Dimerization of the Interferon Type I Receptor IFNaR2–2 Is Sufficient for Induction of Interferon Effector Genes but Not for Full Antiviral Activity
1999; Elsevier BV; Volume: 274; Issue: 49 Linguagem: Inglês
10.1074/jbc.274.49.34838
ISSN1083-351X
AutoresEls Pattyn, Xaveer Van Ostade, Liesbeth Schauvliege, Annick Verhee, Michaël Kalai, Joël Vandekerckhove, Jan Tavernier,
Tópico(s)Immune Cell Function and Interaction
ResumoWe constructed chimeric receptors wherein the extracellular domain of the erythropoietin receptor (EpoR) was fused to the transmembrane and intracellular domains of the interferon (IFN) type I receptor subunits, IFNaR1 or IFNaR2–2. Transfection into 2fTGH and Tyk2-deficient 11,1 cells showed that EpoR/IFNaR2–2 alone was able to transduce a signal upon stimulation with erythropoietin (Epo), as judged by induction of the interferon type I-inducible 6-16 promoter. In contrast, protection against infection with encephalomyocarditis virus or vesicular stomatitis virus was reduced or absent, respectively. To further investigate the role of IFNaR1 in the induction of an antiviral state, we analyzed the Epo-versus IFNα-induced transcription of a set of genes, involved in antiviral protection. Up to 24 h after stimulation with Epo or IFNα, comparable transcription of the p56, dsRNA-dependent protein kinase, 2′-5′A synthetase, and MxA genes was seen. However, at later time points, only in the case of Epo induction, a sharp decrease of mRNA levels was observed. Western blotting analysis of dsRNA-dependent protein kinase showed a similar pattern at the protein level. Taken together, our results imply a role for IFNaR1 in the induction of sustained mRNA and protein levels that are likely required for optimal antiviral activity. We constructed chimeric receptors wherein the extracellular domain of the erythropoietin receptor (EpoR) was fused to the transmembrane and intracellular domains of the interferon (IFN) type I receptor subunits, IFNaR1 or IFNaR2–2. Transfection into 2fTGH and Tyk2-deficient 11,1 cells showed that EpoR/IFNaR2–2 alone was able to transduce a signal upon stimulation with erythropoietin (Epo), as judged by induction of the interferon type I-inducible 6-16 promoter. In contrast, protection against infection with encephalomyocarditis virus or vesicular stomatitis virus was reduced or absent, respectively. To further investigate the role of IFNaR1 in the induction of an antiviral state, we analyzed the Epo-versus IFNα-induced transcription of a set of genes, involved in antiviral protection. Up to 24 h after stimulation with Epo or IFNα, comparable transcription of the p56, dsRNA-dependent protein kinase, 2′-5′A synthetase, and MxA genes was seen. However, at later time points, only in the case of Epo induction, a sharp decrease of mRNA levels was observed. Western blotting analysis of dsRNA-dependent protein kinase showed a similar pattern at the protein level. Taken together, our results imply a role for IFNaR1 in the induction of sustained mRNA and protein levels that are likely required for optimal antiviral activity. interferon encephalomyocarditis virus erythropoietin erythropoietin receptor interferon type I receptor interleukin-1 interleukin-3 interleukin-3 receptor α chain interleukin interleukin-5 receptor α chain Janus kinase secreted alkaline phosphatase signal transducer and activator of transcription vesicular stomatitis virus reverse transcription polymerase chain reaction interferon receptor tyrosine activation motif TAR RNA-binding protein dsRNA-dependent protein kinase It is generally accepted that activation of a cell by a cytokine is initiated by ligand-induced clustering of receptor subunits, which can occur as di-, tri-, or higher order oligomers, involving