Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

CD40 Ligand Mutants Responsible for X-linked Hyper-IgM Syndrome Associate with Wild Type CD40 Ligand

1999; Elsevier BV; Volume: 274; Issue: 16 Linguagem: Inglês

10.1074/jbc.274.16.11310

ISSN

1083-351X

Autores

Kuniaki Seyama, William Osborne, Hans D. Ochs,

Tópico(s)

T-cell and B-cell Immunology

Resumo

CD40 ligand (CD40L) is a 33-kDa type II membrane glycoprotein mainly expressed on activated CD4+ T cells in trimeric form. When it is mutated, the clinical consequences are X-linked hyper-IgM syndrome (XHIM), a primary immunodeficiency disorder characterized by low levels of IgG, IgA, and elevated or normal levels of IgM. Mutated CD40L can no longer bind CD40 nor provide signals for B cells to proliferate and to switch from IgM to other immunoglobulin isotypes. When considering gene therapy for XHIM, it is important to address the possibility that the mutated CD40L associates with transduced wild type CD40L, and as a consequence, immune reconstitution is not attained. In this study, we demonstrate that the various mutated CD40L species we have identified in patients with XHIM, including both full-length and truncated mutants, associate with wild type CD40L on the cell surface of co-transfected COS cells. The association between wild type and mutated CD40L was also observed in CD4+ T cell lines established from XHIM patients with leaky splice site mutations. The clinical phenotype of these patients suggests that this association between wild type and mutated CD40L species may result in less efficient cross-linking of CD40. CD40 ligand (CD40L) is a 33-kDa type II membrane glycoprotein mainly expressed on activated CD4+ T cells in trimeric form. When it is mutated, the clinical consequences are X-linked hyper-IgM syndrome (XHIM), a primary immunodeficiency disorder characterized by low levels of IgG, IgA, and elevated or normal levels of IgM. Mutated CD40L can no longer bind CD40 nor provide signals for B cells to proliferate and to switch from IgM to other immunoglobulin isotypes. When considering gene therapy for XHIM, it is important to address the possibility that the mutated CD40L associates with transduced wild type CD40L, and as a consequence, immune reconstitution is not attained. In this study, we demonstrate that the various mutated CD40L species we have identified in patients with XHIM, including both full-length and truncated mutants, associate with wild type CD40L on the cell surface of co-transfected COS cells. The association between wild type and mutated CD40L was also observed in CD4+ T cell lines established from XHIM patients with leaky splice site mutations. The clinical phenotype of these patients suggests that this association between wild type and mutated CD40L species may result in less efficient cross-linking of CD40. CD40 ligand (CD40L) 1The abbreviations used are: CD40L, CD40 ligand; AP, antisense primer; CD30L, CD30 ligand; DMEM, Dulbecco's modified Eagle's medium; FasL, Fas ligand; FCS, fetal calf serum; mAb, monoclonal antibody; MFI, mean fluorescence intensity; nt, nucleotide number; PBS, phosphate-buffered saline; PMSF, phenylmethylsulfonyl fluoride; RT-PCR, reverse transcription-polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; SP, sense primer; TNF, tumor necrosis factor; XHIM, X-linked hyper-IgM syndrome.