Transcriptional Regulatory Elements of the Human Gene for Cytochrome P450c21 (Steroid 21-Hydroxylase) Lie within Intron 35 of the Linked C4B Gene
1999; Elsevier BV; Volume: 274; Issue: 53 Linguagem: Inglês
10.1074/jbc.274.53.38097
ISSN1083-351X
AutoresSujeewa D. Wijesuriya, Guangren Zhang, Andrea Dardis, Walter L. Miller,
Tópico(s)Hormonal and reproductive studies
ResumoThe CYP21 gene, which encodes P450c21, the adrenal steroid 21-hydroxylase needed for glucocorticoid synthesis, lies in the major histocompatibility locus only 2.3 kilobase pairs (kb) downstream from the C4 gene. A 300-base pair (bp) proximal promoter and two upstream regions within C4are needed for expression of mouse CYP21; the human gene also has a proximal promoter, but upstream elements have not been studied. To search for upstream regulatory elements in humanCYP21B, we examined up to 9 kb of 5′-flanking DNA by transient transfection into human adrenal NCI-H295A cells. The 300-bp proximal promoter had substantial activity, but constructs retaining the DNA between −4.6 and −5.6 kb had increased activity, indicating the presence of distal elements. This region does not correspond to the mouse upstream regions, lying further upstream within intron 35 ofC4B, which encompasses the previously described “Z promoter.” DNase I footprinting located two elements, F1 and F2, lying −186 to −195 bp and −142 to −151 bp upstream from the Z cap site (−4862 to −4871 and −4818 to −4827 bp upstream of theCYP21B cap site). Each element formed a specific DNA-protein complex and conferred orientation-independent expression to a heterologous promoter. Mutations abolished formation of the DNA-protein complexes but only partially decreased expression. We identified a third site, F3, lying at −33 to −42 bp from Z. Competitive gel mobility supershift assays and co-transfection studies with SF-1 produced in vitro indicate F2 and F3 bind SF-1; BLAST searches and Southwestern blotting suggest that NF-W2 may bind F1. These results indicate that the Z promoter is a component of theCYP21 promoter needed to drive its adrenal-specific expression and that CYP21 transcription elements withinC4 have kept these two genes linked during evolution. The CYP21 gene, which encodes P450c21, the adrenal steroid 21-hydroxylase needed for glucocorticoid synthesis, lies in the major histocompatibility locus only 2.3 kilobase pairs (kb) downstream from the C4 gene. A 300-base pair (bp) proximal promoter and two upstream regions within C4are needed for expression of mouse CYP21; the human gene also has a proximal promoter, but upstream elements have not been studied. To search for upstream regulatory elements in humanCYP21B, we examined up to 9 kb of 5′-flanking DNA by transient transfection into human adrenal NCI-H295A cells. The 300-bp proximal promoter had substantial activity, but constructs retaining the DNA between −4.6 and −5.6 kb had increased activity, indicating the presence of distal elements. This region does not correspond to the mouse upstream regions, lying further upstream within intron 35 ofC4B, which encompasses the previously described “Z promoter.” DNase I footprinting located two elements, F1 and F2, lying −186 to −195 bp and −142 to −151 bp upstream from the Z cap site (−4862 to −4871 and −4818 to −4827 bp upstream of theCYP21B cap site). Each element formed a specific DNA-protein complex and conferred orientation-independent expression to a heterologous promoter. Mutations abolished formation of the DNA-protein complexes but only partially decreased expression. We identified a third site, F3, lying at −33 to −42 bp from Z. Competitive gel mobility supershift assays and co-transfection studies with SF-1 produced in vitro indicate F2 and F3 bind SF-1; BLAST searches and Southwestern blotting suggest that