identical or related subunits. With the exception of the heptamembrane-spanning receptors, members from the hematopoietin/IFN,1 tumor necrosis factor/nerve growth factor, and tyrosine kinase receptor families are all activated by this mechanism of cytokine-driven multimerization. Ligand binding to the first receptor component induces the association with additional receptor subunits eventually resulting in an increase of affinity for the ligand (1Kishimoto T. Taga T. Akira S. Cell. 1994; 76: 253-262Abstract Full Text PDF PubMed Scopus (1264) Google Scholar, 2Hilton D.J. Nicola N.A. Guidebook to Cytokines and Their Receptors. Oxford University Press, New York1994: 8-16Google Scholar). Alternatively, preformed receptor complexes may also exist on the cell membrane (3Livnah O. Stura E.A. Middleton S.A. Johnson D.L. Jolliffe L.K. Wilson I.A. Science. 1999; 283: 987-990Crossref PubMed Scopus (545) Google Scholar). Interferons belong to the class I cytokine family and are divided into type I interferons (at least 14 IFNα subtypes, IFNβ, IFNω, and the bovine embryonic IFNτ) that have antiviral, cytostatic, and hematopoietic activities on many cell types, and the type II interferon or IFNγ that is also involved in many immune functions. Both types of interferons bind to distinct receptors that belong to the class I cytokine receptors. The interferon type I receptor (IFNaR) is composed of two subunits, IFNaR1 and IFNaR2–2. As a result of alternative splicing, subtypes of the latter subunit do also exist: a cytoplasmic truncated transmembrane form (IFNaR2–1) and a soluble form (IFNaR2–3) (4Lutfalla G. Holland S.J. Cinato E. Monneron D. Reboul J. Rogers N.C. Smith J.M. Stark G.R. Gardiner K. Mogensen K.E. EMBO J. 1995; 14: 5100-5108Crossref PubMed Scopus (228) Google Scholar, 5Uze G. Lutfalla G. Bandu M.T. Proudhon D. Mogensen K.E. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4774-4778Crossref PubMed Scopus (85) Google Scholar, 6Kim S.H. Cohen B. Novick D. Rubinstein M. Gene ( Amst. ). 1997; 196: 279-286Crossref PubMed Scopus (50) Google Scholar, 7Domanski P. Witte M. Kellum M. Rubinstein M. Hackett R. Pitha P. Colamonici O.R. J. Biol. Chem. 1995; 270: 21606-21611Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 8Novick D. Cohen B. Rubinstein M. Cell. 1994; 77: 391-400Abstract Full Text PDF PubMed Scopus (596) Google Scholar). A large body of evidence has shown that the class I cytokine receptors make use of associated kinases (JAKs) to start intracellular tyrosine phosphorylation, resulting in the activation of the so-called Stat proteins. This JAK/Stat pathway is essential for transcription of many of the cytokine-inducible genes (9Darnell Jr., J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1421Crossref PubMed Scopus (5167) Google Scholar). (10Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3448) Google Scholar, 11Pellegrini S. Dusanter-Fourt I. Eur. J. Biochem. 1997; 248: 615-633Crossref PubMed Scopus (244) Google Scholar) In particular, interferon-induced clustering of the IFNaR1 and IFNaR2–2 subunits results in activation of JAK1 and Tyk2 by reciprocal transphosphorylation, and in phosphorylation of the receptor intracellular domains. Stat1 and Stat2 subsequently bind to the phosphorylated receptors and form heterodimers after being phosphorylated themselves. The activated Stat1/Stat2 heterodimer then associates with a DNA binding subunit, p48, to form the multisubunit complex, ISGF3, that binds with high affinity to the interferon-stimulated response element enhancer sequences, located in the promoters of the interferon-stimulated genes (9Darnell Jr., J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1421Crossref PubMed Scopus (5167) Google Scholar, 12Schindler C. Darnell Jr., J.E. Annu. Rev. Biochem. 