(CD154, gp39, or TRAP) is a type II membrane glycoprotein, consisting of 261 amino acid residues, and is expressed mainly on activated CD4+ T cells (1Hollenbaugh D. Grosmaire L.S. Kullas C.D. Chalupny N.J. Braesch-Andersen S. Noelle R.J. Stamenkovic I. Ledbetter J.A. Aruffo A. EMBO J. 1992; 11: 4313-4321Crossref PubMed Scopus (499) Google Scholar, 2Spriggs M.K. Armitage R.J. Strockbine L. Clifford K.N. Macduff B.M. Sato T.A. Maliszewski C.R. Fanslow W.C. J. Exp. Med. 1992; 176: 1543-1550Crossref PubMed Scopus (392) Google Scholar). The natural receptor for CD40L is CD40, a member of the TNF receptor superfamily, expressed on a variety of cells including B cells, macrophages/monocytes, dendritic cells, vascular endothelial cells, and epithelial cells (3Stout R.D. Suttles J. Immunol. Today. 1996; 17: 487-491Abstract Full Text PDF PubMed Scopus (257) Google Scholar). The interaction between CD40L and CD40 therefore plays a crucial role in the immune system (3Stout R.D. Suttles J. Immunol. Today. 1996; 17: 487-491Abstract Full Text PDF PubMed Scopus (257) Google Scholar, 4Grewal I.S. Flavell R.A. Immunol. Today. 1996; 17: 410-414Abstract Full Text PDF PubMed Scopus (297) Google Scholar). The cross-linking of CD40 by CD40L induces a signal for B cells to undergo proliferation and immunoglobulin isotype switching and to escape apoptosis (3Stout R.D. Suttles J. Immunol. Today. 1996; 17: 487-491Abstract Full Text PDF PubMed Scopus (257) Google Scholar, 4Grewal I.S. Flavell R.A. Immunol. Today. 1996; 17: 410-414Abstract Full Text PDF PubMed Scopus (297) Google Scholar). In addition, CD40L-CD40 interaction influences many aspects of T cell-mediated inflammatory responses, such as up-regulation of adhesion molecules, cell extravasation, production of inflammatory cytokines and chemokines, as well as activation of macrophage effector function (3Stout R.D. Suttles J. Immunol. Today. 1996; 17: 487-491Abstract Full Text PDF PubMed Scopus (257) Google Scholar). The physiologic significance of the CD40L-CD40 interaction has been underscored by the observation that mutations of the CD40Lgene cause X-linked hyper-IgM syndrome (XHIM) (5Aruffo A. Farrington M. Hollenbaugh D. Li X. Milatovich A. Nonoyama S. Bajorath J. Grosmaire L.S. Stenkamp R. Neubauer M. Roberts R.L. Noelle R.J. Ledbetter J.A. Francke U. Ochs H.D. Cell. 1993; 72: 291-300Abstract Full Text PDF PubMed Scopus (752) Google Scholar, 6Korthäuer U. Graf D. Mages H.W. Brière F. Padayachee M. Malcolm S. Ugazio A.G. Notarangelo L.D. Levinsky R.J. Kroczek R.A. Nature. 1993; 361: 539-541Crossref PubMed Scopus (648) Google Scholar, 7Fuleihan R. Ramesh N. Loh R. Jabara H. Rosen F.S. Chatila T. Fu S.M. Stamenkovic I. Geha R.S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2170-2173Crossref PubMed Scopus (357) Google Scholar, 8DiSanto J.P. Bonnefoy J.Y. Gauchat J.F. Fischer A. De Saint Basile G. Nature. 1993; 361: 541-543Crossref PubMed Scopus (651) Google Scholar, 9Allen R.C. Armitage R.J. Conley M.E. Rosenblatt H. Jenkins N.A. Copeland N.G. Bedell M.A. Edelhoff S. Disteche C.M. Simoneaux D.K. Fanslow W.C. Belmont J. Spriggs M.K. Science. 1993; 259: 990-993Crossref PubMed Scopus (768) Google Scholar), a primary immunodeficiency disorder characterized by low or absence of IgG, IgA, and IgE and normal or elevated IgM. Mutations of the CD40Lgene identified in XHIM patients are highly heterogeneous. They include missense, nonsense, and splice site mutations, and insertions or deletions (10Notarangelo L.D. Peitsch M.C. Immunol. Today. 