NF-W2 may bind F1. These results indicate that the Z promoter is a component of theCYP21 promoter needed to drive its adrenal-specific expression and that CYP21 transcription elements withinC4 have kept these two genes linked during evolution. congenital adrenal hyperplasia herpes simplex virus 32-base proximal promoter of the HSV thymidine kinase gene polymerase chain reaction base pair(s) kilobase pair(s) wild type Dulbecco's modified Eagle's medium cytomegalovirus dithiothreitol Congenital adrenal hyperplasia (CAH)1 is a group of inborn errors of human steroid hormone biosynthesis (1Miller W.L. Levine L.S. J. Pediatr. 1987; 111: 1-17Abstract Full Text PDF PubMed Scopus (151) Google Scholar) that occurs in about 1 in 14,000 individuals (2Therrell B.L.J. Berenbaum S.A. Manter-Kapanke V. Simmank J. Korman K. Prentice L. Gonzalez J. Gunn S. Pediatrics. 1998; 101: 583-590Crossref PubMed Scopus (296) Google Scholar). Although mutation of the genes of any of the steroidogenic enzymes may cause CAH, over 95% of cases are due to mutations in steroid 21-hydroxylase; hence, this genetic locus has been the subject of intensive study (3Matteson K.J. Phillips III, J.A. Miller W.L. Chung B. Orlando P.J. Frisch H. Ferrandez A. Burr I.M. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5858-5862Crossref PubMed Scopus (93) Google Scholar, 4Morel Y. Miller W.L. Adv. Hum. Genet. 1991; 20: 1-68Crossref PubMed Scopus (159) Google Scholar, 5White P.C. Tusie-Luna M.T. New M.I. Speiser P.W. Hum. Mutat. 1994; 3: 373-378Crossref PubMed Scopus (112) Google Scholar). Adrenal 21-hydroxylation is catalyzed by cytochrome P450c21 (6Kominami S. Ochi H. Kobayashi Y. Takemori S. J. Biol. Chem. 1980; 255: 3386-3394Abstract Full Text PDF PubMed Google Scholar), although other, unidentified enzymes can catalyze some steroid 21-hydroxylation in extra-adrenal tissues (7Mellon S.H. Miller W.L. J. Clin. Invest. 1989; 84: 1497-1502Crossref PubMed Scopus (108) Google Scholar). Human P450c21 is encoded by the CYP21B gene, which lies in a complex array of genes on chromosome 6p21.3. The human (8Higashi Y. Yoshioka H. Yamane M. Gotoh O. Fujii-Kuriyama Y. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 2841-2845Crossref PubMed Scopus (492) Google Scholar, 9White P.C. New M.I. Dupont B. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 5111-5115Crossref PubMed Scopus (492) Google Scholar, 10Rodrigues N.R. Dunham I. Yu C.Y. Carroll M.C. Porter R.R. Campbell R.D. EMBO. J. 1987; 6: 1653-1661Crossref PubMed Scopus (141) Google Scholar), bovine (11Chung B. Matteson K.J. Miller W.L. DNA. 1985; 4: 211-219Crossref PubMed Scopus (33) Google Scholar, 12Chung B. Matteson K.J. Miller W.L. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 4243-4247Crossref PubMed Scopus (90) Google Scholar), and rodent (13Parker K.L. Chaplin D.D. Wong M. Seidman J.G. Smith J.A. Schimmer B.P. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 7860-7864Crossref PubMed Scopus (48) Google Scholar, 14Chaplin D.D. Galbraith L.J. Seidman J.G. White P.C. Parker K.L. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9601-9605Crossref PubMed Scopus (66) Google Scholar) genomes have duplicatedCYP21A and CYP21B genes, but these duplications postdate mammalian speciation and have different duplication boundaries (15Gitelman S.E. Bristow J. Miller W.L. Mol. Cell. Biol. 1992; 12: 2124-2134Crossref PubMed Scopus (100) Google Scholar). Only the human 21B gene encodes P450c21, as the21A gene carries three mutations that destroy the reading frame (8Higashi Y. Yoshioka H. Yamane M. Gotoh O. Fujii-Kuriyama Y. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 2841-2845Crossref PubMed Scopus (492) Google Scholar, 9White P.C. New M.I. Dupont B. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 5111-5115Crossref PubMed Scopus (492) Google Scholar, 10Rodrigues N.R. Dunham I. Yu C.Y. Carroll M.C. Porter R.R. Campbell R.D. EMBO. J. 1987; 6: 1653-1661Crossref PubMed Scopus (141) Google Scholar). By contrast, the mouse 21A gene is active while the corresponding 21B gene carries a single large internal deletion (13Parker K.L. Chaplin D.D. Wong M. Seidman J.G. Smith J.A. Schimmer B.P. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 7860-7864Crossref PubMed Scopus (48) Google Scholar, 14Chaplin D.D. Galbraith L.J. Seidman J.G. White P.C. Parker K.L. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9601-9605Crossref PubMed Scopus (66) Google Scholar), and in cattle both genes are active (11Chung B. Matteson K.J. Miller W.L. DNA. 1985; 4: 211-219Crossref PubMed Scopus (33) Google Scholar,12Chung B. Matteson K.J. Miller W.L. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 4243-4247Crossref PubMed Scopus (90) Google Scholar, 16John M.E. Okamura T. Dee A. Adler B. John M.C. White P.C. Simpson E.R. Waterman M.R. Biochemistry. 1986; 25: 2846-2853Crossref PubMed Scopus (50) Google Scholar). The human, rodent, and bovine CYP21 genes are located in the major histocompatibility locus and are duplicated in tandem with the closely linked C4 genes for the fourth component of serum complement so that the array is 5′ C4A,21A, C4B, 21B 3′ from telomere to centromere (8Higashi Y. Yoshioka H. Yamane M. Gotoh O. Fujii-Kuriyama Y. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 2841-2845Crossref PubMed Scopus (492) Google Scholar, 9White P.C. New M.I. Dupont B. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 5111-5115Crossref PubMed Scopus (492) Google Scholar, 10Rodrigues N.R. Dunham I. Yu C.Y. Carroll M.C. Porter R.R. Campbell R.D. EMBO. J. 1987; 6: 1653-1661Crossref PubMed Scopus (141) Google Scholar, 11Chung B. Matteson K.J. Miller W.L. DNA. 1985; 4: 211-219Crossref PubMed Scopus (33) Google Scholar, 12Chung B. Matteson K.J. Miller W.L. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 4243-4247Crossref PubMed Scopus (90) Google Scholar, 13Parker K.L. Chaplin D.D. Wong M. Seidman J.G. Smith J.A. Schimmer B.P. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 7860-7864Crossref PubMed Scopus (48) Google Scholar, 14Chaplin D.D. Galbraith L.J. Seidman J.G. White P.C. Parker K.L. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9601-9605Crossref PubMed Scopus (66) Google Scholar, 15Gitelman S.E. Bristow J. Miller W.L. Mol. Cell. Biol. 1992; 12: 2124-2134Crossref PubMed Scopus (100) Google Scholar, 16John M.E. Okamura T. Dee A. Adler B. John M.C. White P.C. Simpson E.R. Waterman M.R. Biochemistry. 1986; 25: 2846-2853Crossref PubMed Scopus (50) Google Scholar, 17Skow L.E. Womack J.E. Petresh J.M. Miller W.L. DNA. 1988; 7: 143-149Crossref PubMed Scopus (36) Google Scholar) (Fig. 1). The 5′ ends (transcriptional start sites) of the human CYP21A and CYP21B genes lie only 2466 bp downstream from the polyadenylation sites of the correspondingC4A and C4B genes (15Gitelman S.E. Bristow J. Miller W.L. Mol. Cell. Biol. 1992; 12: 2124-2134Crossref PubMed Scopus (100) Google Scholar, 18Yu C.Y. J. Immunol. 1991; 146: 1057-1066PubMed Google Scholar). In addition to the C4 and CYP21 genes, at least nine other transcription units overlap the human C4 andC21 genes. XB encodes the extracellular matrix protein tenascin-X (19Morel Y. Bristow J. Gitelman S.E. Miller W.L. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 6582-6586Crossref PubMed Scopus (133) Google Scholar, 20Bristow J. Tee M.K. Gitelman S.E. Mellon S.H. Miller W.L. J. Cell Biol. 1993; 122: 265-278Crossref PubMed Scopus (256) Google Scholar, 21Speek M. Barry F. Miller W.L. Hum. Mol. Genet. 1996; 5: 1749-1758Crossref PubMed Scopus (35) Google Scholar, 22Burch G.H. Gong Y. Liu W. Dettman R. Curry C.J. Smith L. Miller W.L. Bristow J. Nat. Genet. 