1995; 64 (621–651): 621-651Crossref PubMed Scopus (1666) Google Scholar, 13Pellegrini S. Schindler C. Trends Biochem. Sci. 1993; 18: 338-342Abstract Full Text PDF PubMed Scopus (188) Google Scholar, 14Stark G.R. Kerr I.M. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3408) Google Scholar, 15Ihle J.N. Cell. 1996; 84: 331-334Abstract Full Text Full Text PDF PubMed Scopus (1271) Google Scholar). One of the enigmas in IFN type I signal transduction is the specificity by which the IFNaR receptor is activated. Specificity of a cytokine can be determined at the intracellular level, where cell-specific signal transduction components can bind the cytoplasmic portions of the receptor subunits, thereby causing distinct effects of the same cytokine on different cells. At the extracellular level, however, many cytokines share a common receptor subunit (such as, for instance, the common βc subunit for the IL-3, granulocyte-macrophage colony-stimulating factor, and IL-5 receptor complexes), and ligand-specific signaling is at least in part derived from association with cytokine-specific additional receptor components (such as IL-3Rα, granulocyte-macrophage colony-stimulating factor receptor α chain, and IL-5Rα) (1Kishimoto T. Taga T. Akira S. Cell. 1994; 76: 253-262Abstract Full Text PDF PubMed Scopus (1264) Google Scholar). The interferon type I receptor seems to be an exception to this rule. Although IFNα and IFNβ share the same receptor components, differences in specificity in antiviral, antiproliferative, and clinical effects have been reported (16De Marco F. Giannoni F. Marcante M.L. J. Gen. Virol. 1995; 76: 445-450Crossref PubMed Scopus (14) Google Scholar, 17Einhorn S. Strander H. J. Gen. Virol. 1977; 35: 573-577Crossref PubMed Scopus (63) Google Scholar, 18Rosenblum M.G. Yung W.K. Kelleher P.J. Ruzicka F. Steck P.A. Borden E.C. J. Interferon Res. 1990; 10: 141-151Crossref PubMed Scopus (61) Google Scholar, 19Belhumeur P. Lanoix J. Blais Y. Forget D. Steyaert A. Skup D. Mol. Cell. Biol. 1993; 13: 2846-2857Crossref PubMed Scopus (29) Google Scholar, 20Holland K.A. Owczarek C.M. Hwang S.Y. Tymms M.J. Constantinescu S.N. Pfeffer L.M. Kola I. Hertzog P.J. J. Biol. Chem. 1997; 272: 21045-21051Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar, 21Means R.T.J. Krantz S.B. Exp. Hematol. 1996; 24: 204-208PubMed Google Scholar). Moreover, differences between IFNα and IFNβ have also been characterized at the gene induction level since only IFNβ is able to induce a gene called β-R1 in 2fTGH cells (22Rani M.S. Foster G.R. Leung S. Leaman D. Stark G.R. Ransohoff R.M. J. Biol. Chem. 1996; 271: 22878-22884Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar) and to activate the promoter of the 6-16 gene in Tyk2-deficient 2fTGH cells (23Pellegrini S. John J. Shearer M. Kerr I.M. Stark G.R. Mol. Cell. Biol. 1989; 9: 4605-4612Crossref PubMed Scopus (325) Google Scholar). Additionally, some recent findings suggest that IFNα and IFNβ utilize different regions of the IFNaR. For instance, co-immunoprecipitation of IFNaR1 and IFNaR2–2 can be achieved upon IFNβ but not IFNα treatment (24Platanias L.C. Uddin S. Domanski P. Colamonici O.R. J. Biol. Chem. 1996; 271: 23630-23633Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 25Croze E. Russell-Harde D. Wagner T.C. Pu H. Pfeffer L.M. Perez H.D. J. Biol. Chem. 1996; 271: 33165-33168Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar), and two monoclonal antibodies or a polyclonal antiserum, directed against IFNaR1, block the activity of IFNα but not that of IFNβ (26Lu J. Chuntharapai A. Beck J. Bass S. Ow A. de Vos A.M. Gibbs V. Kim K.J. J. Immunol. 