1996; 17: 511-516Abstract Full Text PDF PubMed Scopus (102) Google Scholar, 11Seyama K. Nonoyama S. Gangsaas I. Hollenbaugh D. Pabst H.F. Aruffo A. Ochs H.D. Blood. 1998; 92: 2421-2434Crossref PubMed Google Scholar), and are distributed throughout the CD40Lgene which consists of 5 exons and 4 introns and spreads over 12 kilobase pairs in genomic DNA (12Villa A. Notarangelo L.D. DiSanto J.P Macchi P.P. Strina D. Frattini A. Lucchini F. Patrosso C.M. Giliani S. Mantuano E. Agosti S. Nocera G. Kroczek R.A. Fischer A. Ugazio A.G. De Saint Basile G. Vezzoni P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2110-2114Crossref PubMed Scopus (65) Google Scholar, 13Seyama K. Kira S. Ishidoh K. Souma S. Miyakawa T. Kominami E. Hum. Genet. 1996; 97: 180-185Crossref PubMed Scopus (16) Google Scholar). More than 75 unique mutations have been reported to date (10Notarangelo L.D. Peitsch M.C. Immunol. Today. 1996; 17: 511-516Abstract Full Text PDF PubMed Scopus (102) Google Scholar, 11Seyama K. Nonoyama S. Gangsaas I. Hollenbaugh D. Pabst H.F. Aruffo A. Ochs H.D. Blood. 1998; 92: 2421-2434Crossref PubMed Google Scholar). In most instances, the mutated CD40L on the cell surface of activated T cells is undetectable if anti-CD40L monoclonal antibodies (mAbs) or CD40-Ig, a fusion protein consisting of the extracellular domain of CD40 and the Fc portion of human immunoglobulin G, are used. However, if a polyclonal anti-CD40L antiserum is used, the expression of mutated CD40L by activated T cells is detected in the majority of XHIM patients (11Seyama K. Nonoyama S. Gangsaas I. Hollenbaugh D. Pabst H.F. Aruffo A. Ochs H.D. Blood. 1998; 92: 2421-2434Crossref PubMed Google Scholar). CD40L is a member of the TNF superfamily that includes TNF-α, TNF-β, Fas ligand (FasL), and CD30 ligand (CD30L) (14Beutler B. van Huffel C. Science. 1994; 264: 667-668Crossref PubMed Scopus (420) Google Scholar). Based on x-ray crystallographic structures available for TNF-α (15Jones E.Y. Stuart D.I. Walker N.P.C. Nature. 1989; 338: 225-228Crossref PubMed Scopus (482) Google Scholar, 16Eck M.J. Sprang S.R. J. Biol. Chem. 1989; 264: 17595-17605Abstract Full Text PDF PubMed Google Scholar), TNF-β (17Eck M.J. Ultsch M. Rinderknecht E. De Vos A.M. Sprang S.R. J. Biol. Chem. 1992; 267: 2119-2122Abstract Full Text PDF PubMed Google Scholar, 18Banner D.W. D'Acry A. Janes W. Gentz R. Schoenfeld H.-J. Broger C. Loetscher H. Lesslauer W. Cell. 1993; 73: 431-445Abstract Full Text PDF PubMed Scopus (989) Google Scholar), and CD40L (19Karpusas M. Hsu Y.M. Wang J.H. Thompson J. Lederman S. Chess L. Thomas D. Structure. 1995; 3: 1031-1039Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar), it appears that members of the TNF superfamily characteristically form homotrimers consisting of three monomers, each folding with a “jelly roll” topology (15Jones E.Y. Stuart D.I. Walker N.P.C. Nature. 1989; 338: 225-228Crossref PubMed Scopus (482) Google Scholar, 16Eck M.J. Sprang S.R. J. Biol. Chem. 1989; 264: 17595-17605Abstract Full Text PDF PubMed Google Scholar, 19Karpusas M. Hsu Y.M. Wang J.H. Thompson J. Lederman S. Chess L. Thomas D. Structure. 