1997; 17: 104-108Crossref PubMed Scopus (276) Google Scholar); XB-S is a truncated XB transcript that arises from a promoter within an intron of XB and encodes a protein of unknown function (23Tee M.K. Thomson A.A. Bristow J. Miller W.L. Genomics. 1995; 28: 171-178Crossref PubMed Scopus (43) Google Scholar); XA is an expressed, truncated XB gene that carries an internal deletion and does not encode protein (15Gitelman S.E. Bristow J. Miller W.L. Mol. Cell. Biol. 1992; 12: 2124-2134Crossref PubMed Scopus (100) Google Scholar); YA-S, YA-L, YB-S, and YB-L are short (S) and long (L) alternately spliced transcripts that arise at or near the CYP21A and Btranscriptional start sites but have a different exonic array and lack open reading frames (24Bristow J. Gitelman S.E. Tee M.K. Staels B. Miller W.L. J. Biol. Chem. 1993; 268: 12919-12924Abstract Full Text PDF PubMed Google Scholar); the ZA and ZB transcripts arise from promoters within intron 35 of the C4A and C4Bgenes and have the potential to encode a protein identical to the carboxyl-terminal 131 amino acids of C4 (25Tee M.K. Babalola G.O. Aza-Blanc P. Speek M. Gitelman S.E. Miller W.L. Hum. Mol. Genet. 1995; 4: 2109-2116Crossref PubMed Scopus (36) Google Scholar) (Fig. 1). The three X transcripts are encoded on the DNA strand antisense to all the other transcripts and overlap the CYP21 and Y transcripts by several hundred bases and are transcribed in the same cells (20Bristow J. Tee M.K. Gitelman S.E. Mellon S.H. Miller W.L. J. Cell Biol. 1993; 122: 265-278Crossref PubMed Scopus (256) Google Scholar), but these sense and antisense strands do not form significant RNA:RNA duplexesin vivo (26Speek M. Miller W.L. Mol. Endocrinol. 1995; 9: 1655-1665PubMed Google Scholar). The two C4 genes are expressed almost exclusively in the liver (27Martin H. Loos M. Sorg C. Macrophage-derived Cell Regulatory Factors: Cytokines. Karger, Basel, Switzerland1989: 155-172Google Scholar), and XB is expressed in a wide variety of tissues (20Bristow J. Tee M.K. Gitelman S.E. Mellon S.H. Miller W.L. J. Cell Biol. 1993; 122: 265-278Crossref PubMed Scopus (256) Google Scholar, 28Burch G.H. Bedolli M.A. McDonough S. Rosenthal S.M. Bristow J. Dev. Dyn. 1995; 203: 491-504Crossref PubMed Scopus (90) Google Scholar); all of the remaining transcripts (CYP21B, XA, XB-S, YA-S, YA-L, YB-S, YB-L, ZA, and ZB) are expressed only in the adrenal cortex (15Gitelman S.E. Bristow J. Miller W.L. Mol. Cell. Biol. 1992; 12: 2124-2134Crossref PubMed Scopus (100) Google Scholar, 23Tee M.K. Thomson A.A. Bristow J. Miller W.L. Genomics. 1995; 28: 171-178Crossref PubMed Scopus (43) Google Scholar, 24Bristow J. Gitelman S.E. Tee M.K. Staels B. Miller W.L. J. Biol. Chem. 1993; 268: 12919-12924Abstract Full Text PDF PubMed Google Scholar, 25Tee M.K. Babalola G.O. Aza-Blanc P. Speek M. Gitelman S.E. Miller W.L. Hum. Mol. Genet. 1995; 4: 2109-2116Crossref PubMed Scopus (36) Google Scholar). Thus, this locus is especially well suited for studies aimed at identifying the requirements for adrenal-specific transcription. Although the high frequency of 21-hydroxylase deficiency has stimulated intense study of human CYP21 genetics, less attention has been directed to the regulation of human CYP21transcription. Studies of the mouse CYP21A gene showed that a small promoter fragment of only 230–330 bases upstream from the transcriptional start site is sufficient to confer both basal and cAMP-induced transcription in mouse adrenal Y-1 cells (29Parker K.L. Schimmer B.P. Chaplin D.D. Seidman J.G. J. Biol. Chem. 1986; 261: 15353-15355Abstract Full Text PDF PubMed Google Scholar, 30Handler J.D. Schimmer B.P. Flynn T.R. Szyf M. Seidman J.G. Parker K.L. J. Biol. Chem. 1988; 263: 13068-13073Abstract Full Text PDF PubMed Google Scholar, 31Rice D.A. Kronenberg M.S. Mouw A.R. Aitken L.D. Franklin A. Schimmer B.P. Parker K.L. J. Biol. Chem. 1990; 265: 8052-8058Abstract Full Text PDF PubMed Google Scholar, 32Rice D.A. Mouw A.R. Bogerd A.M. Parker K.L. Mol. Endocrinol. 