The Caenorhabditis elegans CPI-2a Cystatin-like Inhibitor Has an Essential Regulatory Role during Oogenesis and Fertilization
2006; Elsevier BV; Volume: 281; Issue: 38 Linguagem: Inglês
10.1074/jbc.m600254200
ISSN1083-351X
AutoresSarwar Hashmi, Jun Zhang, Yelena Oksov, Qiongmei Ji, Sara Lustigman,
Tópico(s)Reproductive Biology and Fertility
ResumoIn the present study, we characterized a sterile cpi-2a(ok1256) deletion mutant in Caenorhabditis elegans and showed that CPI-2a has an essential regulatory role during oogenesis and fertilization. We have also shown that the CPI2a inhibitor and both Ce-CPL-1 and Ce-CPZ-1 enzymes are present in the myoepithelial sheath surrounding germ cells, oocytes, and embryos as well as in the yolk granules within normal oocytes. Staining of mutant worms with anti-yolk protein antibodies has indicted that the proteins are not present in the mature oocytes. Moreover, green fluorescent protein expression was absence or reduced in cpi-2a/yp170:gfp mutant oocytes, although it was expressed in one of the successfully developed embryos. Based on these results, we hypothesize that the sterility in cpi-2a(ok1256) mutant worms is potentially caused by two possible mechanisms: 1) defects in the uptake and/or processing of yolk proteins by the growing oocytes and 2) indirect induction of defects in cell-cell signaling that is critical for promoting germ line development, oocyte maturation, ovulation, and fertilization. A defect in any of these processes would have detrimental effects on the development of normal embryos and consequently normal production of progenies as we observed in cpi-2a mutant worms. This is the first study that demonstrates the expression of cysteine proteases and their endogenous inhibitor in the gonadal sheath cells surrounding germ cells and oocytes, which indirectly have established their potential involvement in proteolytic processing of molecules within the gonadal sheath cells, such as components of the extracellular matrix or the cytoskeletal proteins, which are essential for proper cell-cell signaling activities of the gonadal sheath cells during normal maturation and ovulation processes. In the present study, we characterized a sterile cpi-2a(ok1256) deletion mutant in Caenorhabditis elegans and showed that CPI-2a has an essential regulatory role during oogenesis and fertilization. We have also shown that the CPI2a inhibitor and both Ce-CPL-1 and Ce-CPZ-1 enzymes are present in the myoepithelial sheath surrounding germ cells, oocytes, and embryos as well as in the yolk granules within normal oocytes. Staining of mutant worms with anti-yolk protein antibodies has indicted that the proteins are not present in the mature oocytes. Moreover, green fluorescent protein expression was absence or reduced in cpi-2a/yp170:gfp mutant oocytes, although it was expressed in one of the successfully developed embryos. Based on these results, we hypothesize that the sterility in cpi-2a(ok1256) mutant worms is potentially caused by two possible mechanisms: 1) defects in the uptake and/or processing of yolk proteins by the growing oocytes and 2) indirect induction of defects in cell-cell signaling that is critical for promoting germ line development, oocyte maturation, ovulation, and fertilization. A defect in any of these processes would have detrimental effects on the development of normal embryos and consequently normal production of progenies as we observed in cpi-2a mutant worms. This is the first study that demonstrates the expression of cysteine proteases and their endogenous inhibitor in the gonadal sheath cells surrounding germ cells and oocytes, which indirectly have established their potential involvement in proteolytic processing of molecules within