1998; 160: 1782-1788PubMed Google Scholar, 27Lewerenz M. Mogensen K.E. Uze G. J. Mol. Biol. 1998; 282: 585-599Crossref PubMed Scopus (77) Google Scholar). In addition, mutagenesis studies of the IFNaR2–2 chain showed differential receptor activation since (i) intracellular deletions abrogated only the IFNβ and not the IFNα-induced antiviral response, while activation of the JAK/Stat pathway was equal in both cases (28Domanski P. Nadeau O.W. Platanias L.C. Fish E. Kellum M. Pitha P. Colamonici O.R. J. Biol. Chem. 1998; 273: 3144-3147Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar), and (ii) extracellular mutations created receptor complexes that showed preferential binding for each of the ligands (27Lewerenz M. Mogensen K.E. Uze G. J. Mol. Biol. 1998; 282: 585-599Crossref PubMed Scopus (77) Google Scholar). It is also possible to obtain mutations in IFNβ that mimic IFNα activity (29Runkel L. Pfeffer L. Lewerenz M. Monneron D. Yang C.H. Murti A. Pellegrini S. Goelz S. Uze G. Mogensen K. J. Biol. Chem. 1998; 273: 8003-8008Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). These data suggest that other mechanisms may be responsible for generation of signal diversity apart from utilization of cytokine-specific receptor components. Little is known about the exact stoichiometry of the activated IFNaR complex. High affinity ligand binding and activation of the IFNα/β signaling pathways requires clustering of the IFNaR1 with the IFNaR2–2 chain (4Lutfalla G. Holland S.J. Cinato E. Monneron D. Reboul J. Rogers N.C. Smith J.M. Stark G.R. Gardiner K. Mogensen K.E. EMBO J. 1995; 14: 5100-5108Crossref PubMed Scopus (228) Google Scholar, 5Uze G. Lutfalla G. Bandu M.T. Proudhon D. Mogensen K.E. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4774-4778Crossref PubMed Scopus (85) Google Scholar, 7Domanski P. Witte M. Kellum M. Rubinstein M. Hackett R. Pitha P. Colamonici O.R. J. Biol. Chem. 1995; 270: 21606-21611Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 30Cleary C.M. Donnelly R.J. Soh J. Mariano T.M. Pestka S. J. Biol. Chem. 1994; 269: 18747-18749Abstract Full Text PDF PubMed Google Scholar, 31Cutrone E.C. Langer J.A. FEBS Lett. 1997; 404: 197-202Crossref PubMed Scopus (70) Google Scholar), but it has been postulated that IFNβ may also be capable of clustering the IFNaR2–2 subunit alone (27Lewerenz M. Mogensen K.E. Uze G. J. Mol. Biol. 1998; 282: 585-599Crossref PubMed Scopus (77) Google Scholar). To further explore the aggregation of the IFNaR1 and IFNaR2–2 chains and their effects on IFNα/β signaling, we fused the extracellular domains of the erythropoietin receptor (EpoR) to the intracellular and transmembrane domains of IFNaR1 or IFNaR2–2, thereby generating the chimeric receptors EpoR/IFNaR1 and EpoR/IFNaR2–2. Since erythropoietin homodimerizes the EpoR (32Watowich S.S. Yoshimura A. Longmore G.D. Hilton D.J. Yoshimura Y. Lodish H.F. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2140-2144Crossref PubMed Scopus (284) Google Scholar), dimerization of the IFNaR intracellular domains could be obtained, and the resulting effects on several interferon functions were studied. Human fibrosarcoma 2fTGH cells and 11,1 cells (both gifts from Sandra Pellegrini, Institut Pasteur, Paris, France) were cultured in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) with 10% fetal calf serum (Globepharm, Surrey, United Kingdom) at 37 °C in 10% CO2. Recombinant human Epo was purchased from R&D Systems (Abingdon, UK). IFNα was purchased from PeproTech inc. (Rocky Hill, NJ), and IFNβ was a gift of Dr. P. Hochman (Biogen Inc., Cambridge, MA). The p6-16SEAP vector was constructed by transferring a HindIII fragment containing the entire 6-16 promoter from the plasmid p6-16luci (gift from Sandra Pellegrini) to the HindIII-opened pSEAP vector (Tropix, Bedford, MA), so that the 6-16 promoter was cloned upstream of