1991; 5: 1552-1561Crossref PubMed Scopus (220) Google Scholar, 33Parissenti A.M. Parker K.L. Schimmer B.P. Mol. Endocrinol. 1993; 7: 283-290PubMed Google Scholar). These initial observations contributed to the discovery of the orphan nuclear receptor called SF-1 or Ad4-BP, which is required for the expression of steroidogenic enzymes in the adrenals and gonads (Refs. 34Morohashi K. Honda S. Inomata Y. Handa H. Omura T. J. Biol. Chem. 1992; 267: 17913-17919Abstract Full Text PDF PubMed Google Scholar, 35Lala D.S. Rice D.A. Parker K.L. Mol. Endocrinol. 1992; 6: 1249-1258Crossref PubMed Scopus (514) Google Scholar, 36Morohashi K. Trends Endocrinol. Metab. 1999; 10: 169-173Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar; for review, see Ref. 37Parker K.L. Schimmer B.P. Endocr. Rev. 1997; 18: 361-377Crossref PubMed Scopus (556) Google Scholar). However, this proximal promoter region was necessary but not sufficient, as two small regions located 5.3 and 6.0 kb upstream from the mouse CYP21A gene were required for its expression in transgenic mice (38Milstone D.S. Shaw S.K. Parker K.L. Szyf M. Seidman J.G. J. Biol. Chem. 1992; 267: 21924-21927Abstract Full Text PDF PubMed Google Scholar). Preliminary experiments with the promoter of the human CYP21B gene similarly identified basal and cAMP-responsive elements within a 200-bp proximal promoter adjacent to the transcriptional start site (39Kagawa N. Waterman M.R. J. Biol. Chem. 1990; 265: 11299-11305Abstract Full Text PDF PubMed Google Scholar, 40Kagawa N. Waterman M.R. J. Biol. Chem. 1991; 266: 11199-11204Abstract Full Text PDF PubMed Google Scholar), but far upstream sequences have not been studied. We previously identified a 1-kb adrenal-specific transcript, operationally termed Z, that arises from a transcriptional start site in intron 35 of the human C4 gene, 55 bases upstream from the 5′ end of exon 36 of C4 and 4676 bases upstream from the cap site of CYP21B (25Tee M.K. Babalola G.O. Aza-Blanc P. Speek M. Gitelman S.E. Miller W.L. Hum. Mol. Genet. 1995; 4: 2109-2116Crossref PubMed Scopus (36) Google Scholar). The “Z promoter,” comprising as little as 235 bp upstream from the Z cap site, drove robust expression of a luciferase reporter when transfected into human adrenal NCI-H295 cells, but not when transfected into human placental JEG-3 cells, human liver HepG2 cells, or monkey kidney COS-1 cells (25Tee M.K. Babalola G.O. Aza-Blanc P. Speek M. Gitelman S.E. Miller W.L. Hum. Mol. Genet. 1995; 4: 2109-2116Crossref PubMed Scopus (36) Google Scholar). Because no function could be found for the Z transcript and because the Z promoter lies near to but upstream from the regions corresponding to the −5.3 and −6.0 regions of the mouse C21A gene tested by Milstone et al. (38Milstone D.S. Shaw S.K. Parker K.L. Szyf M. Seidman J.G. J. Biol. Chem. 1992; 267: 21924-21927Abstract Full Text PDF PubMed Google Scholar), we suggested that the Z promoter is a component required for efficient adrenal-specific expression of the humanCYP21B gene (25Tee M.K. Babalola G.O. Aza-Blanc P. Speek M. Gitelman S.E. Miller W.L. Hum. Mol. Genet. 