the gonadal sheath cells, such as components of the extracellular matrix or the cytoskeletal proteins, which are essential for proper cell-cell signaling activities of the gonadal sheath cells during normal maturation and ovulation processes. Cystatins are endogenous cysteine protease inhibitors that have received a good deal of attention because of their potential regulatory functions. Cysteine proteases are an important group of proteolytic enzymes that have traditionally been viewed as lysosomal mediators of terminal protein degradation but more recently have been found to have a more expanded role in cellular physiology. These roles appear to include apoptosis, major histocompatibility complex class II immune responses, prohormone processing, and extracellular matrix remodeling important to bone development (1Coulibaly S. Schwihla H. Abrahamson M. Albini A. Cerni C. Clark J.L. Ng K.M. Katunuma N. Schlappack O. Glossl J. Mach L. Int. J. Cancer. 1999; 83: 526531Crossref Scopus (90) Google Scholar, 2***Barrett A.J. Kirschke H. Methods Enzymol. 1981; 80: 535-561Crossref PubMed Scopus (1726) Google Scholar, 3***Orlowski M. Mol. Cell. Biochem. 1983; 52: 49-74Crossref PubMed Scopus (31) Google Scholar, 4***Tepel C. Bromme D. Herzog V. Brix K. J. Cell Sci. 2000; 113: 4487-4498Crossref PubMed Google Scholar, 5Chapman H.A. Riese R.J. Shi G.P. Annu. Rev. Physiol. 1997; 59: 63-88Crossref PubMed Scopus (684) Google Scholar, 6Saftig P. Hunziker E. Everts V. Jones S. Boyde A. Wehmeyer O. Suter A. von Figura K. Adv. Exp. Med. Biol. 2000; 477: 293-303Crossref PubMed Google Scholar). The cysteine proteases, cathepsin B, L, and H, as well as the aspartic protease cathepsin D have been shown to be essential enzymes required for the proteolytic processing of the vitellogenin into yolk proteins during oogenesis (7Kwon J.Y. Prat F. Randall C. Tyler C.R. Biol. Reprod. 2001; 65: 1701-1709Crossref PubMed Scopus (122) Google Scholar) and embryonic development in many organisms (8Cho W.L. Tsao S.M. Hays A.R. Walter R. Chen J.S. Snigirevskaya E.S. Raikhel A.S. J. Biol. Chem. 1999; 274: 13311-13321Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar, 9Ribolla P.E.M. Daffre S. Bianchi A.G.D. Insect Biochem. Mol. Biol. 1993; 23: 217-223Crossref Scopus (38) Google Scholar, 10Takahashi S.Y. Yamamoto Y. Shionoya Y. Kageyama T. J. Biochem. (Tokyo). 1993; 114: 267-272Crossref PubMed Scopus (58) Google Scholar). In a mouse model, cathepsin B and L have been shown to be required for normal embryo development and uterine decidualization, and the deciduas, which is a transient tissue that develops in the uterine chamber of the mouse and known to secret enzyme inhibitors, contributes to the control of the cysteine proteases by a coordinated expression of cystatin C during mouse implantation (11Afonso S. Romagnano L. Babiarz B. Development. 1997; 124: 3415-3425Crossref PubMed Google Scholar); the cystatin C message and protein levels are regulated in a specific spatial and temporal pattern that correlates with cathepsin B and L production. In addition, the perturbation of cysteine protease activity during early implantation caused abnormal embryo development and uterine decidualization. The human cystatin C is highly abundant in body fluids and has a role in many important physiological functions (12Abrahamson M. Methods Enzymol. 1994; 244: 685-700Crossref PubMed Scopus (182) Google Scholar, 13Abrahamson M. Barrett A.J. Salvesen G. Grubb A. J. Biol. Chem. 1986; 261: 11282-11289Abstract Full Text PDF PubMed Google Scholar). The physiological activities of the cathepsin-like cysteine proteases are controlled by their specific endogenous protein inhibitors. Any imbalance between the enzymes and their cystatin-like inhibitors can create in mammalian systems uncontrolled proteolysis seen in inflammatory disorders and during tumor growth (reviewed in Ref. 14Henskens Y.M. Veerman E.C. Nieuw Amerongen A.V. Biol. Chem. Hoppe Seyler. 