alternatively, this enzyme may be utilized to process other RNA substrates, including T4 bacteriophage pre-tRNAs that lack the CCA residues (28Deutscher M.P. Foulds J. McClain W.H. J. Biol. Chem. 1974; 249: 6696-6699Abstract Full Text PDF PubMed Google Scholar). We could not explain why T. maritima pre-tRNAArg(GUG) was not cleaved. This is not due to the presence of the 5′ leader, because human pre-tRNAArg(GUG) with a 7-nt 5′ leader was processed as efficiently as human pre-tRNAArg(GUG) without the leader (data not shown). In good contrast to the T. maritima genome, the CCA sequences are not encoded in all 45 tRNA genes in the T. acidophilum genome with one exception (29Ruepp A. Graml W. Santos-Martinez M.L. Koretke K.K. Volker C. Mewes H.W. Frishman D. Stocker S. Lupas A.N. Baumeister W. Nature. 2000; 407: 508-513Crossref PubMed Scopus (345) Google Scholar). The cellular pre-tRNAs would probably be 3′-processed by 3′ tRNase, although the cleavage site could vary from after nt 74 to after the discriminator depending on pre-tRNA species, judging from our in vitro data. Because T. maritima pre-tRNAArg(CCA) was not cleaved by T. acidophilum 3′ tRNase, the exceptional CCA-containing pre-tRNA would be 3′-processed by RNase PH, which is encoded in the genome as the only RNase orthologue among the six E. coli enzymes. Although the P. aerophilum genome (30Fitz-Gibbon S.T. Ladner H. Kim U.J. Stetter K.O. Simon M.I. Miller J.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 984-989Crossref PubMed Scopus (197) Google Scholar) contains 19 CCA-coding and 27 non-CCA-coding tRNA genes, P. aerophilum 3′ tRNase cleaved only the CCA-containing pre-tRNAArg in vitro (Fig. 6). Thus, the 19 pre-tRNAs with CCA would be processed by either 3′ tRNase or RNase PH, which is encoded in the genome as the only RNase orthologue among the six exoribonucleases. With respect to the other 27 pre-tRNAs, RNase PH could trim 3′ trailers up to the discriminator, or other unidentified RNases could be involved. This case contrasts sharply with the Bacillus subtilis case, where the genome has ∼73% CCA-coding tRNA genes, and B. subtilis 3′ tRNase cleaves only CCA-less pre-tRNAs (31Pellegrini O. Nezzar J. Marchfelder A. Putzer H. Condon C. EMBO J. 2003; 22: 4534-4543Crossref PubMed Scopus (114) Google Scholar). Evolution of the Mechanism to Generate the CCA 3′ Termini—The above consideration implies that the mechanism for 3′ tRNase to select substrates and cleavage sites must have co-evolved with the gain or loss of exoribonuclease genes and the CCA sequence encoded in tRNA genes and would currently be used properly depending on the presence or absence of CCA in pre-tRNAs. Curiously, the T. maritima CCA-adding enzyme groups with A-adding enzymes, not with CCA-adding enzymes or with CC-adding enzymes (32Tomita K. Weiner A.M. J. Biol. Chem. 2002; 277: 48192-48198Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). The presence of the two unusual enzymes 3′ tRNase and CCA-adding enzyme involved in the 3′-terminal CCA generation suggests that T. maritima has evolved very uniquely. We thank M. Takeda for technical assistance.
Referência(s)