1995; 3: 1031-1039Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). Most of the TNF superfamily members exist in both membrane-anchored and soluble forms due to proteolytic cleavage (20Graf D. Muller S. Korthauer U. van Kooten C. Weise C. Kroczek R.A. Eur. J. Immunol. 1995; 25: 1749-1754Crossref PubMed Scopus (226) Google Scholar, 21Pietravalle F. Lecoanet-Henchoz S. Blasey H. Aubry J.P. Elson G. Edgerton M.D. Bonnefoy J.-Y. Gauchat J.-F. J. Biol. Chem. 1996; 271: 5965-5967Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 22Dhein J. Walczak H. Baumler C. Debatin K.M. Krammer P.H. Nature. 1995; 373: 438-441Crossref PubMed Scopus (1609) Google Scholar), except for the TNF-β homotrimer which is expressed only as soluble form. Heterotrimer formation is known only among lymphotoxin β and TNF-β (23Androlewicz M.J. Browning J.L. Ware C.F. J. Biol. Chem. 1992; 267: 2542-2547Abstract Full Text PDF PubMed Google Scholar, 24Browning J.L. Ngam-ek A. Lawton P. DeMarinis J. Tizard R. Chow E.P. Hession C. O'Brine-Greco B. Foley S.F. Ware C.F. Cell. 1993; 72: 847-856Abstract Full Text PDF PubMed Scopus (437) Google Scholar). Each trimer, e.g. TNF-β and CD40L, can bind three molecules of the counter-receptor along the surface groove between two adjacent subunits (18Banner D.W. D'Acry A. Janes W. Gentz R. Schoenfeld H.-J. Broger C. Loetscher H. Lesslauer W. Cell. 1993; 73: 431-445Abstract Full Text PDF PubMed Scopus (989) Google Scholar, 25Bajorath J. Chalupny N.J. Marken J.S. Siadak A.W. Skonier J. Gordon M. Hollenbaugh D. Noelle R.J. Ochs H.D. Aruffo A. Biochemistry. 1995; 34: 1833-1844Crossref PubMed Scopus (69) Google Scholar, 26Bajorath J. Marken J.S. Chalupny N.J. Spoon T.L. Siadak A.W. Gordon M. Noelle R.J. Hollenbaugh D. Aruffo A. Biochemistry. 1995; 34: 9884-9892Crossref PubMed Scopus (55) Google Scholar), leading to receptor clustering or aggregation required for activation signaling into the target cells (18Banner D.W. D'Acry A. Janes W. Gentz R. Schoenfeld H.-J. Broger C. Loetscher H. Lesslauer W. Cell. 1993; 73: 431-445Abstract Full Text PDF PubMed Scopus (989) Google Scholar, 27Hsu Y.-M. Lucci J. Su L. Ehrenfels B. Garber E. Thomas D. J. Biol. Chem. 1997; 272: 911-915Crossref PubMed Scopus (46) Google Scholar, 28Kayagaki N. Kawasaki A. Ebata T. Ohmoto H. Ikeda S. Inoue S. Yoshino K. Okumura K. Yagita H. J. Exp. Med. 1995; 182: 1777-1783Crossref PubMed Scopus (778) Google Scholar). When considering gene therapy for XHIM patients, the possibility of an association between the transduced wild type CD40L and the patient's mutated CD40L resulting in heterotrimer formation has to be addressed. Since two CD40L monomers contribute to form one functional CD40-binding site (25Bajorath J. Chalupny N.J. Marken J.S. Siadak A.W. Skonier J. Gordon M. Hollenbaugh D. Noelle R.J. Ochs H.D. Aruffo A. Biochemistry. 1995; 34: 1833-1844Crossref PubMed Scopus (69) Google Scholar, 26Bajorath J. Marken J.S. Chalupny N.J. Spoon T.L. Siadak A.W. Gordon M. Noelle R.J. Hollenbaugh D. Aruffo A. Biochemistry. 