1995; 4: 2109-2116Crossref PubMed Scopus (36) Google Scholar). We have now confirmed this hypothesis by characterizing large segments of the human CYP21B promoter, identifying specific sites of DNA/protein interaction. A pWE15 human cosmid library (Stratagene, La Jolla, CA) was screened under stringent conditions forC4/C21 sequences using a 372-bp PCR probe containing sequences from intron 35 of the C4-Z promoter region (−5254 to −4882 of the CYP21B gene) (Fig. 1). To isolate C4B/CYP21B clones, secondary screening was performed by PCR of primary clones using 21B specific oligonucleotides resulting in a 670-bp product (−64 to −729 ofCYP21B), which excluded amplification of CYP21Asequences. Positive cosmids were then digested with EcoRI and BamHI and hybridized with the 670-bp PCR probe. Positive DNA fragments were purified and used to assemble the constructs. The luciferase reporter constructs were built by cloning contiguous and internally deleted 5′-flanking DNA fragments of the CYP21Bgene extending from +13 bp to −9 kb (CYP21B transcription initiation site is designated as −1). These fragments were cloned upstream from the firefly luciferase reporter gene in the PGL3-Basic vector (Promega, Madison, WI) at various restriction sites within the polylinker. The constructs were named according to the approximate length of the DNA segment cloned from the CYP21B gene with the bases numbered according to the sequence of the humanC4A gene (18Yu C.Y. J. Immunol. 1991; 146: 1057-1066PubMed Google Scholar) (Fig. 1). Mutations were introduced into various functional elements by site-directed mutagenesis using a modification of the PCR protocol of Weiner et al. (41Weiner M.P. Costa G.L. Schoettlin W. Cline J. Mathur E. Bauer J.C. Gene (Amst.). 1994; 151: 119-123Crossref PubMed Scopus (415) Google Scholar). Using 200 ng of wild type plasmid DNA as template, PCR was performed in reactions containing 500 μm dNTPs, 2 units of Pfu polymerase, and 250 ng each of the sense and antisense mutant oligos (Tm = 75 °C). The reaction conditions were: 95 °C for 30 s, followed by 20 cycles of 95 °C for 30 s, 55 °C for 1 min, and 65 °C for 25 min (2.5 min/kb DNA). PCR products were directly treated with 20 units of DpnI at 37 °C for 90 min, and the treated products used to transformEscherichia coli DH5α. To prevent the need for sequencing the resulting mutant clones in their entirety, restriction fragments encompassing the mutant regions were subcloned into the respective wild type constructs. Constructs used for heterologous promoter experiments consisted of single and multiple tandem copies of the wild type and mutant oligos used in the electrophoretic mobility shift assays (Table I) inserted upstream from an 86-bp fragment of the herpes simplex virus thymidine kinase promoter (42McKnight S.L. Gavis E.R. Kingsbury R. Cell. 1981; 25: 385-398Abstract Full Text PDF PubMed Scopus (300) Google Scholar) extending from −32 to +55, lying immediately upstream from the firefly luciferase gene (HSV-TK32/Luc). Double-stranded oligonucleotides were blunt-end cloned into theSmaI site. The fidelity of all constructs was verified by restriction enzyme digestion and sequencing.Table IOligonucleotides used in this studyNameSequence−205/−177 wtGAACACGTCCATGATGCAAGACTCTGCTGCTTGTGCAGGTACTACTGTCTGAGACGAC−193/−188 MGAACACGTCCATACGTATAGACTCTGCTGCTTGTGCAGGTATGCATATCTGAGACGAC−162/−129 wtTGAAGACTGGGGCAAGGTCACCCTCTGGGAAGTGACTTCTGACCCCGTTCCAGTGGGAGACCCTTCAC−149/−144 MTGAAGACTGGGGCGCTTATACCCTCTGACTTCTGACCCCGCGAATATCGGAGAC−85/−66 P450sccGATCTGCAGGAGGAAGGACGTGAACGACGTCCTCCTTCCTGCACTTGCCTAG−155/−131 P450sccGATCTCGCTGCAGAAATTCCAGACTGAACCGAGCGACGTCTTTAAGGTCTGACTTGGCCTAG−447/−419 rat P450c17GTGTGACCTTATGCCGACTAACCTTTGAACACACTGGAATACGGCTGATTGGAAACTT−84/−55 rat P450c17CAAGAGATAACTCGACGTCAAGGTGACAAGTTCTCTAATGAGCTGCAGTTCCACTGTT−94/−119CTCTCAAAGCTGCTCCGCAAGGTCT−73/−51 wtCAGAATGAGAAGGACACTGGAGAGTCTTACACTTCCTGTGACCTCT−73/−51 MCAGAATGTAGCATCTGCTGGAGAGTCTTACATCGTAGACGACCTCT Open table in a new tab An adherent subline (NCI-H295A) (43Rodriguez H. Hum D.W. Staels B. Miller W.L. J. Clin. Endocrinol. Metab. 