the SEAP coding region. EpoR/IFNaR receptor chimeras were constructed as follows. RNA was isolated from 5 × 106 TF-1 cells using the RNeasy kit (Qiagen). According to standard RT-PCR procedures, cDNA was prepared and the PCR performed using Pfu enzyme (5 units; Stratagene). Forward (CGGGGTACCATGGACCACCTCGGGGCGTCC) and reverse (CCCTTAATTAAGTCCAGGTCGCTAGGCGTCAG) primers were designed to amplify the extracellular part of the EpoR between a KpnI andPacI site. A band of correct size was purified and the DNA was digested with KpnI and PacI and inserted into the KpnI-PacI opened pSV-SPORT IL-5Rα/IFNaR2–2 or pSV-SPORT βc/IFNaR1 vectors. These vectors contain chimeric receptors that have the extracellular domain of the receptors for IL-5, IL-5Rα, or βc, fused to the transmembrane and intracellular domains of IFNaR1 or IFNaR2–2. By site-specific mutagenesis, a PacI site was added to the fusion point by means of the site-directed mutagenesis kit (Stratagene, La Jolla, CA), which resulted in the insertion of two amino acids (Leu-Ile) before the last extracellular membrane-proximal amino acid (Lys) of IFNaR1 and IFNaR2–2. 2X. Van Ostade, E. Pattyn, A. Verhee, J. Vandekerckhove, and J. Tavernier, manuscript in preparation. Hence, using theKpnI site that precedes the coding sequence and the createdPacI site on the extracellular/transmembrane domain fusion site, the extracellular domain of IL-5Rα or βc could be exchanged by the one of EpoR, as described above. The resultant vectors were named pSV-SPORT-EpoR/IFNaR2–2 and pSV-SPORT-EpoR/IFNaR1, respectively. All transient transfection experiments were performed using the calcium phosphate method (33Graham F.L. Eb A.J. Virology. 1973; 52: 456-467Crossref PubMed Scopus (7178) Google Scholar). 2fTGH cells, stably transfected with p6-16SEAP, were obtained by co-transfection of 20 μg of p6-16SEAP with 2 μg of pBSpac/deltap also using the calcium phosphate transfection method. The pBSpac/deltap plasmid contains a gene for puromycin resistance under control of the constitutive SV40 early promoter. Optimal puromycin concentration was determined as 3 μg/ml. Single colonies were isolated by limited dilution in 96-well microtiter plates. The clone 2fTGH6-16SEAP clone 5 was selected based on an optimal IFNα and IFNβ stimulation window of SEAP secretion. For development of stable cells expressing the EpoR/IFNaR chimeras, either 2fTGH 6-16SEAP clone 5 or 2fTGH cells were transfected with 20 μg of pSV-SPORT-EpoR/R2–2 and 2 μg of pcDNA1/Neo. Stable transfectants were selected in medium containing G418 (400 μg/ml). Clones of the Tyk2-deficient 11,1 cells with the stable integration of pSV-SPORT-EpoR/R2–2 were obtained by cotransfection of the latter plasmid with pBSpac/deltap. Surviving clones on puromycin were tested on their integration of the pSV-SPORT-EpoR/R2–2 plasmid by transfecting the individual clones with 6-16SEAP. 11,1 EpoR/R2–2 cl.4 was selected. The amount of secreted alkaline phosphatase was determined with the Phospha-light kit (Tropix), using disodium 3(4-methoxyspiro(1,2-dioxetane-3,2′-(5′chloro)tricyclo[3.3.1.1]decan)-4-yl)phenyl phosphate as the luminogenic substrate. Assays were performed in a 96-well microtiter plate following the manufacturers guidelines, and were counted in a Topcount luminometer (Canberra Packard, Zellik, Belgium). For antiviral assays, cells were treated with different IFN or Epo concentrations as indicated in the figures. VSV or EMCV was added after 24 h, and the cytopathic effect was scored another 20 h later by removing the medium and staining of living cells for 10 min with 100 μl of a crystal violet solution (0.5% crystal violet (w/v), 3% formaldehyde, 30% ethanol, and 0.17% NaCl (w/v)). After this, the cells were extensively washed and dried and