1996; 377: 71-86Crossref PubMed Google Scholar). For example, the persistent phenotype of many metastatic cell types was shown to be associated with increased production of cathepsin-like enzymes and their abnormal regulation by cystatin C (15Lah T.T. Clifford J.L. Helmer K.M. Day N.A. Moin K. Honn K.V. Crissman J.D. Sloane B.F. Biochim. Biophys. Acta. 1989; 993: 63-73Crossref PubMed Scopus (71) Google Scholar, 16Sloane B.F. Rozhin J. Robinson D. Honn K.V. Biol. Chem. Hoppe Seyler. 1990; 371: 193-198PubMed Google Scholar, 17Chambers A.F. Tuck A.B. Crit. Rev. Oncog. 1993; 4: 95-114PubMed Google Scholar). The importance of cysteine proteases and their inhibitors to the normal development of embryos was demonstrated by treatment of pregnant female animals with the cysteine protease inhibitor, E-64, resulting in stunted embryos (18Alexander C.M. Hansell E.J. Behrendtsen O. Flannery M.L. Kishnani N.S. Hawkes S.P. Werb Z. Development. 1996; 122: 1723-1736Crossref PubMed Google Scholar). In rats, the in vitro perturbation of the yolk sac with E-64 or leupeptin, another specific cysteine protease inhibitor, resulted in decreased protein processing and embryo growth retardation (19Daston G.P. Baines D. Yonker J.E. Lehman-McKeeman L.D. Teratology. 1991; 43: 253-261Crossref PubMed Scopus (24) Google Scholar), suggesting that enzyme activity is required for normal breakdown of yolk proteins during embryogenesis (20Grubb J.D. Koszalk T.R. Drabick J.J. Metrione R.M. Placenta. 1991; 12: 143-151Crossref PubMed Scopus (19) Google Scholar). Based on size, location, and homology, the members of the cystatin superfamily are subdivided into the stefin family (type 1), cystatin family (type 2), and kininogen family (type 3) (21Barrett A.J. Fritz H. Grubb A. Isemura S. Jarvinen M. Katunuma N. Machleidt W. Muller-Esterl W. Sasaki M. Turk V. Biochem. J. 1986; 236: 312Crossref PubMed Scopus (277) Google Scholar), all composed of at least one 100-120-amino acid domain containing a highly conserved reactive site consisting of 5 amino acids, QXVXG (22Turk V. Bode W. FEBS Lett. 1991; 285: 213-219Crossref PubMed Scopus (718) Google Scholar, 23Rawlings N.D. Barrett A.J. J. Mol. Evol. 1990; 30: 60-71Crossref PubMed Scopus (268) Google Scholar, 24Abrahamson M. Ritonja A. Brown M.A. Grubb A. Machleidt W. Barrett A.J. J. Biol. Chem. 1987; 262: 9688-9694Abstract Full Text PDF PubMed Google Scholar). The type 2 cystatin, including cystatin C, D, S, SN, and SA, are tightly binding inhibitors of papain-like cysteine proteases such as cathepsin B, H, L, and S (12Abrahamson M. Methods Enzymol. 1994; 244: 685-700Crossref PubMed Scopus (182) Google Scholar, 24Abrahamson M. Ritonja A. Brown M.A. Grubb A. Machleidt W. Barrett A.J. J. Biol. Chem. 1987; 262: 9688-9694Abstract Full Text PDF PubMed Google Scholar, 25Barrett A.J. Davies M.E. Grubb A. Biochem. Biophys. Res. Commun. 1984; 120: 631-636Crossref PubMed Scopus (264) Google Scholar, 26Bromme D. Rinne R. Kirschke H. Biomed. Biochim. Acta. 1991; 50: 631-635PubMed Google Scholar). They are secreted proteins of ∼120 amino acid residues containing a single inhibitory domain. The best studied representatives of the cystatin family type 2 are the human cystatin C and the chicken cystatin (12Abrahamson M. Methods Enzymol. 1994; 244: 685-700Crossref PubMed Scopus (182) Google Scholar, 14Henskens Y.M. Veerman E.C. Nieuw Amerongen A.V. Biol. Chem. Hoppe Seyler. 