1995; 34: 9884-9892Crossref PubMed Scopus (55) Google Scholar), the association of wild type CD40L monomer with mutated CD40L monomer is expected to generate decreased numbers of CD40-binding sites and, consequently, render the heterotrimer less efficient in clustering CD40. In this study, the association of wild type CD40L with various mutated CD40L species isolated from XHIM patients is demonstrated in transfected COS cells and in activated T cell lines established from XHIM patients with different splice site mutations. COS cells, murine IgG1 anti-human CD40L monoclonal antibody 106 (mAb 106), and biotinylated mAb 106 (bio-106), rabbit anti-human CD40L antiserum, and the CD40-Ig construct consisting of the extracellular domain of CD40 fused with the Fc region of human IgG1 were provided by Dr. Diane Hollenbaugh (Bristol-Myers Squibb). COS cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% heat-inactivated fetal calf serum (FCS) (HyClone, Logan, UT), 2 mm glutamine, 100 units/ml penicillin, and 100 μg/ml of streptomycin. Murine anti-CD40L mAb 5c8 (IgG2a) and Rb784, a rabbit antiserum (27Hsu Y.-M. Lucci J. Su L. Ehrenfels B. Garber E. Thomas D. J. Biol. Chem. 1997; 272: 911-915Crossref PubMed Scopus (46) Google Scholar) recognizing the N-terminal 15 amino acids of CD40L, were provided by Biogen Inc. (Cambridge, MA). Murine anti-Flag mAbs, M5 (IgG1), and biotinylated M5 (bio-M5), were purchased from Eastman Kodak Co.). Murine anti-human FasL mAb NOK1 (IgG1) (28Kayagaki N. Kawasaki A. Ebata T. Ohmoto H. Ikeda S. Inoue S. Yoshino K. Okumura K. Yagita H. J. Exp. Med. 1995; 182: 1777-1783Crossref PubMed Scopus (778) Google Scholar) was a generous gift from Dr. Hideo Yagita (Juntendo University, Tokyo, Japan) and murine anti-human CD30L mAbs, M80 (IgG2b), M81 (IgG2b), and M82 (IgG2a) were provided by Immunex Corp. (Seattle, WA). Interleukin-2-dependent CD4+ T cell lines (>90% CD4+) were prepared from T cell lines established from XHIM patients using a magnetic cell sorting system (Miltenyi Biotec Inc., Auburn, CA) and maintained in Yssel's medium (Gemini Biological Products, Calabasas, CA) supplemented with 8% heat-inactivated FCS, 2% heat-inactivated human AB serum (Gemini Biological Products), 100 units/ml penicillin, and 100 μg/ml streptomycin according to standard methods. A schematic representation of the protein structures we expressed in COS cells and the arbitrary designation of each plasmid and corresponding protein are shown in Fig. 1 and TableI, respectively. All of the expression plasmids were constructed by reverse transcription-polymerase chain reaction (RT-PCR) with Pfu DNA polymerase (Stratagene, La Jolla, CA) using cDNA isolated from activated peripheral blood mononuclear cells derived from a healthy volunteer or from selected XHIM patients (11Seyama K. Nonoyama S. Gangsaas I. Hollenbaugh D. Pabst H.F. Aruffo A. Ochs H.D. Blood. 1998; 92: 2421-2434Crossref PubMed Google Scholar). The human CD40L cDNA consisting of nt 1–807 (nucleotide numbering is based on the sequence data of Diane Hollenbaugh et al. (1Hollenbaugh D. Grosmaire L.S. Kullas C.D. Chalupny N.J. Braesch-Andersen S. Noelle R.J. Stamenkovic I. Ledbetter J.A. Aruffo A. EMBO J. 1992; 11: 4313-4321Crossref PubMed Scopus (499) Google Scholar)) was amplified by RT-PCR using sense primer (SP) 1 (5′CGCGGATCCATTTCAACTTTAACACAGC3′, recognition sequence underlined) and antisense primer (AP) 1 (5′GCGCTCGAGTCAGAGTTTGAGTAAGCCAAAGG3′), and subsequently cloned into BamHI andXhoI sites of pcDNA3.1/Zeo(+) (Invitrogen, Carlsbad, CA). Naturally occurring mutant cDNAs, exon 2-skipped cDNA, 19 nucleotides of intron 2-inserted cDNA, and exon 3-skipped cDNA, were similarly cloned into pcDNA3.1/Zeo(+) using cDNA generated from the appropriate XHIM patients. The