staining was quantified by solubilizing in 100 μl 30% acidic acid and measurement in an enzyme-linked immunosorbent assay reader (Dynatech Laboratories Inc., Chantilly, VA) at 590 nm. As a control on growth inhibition, a similar experiment was set up, but without virus addition. All experiments were performed in triplicate. For the Northern blot analysis, total RNA was prepared from 2fTGH 6-16SEAP EpoR/R2–2 cells using the RNeasy method (Qiagen). RNA (10 μg) was separated on a 1.5% agarose, 6% formaldehyde gel, transferred to a nylon membrane (Zetaprobe; Bio-Rad), and cross-linked using UV radiation. The filters were hybridized for 1 h at 68 °C in ExpressHyb solution (CLONTECH) with [32P]dCTP-labeled DNA probes and washed three times with 2× SSC, 0.05% SDS at room temperature and twice in 0.1× SSC, 0.1% SDS at 50 °C. Blots were exposed to film using intensifying screens at −70 °C. β-Actin was used for normalization. For the Western blot analysis, whole cell extracts of 2fTGH 6-16SEAP EpoR/R2–2 cells were obtained by lysis in Laemmli SDS-polyacrylamide gel electrophoresis sample buffer, sonication and boiling. Proteins from equal amounts of cell lysate were resolved by 15% SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes (Schleicher & Schuell). Ponceau S staining (Serva, Heidelberg, Germany) controlled the transfer of proteins to the membrane and allowed normalization of the different samples. Membranes were blocked and incubated with primary antibodies. Specific bands were revealed by incubation with horseradish peroxidase-conjugated secondary antibodies (Amersham Pharmacia Biotech) and enhanced chemiluminescence renaissance reagents (NEN Life Science Products). Polyclonal rabbit antisera to PKR was obtained from Santa Cruz Biotechnology, and mouse monoclonal anti-PKR was from Transduction Laboratories. Rabbit antisera to TRBP was kindly provided by Dr. Kuan-Teh Jeang (NIAID, National Institutes of Health, Bethesda, MD). To mimic experimental conditions optimally, Dulbecco's modified Eagle's medium, supplemented with IFNβ (1 ng/ml), IFNα (1.7 ng/ml), or Epo (5 ng/ml) was incubated on a subconfluent monolayer of 2fTGH 6-16SEAP EpoR/IFNaR2–2 clone 4 cells for 6, 11, 24, 36, and 48 h. In a parallel experiment, the same set up was used but incubation was without cells. The media were then tested for IFN or Epo activity by transfer to 2fTGH 6-16SEAP EpoR/IFNaR2–2 clone 4 cells and by measuring the induction of SEAP secretion by these cells after 24 h of incubation. We constructed a plasmid (p6-16SEAP) wherein the 6-16 promoter was cloned upstream of the SEAP reporter gene and co-transfected this with pBSpac/deltap into 2fTGH cells, allowing isolation of stable clones by selection on puromycin. Based on the best window in SEAP production between IFNα and IFNβ stimulated and non-stimulated cells, 2fTGH 6-16SEAP clone 5 was selected for further work. Due to a lower background, higher ligand-induced SEAP levels could be reached with this cell line as compared with transient co-transfection of chimeric receptors with p6-16SEAP in 2fTGH cells (data not shown). It is widely accepted that Epo functions through a homodimeric receptor (32Watowich S.S. Yoshimura A. Longmore G.D. Hilton D.J. Yoshimura Y. Lodish H.F. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2140-2144Crossref PubMed Scopus (284) Google Scholar). Furthermore, there is evidence for preformed dimers of the EpoR before ligand activation (3Livnah O. Stura E.A. Middleton S.A. Johnson D.L. Jolliffe L.K. Wilson I.A. Science. 