1996; 377: 71-86Crossref PubMed Google Scholar, 22Turk V. Bode W. FEBS Lett. 1991; 285: 213-219Crossref PubMed Scopus (718) Google Scholar, 27Barrett A.J. Rawlings N.D. Davies M.E. Machleidt W. Salvesen G. Turk V. Barrett A.J. Salvesen G. Proteinase Inhibitors. Elsevier Science Publishers, Amsterdam1986: 515-569Google Scholar). Type 2 cystatin has been also identified and characterized in many parasites such as Trypanosoma cruzi, Trypanosoma congolense, and Trypanosoma brucei (28Stoka V. Nycander M. Lenarcic B. Labriola C. Cazzulo J.J. Bjork I. Turk V. FEBS Lett. 1995; 370: 101-104Crossref PubMed Scopus (86) Google Scholar, 29Troeberg L. Pike R.N. Morty R.E. Berry R.K. Coetzer T.H. Lonsdale-Eccles J.D. Eur. J. Biochem. 1996; 238: 728-736Crossref PubMed Scopus (83) Google Scholar, 30Chagas J.R. Authie E. Serveau C. Lalmanach G. Juliano L. Gauthier F. Mol. Biochem. Parasitol. 1997; 88: 85-94Crossref PubMed Scopus (40) Google Scholar), Brugia malayi (31Manoury B. Gregory W.F. Maizels R.M. Watts C. Curr. Biol. 2001; 11: 447451Abstract Full Text Full Text PDF Scopus (182) Google Scholar), Litomosoides sigmodontis (32Pfaff A.W. Schulz-Key H. Soboslay P.T. Taylor D.W. MacLennan K. Hoffmann W.H. Int. J. Parasitol. 2002; 32: 171-178Crossref PubMed Scopus (59) Google Scholar) Onchocerca volvulus (33Lustigman S. Brotman B. Huima T. Prince A.M. McKerrow J.H. J. Biol. Chem. 1992; 267: 17339-17346Abstract Full Text PDF PubMed Google Scholar), Hemonchus contortus (34Newlands G.F. Skuce P.J. Knox D.P. Smith W.D. Parasitology. 2001; 122: 371-378Crossref PubMed Scopus (62) Google Scholar), Acanthocheilonema viteae (35Hartmann S. Kyewski B. Sonnenburg B. Lucius R. Eur. J. Immunol. 1997; 27: 2253-2260Crossref PubMed Scopus (122) Google Scholar), and Schistosoma mansoni (36Morales F.C. Furtado D.R. Rumjanek F.D. Mol. Biochem. Parasitol. 2004; 134: 65-73Crossref PubMed Scopus (22) Google Scholar). The precise function of the cystatins in the parasites is mostly unknown, although Bm-CPI-2, a cystatin from B. malayi, was shown to suppress the host immune response by interfering in the processing of major histocompatibility complex class II-restricted antigen processing via direct inhibition of the human cathepsins S, L, and B (31Manoury B. Gregory W.F. Maizels R.M. Watts C. Curr. Biol. 2001; 11: 447451Abstract Full Text Full Text PDF Scopus (182) Google Scholar, 37Schierack P. Lucius R. Sonnenburg B. Schilling K. Hartmann S. Infect. Immun. 2003; 71: 2422-2429Crossref PubMed Scopus (102) Google Scholar). In the human parasitic O. volvulus nematode, two cystatin-like protease inhibitors encoded by Ov-cpi-1 and Ov-cpi-2 were identified. Based on its localization in the parasites during development in the host, the Ov-CPI-2 was proposed to play a role in the regulation of the endogenous parasite cysteine proteases during molting, cuticle and eggshell remodeling, and embryogenesis (38Lustigman S. Brotman B. Huima T. Prince A.M. Mol. Biochem. Parasitol. 1991; 45: 65-75Crossref PubMed Scopus (71) Google Scholar) The Ov-CPI-1 was identified in the O. volvulus EST 2The abbreviations used are: EST, expressed sequence tag; RNAi, RNA interference; GFP, green fluorescent protein; DAPI, 4′ ,6-diamidino-2-phenylindole; L1, first stage larvae; L2, second stage larvae; L3, third stage larvae; L4, fourth stage larvae.2The abbreviations used are: EST, expressed sequence tag; RNAi, RNA interference; GFP, green fluorescent protein; DAPI, 4′ ,6-diamidino-2-phenylindole; L1, first stage larvae; L2, second stage larvae; L3, third stage larvae; L4, fourth stage larvae. data base; however, its specific role during filarial development is still unknown. Recent studies have demonstrated that the O. volvulus cathepsin L (39Hashmi S. Britton C. Liu J. Guiliano D.B. Oksov Y. Lustigman S. J. Biol. Chem. 2002; 277: 3477-3486Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar) and cathepsin Z (40Lustigman S. McKerrow J.H. Shah K. Lui J. Huima T. Hough M. Brotman B. J. Biol. Chem. 1996; 271: 30181-30189Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) are localized in the same regions as Ov-CPI-2, implying that Ov-CPI-2 may regulate both enzymes during O. volvulus development. Moreover, using RNAi, we have shown that both enzymes are essential for third to fourth stage larva molting (41Lustigman S. Zhang J. Liu J. Oksov Y. Hashmi S. Mol. Biochem. Parasitol. 