1997; 82: 365-371Crossref PubMed Scopus (88) Google Scholar) of human adrenocortical carcinoma NCI-H295 cells (44Gazdar A.F. Oie H.K. Shackleton C.H. Chen T.R. Triche T.J. Myers C.E. Chrousos G.P. Brennan M.F. Stein C.A. LaRocca R.V. Cancer. Res. 1990; 50: 5488-5496PubMed Google Scholar, 45Staels B. Hum D.W. Miller W.L. Mol. Endocrinol. 1993; 7: 423-433Crossref PubMed Scopus (176) Google Scholar) was maintained in RPMI 1640 medium supplemented with 2% fetal calf serum and antibiotics (penicillin, 20 units/ml; streptomycin, 20 μg/ml), selenium (5 ng/ml), insulin (5 μl/ml), and transferrin (5 μl/ml). Mouse Y1 adrenal carcinoma cells (46Yasamura Y. Buonassisi V. Sato G.H. Cancer Res. 1966; 26: 529-535PubMed Google Scholar), a generous gift from Dr. B. Schimmer (University of Toronto, Ontario, Canada), were grown in 50% Dulbecco's modified Eagle's medium (DMEM)-H16:50% Ham's F12 with 15% heat-inactivated horse serum, 2.5% fetal bovine serum, and antibiotics. Monkey kidney COS-1 cells and human HepG2 hepatocarcinoma cells were grown in DMEM-H21 media supplemented with 10% fetal bovine serum and antibiotics. Human JEG-3 choriocarcinoma cells (47Kohler P.O. Bridson W.E. J. Clin. Endocrinol. Metab. 1971; 65: 122-126Google Scholar) were grown in DMEM-H21 media supplemented with 5% horse serum and 0.2 mm gentamycin. Mouse MA-10 Leydig cells (48Ascoli M. Endocrinology. 1981; 108: 88-95Crossref PubMed Scopus (517) Google Scholar) were grown in Weymouth's medium supplemented with 15% horse serum, 2.5% HEPES buffer, and 0.2 mm gentamycin. All cell lines were maintained at 37 °C and 5% CO2. For transient transfection with the luciferase reporter constructs, cells were grown to 80% confluence in 10-cm Petri dishes and split into six-well plates 24 h prior to transfection. For the NCI-H295A cells, the DMEM-H16 medium supplemented with 10% fetal calf serum was used for transfection and replaced with growth medium 12 h after transfection. Plasmid constructs used for transfection studies were purified using Qiagen columns (Qiagen, Chatsworth, CA). Equal molar amounts of plasmid DNA containing varying lengths of contiguous and internally deletedCYP21B 5′-flanking DNA were transfected using the calcium phosphate-DNA co-precipitation method. Following incubation for 12 h, the medium was removed, and fresh medium was added and incubated for another 12 h. Cells were harvested and cellular extracts were assessed for luciferase activity by the dual luciferase reporter assay system (Promega). Transfection efficiencies were normalized by co-transfecting with the pRL-CMV plasmid (Promega) containing theRenilla luciferase gene driven by the CMV promoter. Luciferase activity values were normalized by initial division of all pRL-CMV-luciferase values by the lowest value obtained and the result used to divide the luciferase values obtained from the corresponding constructs. All constructs were transfected in triplicate, and the means of two independent experiments are shown. Nuclear extracts from NCI-H295A, JEG-3, COS-1, HepG2, MA-10, and Y1 cells were extracted using a method adapted from Dignam et al. (49Dignam J.D. Martin P.L. Shastry B.S. Roeder R.G. Methods Enzymol. 1983; 101: 582-598Crossref PubMed Scopus (745) Google Scholar). Protein concentrations were determined by the Bradford method (Bio-Rad) using bovine serum albumin as a standard. Double-stranded probes were prepared by hybridization of [32P]dATP (Amersham Pharmacia Biotech) end-labeled complementary oligonucleotides (Table I). Mobility shift binding reactions typically contained 5–10 μg of nuclear extract and 40,000 cpm (less than 0.5 ng) of end-labeled double-stranded probe in a final buffer composition of 4% glycerol, 1 mm EDTA, 5 mmDTT, 10 mm Tris-HCl, pH 7.5, 0.1 mg/ml bovine serum albumin, and 50 mm or 100 mm KCl. Poly(dI-dC) (1 μg) was included as a nonspecific competitor in all reactions. When competitive binding studies were being performed, 5- 50 ng (10–100-fold