1999; 283: 987-990Crossref PubMed Scopus (545) Google Scholar). Therefore, EpoR/IFNaR receptor chimeras would allow us to dissect the precise contributions of the IFNaR1 and IFNaR2–2 intracellular domains in signaling through the type I IFN receptor. To make these receptor chimeras, the extracellular domain of the EpoR was amplified from TF-1 mRNA by RT-PCR, thereby adding a unique KpnI and PacI site at the 5′ and 3′ termini, respectively. This made it possible to quickly fuse the EpoR extracellular domain to the IFNaR1 or IFNaR2–2 transmembrane and intracellular domains (Fig. 1; see “Experimental Procedures”). The resultant plasmids were named pSV-SPORT-EpoR/IFNaR1 and pSV-SPORT-EpoR/IFNaR2–2. The EpoR/IFNaR1 and EpoR/IFNaR2–2 plasmids alone, or in combination, were transiently transfected into 2fTGH 6-16SEAP clone 5 cells, and the induction of SEAP activity was measured following Epo or IFNα treatment. A clear SEAP induction was seen when the cells were transfected with the EpoR/IFNaR2–2 chimeras alone or with the combination of both chimeras, but not with the EpoR/IFNaR1 chimeras alone, or with empty vector (Fig.2), indicating that homodimerization of the IFNaR2–2 receptor is sufficient for activation of the 6-16 promoter. Induction levels comparable to IFNα were observed. Since both chimeric receptor complexes probably appear at the cell membrane of the double-transfected cells, we were not able to attribute the Epo-induced 6-16 promoter activation to EpoR/IFNaR2–2 homodimerization or to EpoR/IFNaR1 + EpoR/IFNaR2–2 heterodimerization. No mRNA, coding for the wild-type EpoR, is present in the cells as determined by RT-PCR analysis on 2fTGH 6-16SEAP clone 5 cells (data not shown). To eliminate possible cross-talk with the endogenous IFNaR1, we transfected the EpoR/IFNaR2–2 chimeras in 2fTGH cells that lack the IFNaR1-associated Tyk2 kinase (11,1 mutant cells). These cells are deficient in signaling via the IFNaR1 component of which they express barely detectable levels (34Gauzzi M.C. Barbieri G. Richter M.F. Uze G. Ling L. Fellous M. Pellegrini S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11839-11844Crossref PubMed Scopus (106) Google Scholar, 35Richter M.F. Dumenil G. Uze G. Fellous M. Pellegrini S. J. Biol. Chem. 1998; 273: 24723-24729Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). A clear Epo-induced SEAP expression in the 11,1 transfectants was observed (Fig.3 B), underscoring that signaling occurred through homodimerization of the IFNaR2–2 cytosolic domains. Similar 6-16SEAP induction by Epo was observed in 11,1 cells stably expressing the EpoR/IFNaR2–2 chimera (11,1 EpoR/R2–2 clone 4) (Fig. 3 A). Interestingly, in transiently transfected cells and in this stable clone, but not in the parental 11,1 cells transfected with the 6-16SEAP construct alone, a loss of IFNβ-induced 6-16 promoter activity was observed (Fig. 3, panels A–C). This effect is likely due to recruitment of the available JAK1 pool to the chimeric receptor. Certain mutations of the IFNaR receptor can uncouple IFN-induced activation of the JAK/Stat pathway from the antiviral activity (28Domanski P. Nadeau O.W. Platanias L.C. Fish E. Kellum M. Pitha P. Colamonici O.R. J. Biol. Chem. 1998; 273: 3144-3147Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar), indicating that additional pathways are involved in the latter activity. Because induction of SEAP production by the 6-16 promoter depends largely on JAK/Stat activation, we wished to compare the function of the chimeric receptors in antiviral assays versus the SEAP induction assay. 2fTGH 6-16SEAP and 2fTGH cell lines that stably expressed the EpoR/IFNaR2–2 chimeric receptor were developed by selection on G418 as described under “Experimental Procedures” (2fTGH 6-16SEAP EpoR/R2–2 clone 4, and 2fTGH EpoR/IFNaR2–2 clones 1 and 8, respectively). 