2004; 138: 165-170Crossref PubMed Scopus (136) Google Scholar). Using the Caenorhabditis elegans model, we have confirmed that the homologues of the filarial enzymes in C. elegans, Ce-cpz-1 and Ce-cpl-1, have essential roles not only during molting but also during embryogenesis (39Hashmi S. Britton C. Liu J. Guiliano D.B. Oksov Y. Lustigman S. J. Biol. Chem. 2002; 277: 3477-3486Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 42Hashmi S. Zhang J. Oksov Y. Lustigman S. J. Biol. Chem. 2004; 279: 6035-6045Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). In both O. volvulus and C. elegans, these enzymes may act as proteolytic enzymes processing and/or degrading cuticular proteins during molting and other proteins involved in embryogenesis (41Lustigman S. Zhang J. Liu J. Oksov Y. Hashmi S. Mol. Biochem. Parasitol. 2004; 138: 165-170Crossref PubMed Scopus (136) Google Scholar, 42Hashmi S. Zhang J. Oksov Y. Lustigman S. J. Biol. Chem. 2004; 279: 6035-6045Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). The C. elegans CPL-1 enzyme was also shown to have a specific role in yolk protein processing (43Britton C. Murray L. J. Cell Sci. 2004; 117: 5133-5143Crossref PubMed Scopus (57) Google Scholar). The free living nematode, C. elegans, also expresses only two cystatin molecules, Ce-cpi-2a (R01B10.1) and Ce-cpi-1 (K08B4.6). The two cystatins have a considerable level of sequence homology to B. malayi, L. sigmodontis, A. viteae, and O. volvulus cystatin inhibitors (44Lustigman S. James E.R. Tawe W. Abraham D. Trends Parasitol. 2002; 18: 135-141Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Biochemical analysis of the inhibitory activity of Ce-CPI-2a and Ce-CPI-1 have shown that although both inhibit the human cathepsin B, L, and S with Ki values ranging from 0.0143 to 33.88, both inhibitors have distinct interactions with each enzyme based on the differing Ki values with each of the enzymes (37Schierack P. Lucius R. Sonnenburg B. Schilling K. Hartmann S. Infect. Immun. 2003; 71: 2422-2429Crossref PubMed Scopus (102) Google Scholar). Our preliminary data indicated that the cpi-2a and cpi-1 genes are expressed differentially during C. elegans development, which suggests that they have distinctive regulatory roles through their interaction with their individual target enzymes and potentially in discrete processes. In this study, we have used the C. elegans model to provide direct evidence of the functional role(s) of the C. elegans cpi-2a during worm development and show that its role during C. elegans reproduction is essential. The function of Ce-CPI-2a during development is potentially due to its putative interaction with both the Ce-CPL-1 and Ce-CPZ-1 cathepsin-like enzymes. Nematode Strains and Culture Conditions—All C. elegans strains used in this study were maintained and propagated at 20 °C on small Petri plates containing nematode growth medium and seeded with the Escherichia coli strain OP50 (48Brenner S. Genetics. 