excess) of unlabeled specific and nonspecific oligonucleotides were pre-mixed with the probe for 1–2 min prior to addition of the nuclear extract. The reactions were incubated for 15 min at room temperature and electrophoresed through an 8% native polyacrylamide gel in 50 mm Tris base, 0.38 mglycine, 2 mm EDTA and analyzed by autoradiography or phosphorimaging. SF-1 cDNA was obtained by reverse transcription-PCR of human adrenal RNA. cDNA was synthesized using 1 μg of random-primed RNA. Specific oligonucleotides designed at the 5′ and 3′ end of the gene to amplify the cDNA in the correct reading frame were used in a PCR reaction containing 2 mm MgCl2, 5% Me2SO, 200 μm dNTPs, 0.6 mmoligonucleotides, and 2.5 units of Pfu DNA polymerase. The 1.3-kb cDNA fragment was cloned into the BamHI-EcoRI site of the pCDNA3 vector (Stratagene). SF-1 protein was obtained by in vitro transcription and translation using the TnT T7-coupled reticulocyte lysate system kit (Promega). 5 μl of lysate containing SF-1 protein or protein from lysate containing empty pCDNA3 vector were used in mobility shift assays. Probes were generated by PCR of the CYP21B −4.6 to −5.6 kb region using the C21/−5.0kb/Luc and C21/−5.6kb/Luc constructs as templates and [32P]dATP-end-labeled oligonucleotides. Both the −94 to −310 fragment from the C21/−5.0kb/Luc construct and the −717 to −937 fragment from the C21/−5.6kb/Luc construct were amplified using a vector-specific sense oligonucleotide. All other probes were obtained using the C21/−5.6kb/Luc construct. PCR products were purified using the Qiagen PCR purification kit and 70,000 cpm used in each assay. Probe DNA was incubated with varying concentrations of NCI-H295A and Y1 nuclear cell extracts (5–70 μg) in reactions containing 50 mm NaCl, 0.5 mm EDTA, 20 mm HEPES buffer, 10% glycerol, and 0.5 mm DTT. Poly(dI-dC) (1 μg) was included to prevent nonspecific DNA-binding proteins from binding to the labeled DNA. Reactions were incubated at 25 °C for 15 min, followed by the addition of 5 mm CaCl2, 10 mm MgCl2 and digestion with 0.1 units of DNase I. The reactions were terminated by adding 20 mm EDTA, 1% SDS, 0.2 m NaCl, and 250 ng/ml yeast tRNA. Phenol/chloroform-purified and ethanol-precipitated products were resuspended in formamide loading buffer and separated by electrophoresis through an 8% denaturing polyacrylamide gel. Dried gels were subjected to autoradiography. Southwestern blotting was done essentially as described (50Miskimins W.K. Roberts M.P. McClelland A. Ruddle F.H. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 6741-6744Crossref PubMed Scopus (201) Google Scholar); 100 μg of NCI-H295A cell nuclear extract was electophoresed on 10% SDS-polyacrylamide gels and electrophoretically transferred on to Immobilon-P polyvinylidene difluoride membranes (Millipore, Bradford, MA) treated according to the manufacturer's protocol. The membranes were incubated in 10 mm HEPES, pH 7.9, 60 mm KCl, 1 mmEDTA, 8% glycerol, 1 mm DTT, 5% nonfat dry milk powder, and 10 μg/ml poly(dA-dT) for 1.5 h at 25 °C. The membranes were then transferred to hybridization buffer (10 mm HEPES, pH 7.9, 60 mm KCl, 1 mm EDTA, 8% glycerol, 1 mm DTT, and 0.25% nonfat dry milk powder) containing 2 × 106 cpm/ml labeled probe for 2 h at 25 °C. The membranes were washed three times for 15 min each in hybridization buffer without probe at 25 °C and exposed to autoradiography or phosphorimaging. The 5′ upstream DNA for both the humanCYP21A and 21B genes is active, but expression from the 21A promoter occurs at only about 20% of the level of the 21B promoter (24Bristow J. Gitelman S.E. Tee M.K. Staels B. Miller W.L. J. Biol. Chem. 1993; 268: 12919-12924Abstract Full Text PDF PubMed Google Scholar, 51Chang S.F. Chung B. Mol. Endocrinol. 1995; 9: 1330-
Referência(s)