2fTGH 6-16SEAP EpoR/R2–2 clone 4 cells were treated for 24 h with serial dilutions of Epo or IFNα, incubated for 20 h with VSV or EMCV and subsequently examined for survival. Fig. 4 A shows a protective effect of Epo against EMCV thereby providing evidence that the IFNaR1 subunit is not indispensable for antiviral activity. However, when compared with IFNα, this effect was at least 10-fold lower with significantly reduced plateau levels. Furthermore, Epo was completely unable to protect cells from infection with VSV (Fig. 4 B) even at high concentrations. Similar results were obtained on the other clones (2fTGH EpoR/R2–2 clones 1 and 8; data not shown). On 11,1 EpoR/R2–2 clone 4 cells, a similar low protection by Epo was observed against EMCV (Fig. 4 C), while Epo was completely inactive on parental 11,1 cells (Fig. 4 D). This observation lends further support to the fact that no functional signaling via the endogenous IFNaR1 chain is required to explain the observed effects via the EpoR/IFNaR2–2 chimera. Since the reduction or absence of antiviral activity could also be interpreted as an induction of growth inhibition by the cytokine, we examined the effect of Epo versus IFNα on cell growth in the absence of virus. A small growth-inhibitory effect was seen after treatment with the same Epo concentrations as used for the antiviral assay. This effect was slightly weaker when compared with IFNα treatment (Fig. 4 E). This indicates that there is no direct relation between growth inhibition and antiviral activity in our experiments. The results we see in the antiviral assays may, however, be the net result of antiviral and antiproliferative activities. This could explain why we see a reduction in cell number with VSV infection upon Epo treatment since a small, growth-inhibitory effect of Epo may become enlarged upon VSV infection. In the case of IFNα, this effect may be masked by the protective, antiviral effect that this cytokine exerts on the cells. We cannot exclude however, that aberrant EpoR/IFNaR2–2 receptor activation resulting from high Epo concentrations could lead to an increased viral infection. To ascertain that the reduced antiviral activity by EpoR/IFNaR2–2 homodimerization was not the result of instability of Epo, we incubated medium containing Epo, IFNα, or no cytokine in the presence or absence of the 2fTGH 6-16SEAP EpoR/IFNaR2–2 clone 4 cells for 6, 11, 24, 36, and 48 h. After this, the media were tested for activity by transferring them to the 2fTGH 6-16SEAP EpoR/IFNaR2–2 clone 4 cells and measuring SEAP induction. Fig. 5shows that no clear reduction in Epo or IFNα activity could be measured when ligands were incubated in the absence of cells, indicating that the intrinsic stability of both cytokines was sufficient for longer incubation times. Pre-incubation of Epo and IFNα in the presence of cells caused a reduction in activity, probably due to ligand internalization or to proteases released by the cells, but this reduction was small and equal for both ligands and could therefore not account for the difference in antiviral activity (Fig. 5). Moreover, addition of Epo or IFNα every 8 h during the antiviral assay did not narrow the window in antiviral protection between both cytokines (data not shown). We further investigated the EpoR/IFNaR2–2-dependent induction of mRNAs of genes that are strongly induced by interferon. PKR, 2′-5′A synthetase and MxA are known to have a central role in the antiviral protection mechanism of the cell (14Stark G.R. Kerr I.M. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3408) Google Scholar). p56 was also investigated because it is very strongly induced by interferons (36Wathelet M. Moutschen S. Defilippi P. Cravador A. Collet M. Huez G. Content J. Eur. J. Biochem. 1986; 155: 11-17Crossref PubMed Scopus (64) Google Scholar), and it was recently shown to be involved in translation inh
Referência(s)