1974; 77: 71-94Crossref PubMed Google Scholar). The wild type strain N2 (Bristol) was received from the C. elegans Genetics Center (Minneapolis, MN) and was used to create the various transgenic strains. The C. elegans homozygous mutant cpi-2a allele (ok1256)V and cpi-1 allele (ok1213)IV strains as well as the DH1033 strain were also provided by the C. elegans Genetics Center. Stage-specific Profile of the Ce-cpi-2a mRNA Transcript Using Real Time PCR—A synchronous population of all developmental stages was prepared as described previously (42Hashmi S. Zhang J. Oksov Y. Lustigman S. J. Biol. Chem. 2004; 279: 6035-6045Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). First strand cDNA was generated from 1 μg of total RNA using the Omniscript RT kit (Qiagen, Valencia, CA) and priming with random hexamers. The specific cDNA fragment of Ce-cpi-2a was amplified using the forward (5′-CGTCTTCGCTCTCATTGCCATTTC-3′) and reverse (5′-GTAGTAGTAAGGTCCGTTGTTGGATGC-3′) primers. The copy number of each transcript was quantified by real time PCR using the QuantiTech™ SYBR Green PCR kit (Qiagen). The following PCR conditions were used: 50 °C for 2 min, 95 °C for 15 min, followed by 40 cycles of 94 °C for 15 s, 64 °C for 30 s, and 72 °C for 45 s. The copy number of the transcript within each of the stage-specific cDNA preparations and the standard curves for cpi-2a and ama-1 (α-amanitin-resistant gene) were drawn as described previously (42Hashmi S. Zhang J. Oksov Y. Lustigman S. J. Biol. Chem. 2004; 279: 6035-6045Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). The ama-1 gene, which encodes the large subunit of RNA polymerase II, was used as the control gene. The levels of ama-1 (45Johnstone I.L. Barry J.D. EMBO J. 1996; 15: 3633-3639Crossref PubMed Scopus (133) Google Scholar) are relatively constant during development and thus suitable for comparison of transcript levels between stages of the worm. Analysis of the Temporal and Spatial Expression Patterns of the cpi-2a Transgene—In order to investigate the cell specific and the temporally regulated expression of cpi-2a (Fig. 1A) in vivo, we created C. elegans transgenes using a cpi-2a:lacZ fusion reporter construct. The translational fusion construct for cpi-2a, designated (pSL112A) (Fig. 1B), contained a 900-bp promoter region upstream to the ATG and the 1.4-kb coding sequence consisting of all three exons of the Ce-cpi-2a and was generated by PCR from C. elegans genomic DNA. This PCR fragment of 2.3 kb was then cloned into the PCR 2.1 cloning vector (TOPO cloning kit; Invitrogen) before excision and subcloning into a C. elegans β-galactosidase (lacZ) reporter vector pPD90.23, which contains the nuclear localization signal motif. The C. elegans transgenes were created as described previously using the pRF4 as the selection marker (46Mello C.C. Kramer J.M. Stinchcomb D. Ambros V. EMBO J. 1991; 10: 3959-3970Crossref PubMed Scopus (2419) Google Scholar, 47Kramer J.M. French R.P. Park E.C. Johnson J.J. Mol. Cell Biol. 1990; 10: 2081-2089Crossref PubMed Scopus (262) Google Scholar). Third (F3) and subsequent generations of four transgenic lines exhibiting the roller phenotype were stained for β-galactosidase activity as previously described (42Hashmi S. Zhang J. Oksov Y. Lustigman S. J. Biol. Chem. 2004; 279: 6035-6045Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). Analyses of cpi-2a Mutant—To further our understanding of the role of cpi2a in C. elegans development, we obtained a deletion mutant, the cpi-2a(ok1256) allele, which has a deletion of 1801 bp that covers all three cpi-2a exons and the 3′-untranslated region, resulting in a complete removal of the coding sequences within the R01B10.1a gene. The mutant was backcrossed three times using wild type N2 (Bristol) strain males according to a standard protocol (48Brenner S. Genetics. 1974; 77: 71-94Crossref PubMed Google Scholar) and maintained as homozygous worms. The homozygous mutant allele was sequenced to confirm the deletion site using inner right sequence primer CCACAATTCCAATCCCAATC, corresponding to positions 1833-1813 bp in relation to the ATG start codon, and inner left sequence ATTTTCTGGCCAATTTCGTG, corresponding to positions -265 to -245 bp in relation to the ATG start codon in the cpi-2a gene. Individual homozygous mutant hermaphrodites were grown on plates at 20 °C, and their self-progeny were used in subsequent experiments. For morphological comparison between mutant and wild type strains, living animals were observed using Nomarski differential interference contrast (DIC) microscopy. Fertility and Brood Analyses—To measure fertility of the homozygous cpi-2a(ok1256) worms, individual hermaphrodites were placed onto nematode growth medium plates seeded with E. coli OP50, and the generation of viable progeny was observed. The worms were transferred to fresh nematode growth medium plates every 18-20 h, followed by counting the eggs and larvae for four consecutive days. If a hermaphrodite worm did not produce during a 5-day period any viable embryo or it produced a very low number of viable embryos (from 5 to 20), the worm was then classified as sterile. Rescue of the Sterile Phenotype Due to cpi-2a Mutation Using C. elegans Transgenic Strains—To rescue the cpi-2a mutation by complementation, several transgenic rescue constructs were created using a C. elegans expression vector (pPD95.75) without the gfp (Fig. 1): 1) the cpi-2a cDNA was placed under the control of its endogenous 900-bp promoter (Fig. 1C; pSL112C); 2) the cpi-1 cDNA was placed under the control of the Ce-cpi-2a 900-bp promoter (Fig. 1D; pSL151A); and 3) the genomic sequence encoding for the full-length cDNA of the R01B10.3 gene was placed under its own 900-bp promoter region (Fig. 1E; pSL149A). The rescue of the cpi-2a(ok1256) mutant strain with the full genomic sequence of R01b10.3 was designed to confirm that the phenotype due to deletion was only due to the knockdown of the cpi-2a transcript. The opposite strand of the genomic sequence of cpi2a (R01B10.1) encodes another gene, named R01B10.3 (α-amylase), which is 396-bp-long, is composed of three exons (Fig. 1F), and corresponds to the second intron of cpi-2a on the other strand. Transgenic lines for each rescue construct were created by the injection of each rescue plasmid DNA along with pRF4 into the gonad of C. elegans N2 strain as described above. The procedure to rescue deletion mutant worms using transgenic strains followed the procedures described by Janke et al. (49Janke D.L. Schein J.E. Ha T. Franz N.W. O'Neil N.J. Vatcher G.P. Stewart H.I. Kuervers L.M. Baillie D.L. Rose A.M. Genome Res. 1997; 7: 974-985Crossref PubMed Scopus (25) Google Scholar). In brief, heterozygous mutant males were created by crossing hermaphrodite cpi-2a(ok1256) mutant worms with wild type males; 15-20 individual transgenic hermaphrodites expressing the rescue gene were then crossed, each with 10-12 heterozygous mutant males. After 36 h of mating, the hermaphrodites were transferred individually to fresh plates and allowed to produce progeny. The F1 progeny was screened for males exhibiting the roller phenotype (rol-6). The presence of a roller phenotype in the progeny of the crossed worms was an indicator of the presence of the transgene within the worms and thus successful crossings. In addition, single worm PCR was performed on the roller worm to ensure that these worms contained the rescue gene. Twenty-five L4 roller hermaphrodites from a successful mating plate were individually picked and transferred to fresh plates to allow self-fertilization. For each transgene rescue experiment, the individual worms were of two possible genotypes: 1) cpi-2a(ok1256)/+; cpi-2a (Ex) or +/+; cpi-2a (Ex); 2) cpi-2a(ok1256)/+; cpi-1(Ex) or +/+; cpi-1 (Ex); or 3) cpi-2a(ok1256)/+; R01B10.3 (Ex) or +/+; R01B10.3 (Ex). The Ex designates extrachromosomal array for each rescue gene. The worms of both genotypes were screened for the presence of sterile or nonsterile animals over 4 days. If the worms produced 150 worms in 4 days, they were considered rescued successfully by the transgenic strain. The rescue was correlated with the presence or absence of the rescue genes as well as their genotype (the presence and absence of cpi-2a deletion) using PCR on single worms (fertile and nonfertile animals) with the corresponding gene-specific primers. The progenies of the heterozygous fertile or nonfertile roller worms were self-fertilized to obtain homozygous. We used single worm PCR on roller mother to confirm their genotype, and then the progenies of homozygous worms were tested for fertility by growing them individually on separate plates. The presence of fertility in cpi2a/cpi2a; cpi-2a (Ex) worms indicated that these worms were rescued. The continued presence of sterility in cpi2a/cpi2a; R01B10.3 (Ex) or cpi2a/cpi2a; cpi-1(Ex) indicated that both genes did not rescue the sterile phenotype of cpi-2a(ok1256). Co-localization by Immunofluorescence of the CPI-2a Cystatin Inhibitor with Two C. elegans Endogenous Cysteine Proteases, Ce-CPZ-1 and Ce-CPL-1—Rabbit anti-CPI-2a antibodies and mouse anti-CPL-1 or anti-CPZ-1 antibodies were used for the co-localization of their corresponding inhibitor and enzymes in C. elegans embryos, mixed larvae, and adult worms by immunofluorescence assays. The rabbit anti-Ce-CPI-2a antibodies were kindly provided by Susanne Hartman (Molecular Parasitology, Humboldt University, Berlin, Germany). Because the anti-CPI-2a antibodies cross-reacted with the Ce-CPI-1 recombinant protein (data not shown), we used the cpi-1(ok1213) mutant strain for staining with the anti-CPI-2a antibodies, which allowed the determination of the specific locations of the CPI-2a native protein. The Ce-cpi-1(ok1213) allele has a deletion of 1244 bp that covers 460 bp of the promoter region as well as the gene coding for exon 1, exon 2, and part of exon 3 within K08B4.6, thus not expressing any fragment of CPI-1 that could cross-react with the anti-CPI-2a antibodies. The Ce-cpi-1(ok1213) mutant strain does not have any obvious phenotypes, and its reproduction is normal. The procedures for sample preparation and staining were essentially the same as described previously for Ce-CPZ-1 and Ce-CPL-1 (39Hashmi S. Britton C. Liu J. Guiliano D.B. Oksov Y. Lustigman S. J. Biol. Chem. 2002; 277: 3477-3486Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 42Hashmi S. Zhang J. Oksov Y. Lustigman S. J. Biol. Chem. 2004; 279: 6035-6045Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). In brief, C. elegans cpi-1 mutant gravid hermaphrodites were washed with PBS and cut open to release the embryos. The embryos were then fixed in methanol/acetone using the freeze-cracking protocol (50Finney M. Ruvkun G. Cell. 1990; 63: 895-905Abstract Full Text PDF PubMed Scopus (490) Google Scholar). Whole mount fixation of the mutant animals was performed according to a modification of the method of Finney and Ruvkun (51Miller D.M. Shakes D.C. Methods Cell Biol. 1995; 48: 365-394Crossref PubMed Scopus (210) Google Scholar). The fixed embryos or the permeabilized whole worms were treated with 1% bovine serum albumin for 1 h before reaction with antibodies. The embryos or mixed stage larvae and adult worms were incubated with a mixture of rabbit anti-CPI-2a and mouse anti-CPL-1 or CPZ-1 antibodies at a dilution of 1:200 each. The samples were incubated with the antibodies at 4 °C overnight. After washing, the samples were incubated with a mix of fluorescein isothiocyanate-conjugat
Referência(s)