expression vector of the CD40L lacking the cytoplasmic domain (CytDel, Met21-Leu261) was generated using SP2 (5′CGCGGATCCATTTCAACTTTAACACAGCATGAAAATTTTTATGTATTTAC3′) and AP1 and cloned into BamHI and XhoI sites of pcDNA3.1/Zeo(+). The expression vectors of Flag-tagged wild type and the naturally occurring mutant CD40L were generated by RT-PCR using primers SP3 (5′CGCGGATCCATTTCAACTTTAACACAGCATGGATTACAAGGACGATGACGACAAGATCGAAACATACAACCAAACTTC3′) and AP1, cloned into the same vector; Flag peptides consisting of DKYDDDDL were inserted between Met1 and Ile2 of wild type or mutant CD40L. In constructing pF-L258S, AP2 (5′GCGCTCGAGTCAGAGTTTGAGTGAGCCAAAGG3′) was designed to have a missense mutation within the antisense primer sequence and was used for amplification instead of AP1. The Flag-tagged expression vector, pF-Stalk, expressing the remainder of the CD40L molecule after the extracellular domain of CD40L (Gln114-Leu261) had been cleaved off (20Graf D. Muller S. Korthauer U. van Kooten C. Weise C. Kroczek R.A. Eur. J. Immunol. 1995; 25: 1749-1754Crossref PubMed Scopus (226) Google Scholar, 21Pietravalle F. Lecoanet-Henchoz S. Blasey H. Aubry J.P. Elson G. Edgerton M.D. Bonnefoy J.-Y. Gauchat J.-F. J. Biol. Chem. 1996; 271: 5965-5967Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar) was constructed using SP3 and AP3 (5′GCGCTCGAGTCACTACATTTCAAAGCTGTTTTCTTTC3′). The control expression vectors, pF-HybFasL and pF-HybCD30L, expressing a Flag-tagged fusion protein consisting of the cytoplasmic and transmembrane domains of CD40L and the extracellular domain of FasL (Gln103-Leu281) (29Takahashi T. Tanaka M. Inazawa J. Abe T. Suda T. Nagata S. Int. Immunol. 1994; 6: 1567-1574Crossref PubMed Scopus (420) Google Scholar) and CD30L (Gln63-Asp234) (30Smith C.A. Gruss H.J. Davis T. Anderson D. Farrah T. Baker E. Sutherland G.R. Brannan C.I. Copeland N.G. Jenkins N.A. Grabstein K.H. Gliniak B. McAlister I.B. Fanslow W. Anderson M. Falk B. Gimpel S. Gillis S. Din W.S. Goodwin R.G. Armitage R.J. Cell. 1993; 73: 1349-1360Abstract Full Text PDF PubMed Scopus (515) Google Scholar), respectively, were constructed as follows. The coding sequence of cytoplasmic and transmembrane domains of CD40L was amplified by RT-PCR using SP4 (5′ATAAGAATGCGGCCGCATTTCAACTTTAACACAGCATGGATTACAAGGACGATGACGACAAGATCGAAACATACAACCAAACTTC3′) and AP4 (5′CGCGGATCCCGAAGATACACAGCAAAAAGTGCTG3′) and subsequently cloned into NotI and BamHI sites of pcDNA3.1/Zeo(+). The coding sequences of the extracellular domain of the FasL and CD30L were amplified by PCR using SP5 (5′CGCGGATCCACAGCTCTTCCACCTACAGAAGGAG3′) and AP5 (5′GCGCTCGAGTTAGAGCTTATATAAGCCGAAAAACGTCTG3′) for FasL and SP6 (5′CGCGGATCCACAGAGGACGGACTCCATTCC3′) and AP6 (5′GCGCTCGAGTCAGTCTGAATTACTGTATAAG3′) for CD30L, respectively, and then fused into BamHI and XhoI sites of the pcDNA3.1/Zeo(+) into which the coding sequence of the cytoplasmic and transmembrane domains of CD40L had already been cloned. All expression vectors were sequenced to verify the correct nucleotide sequences.Table IExpression plasmids and structural feature of proteins expressed by plasmidsPlasmidFlag tagExpressed proteinStructure and feature of protein1N-Flag means that Flag peptide (DKYDDDDL) was added at the N terminus of protein and preceded by initiation methionine.1.pWild−Wild type CD40LWild type CD40L (Met1–Leu261)2.pCytDel−CytDelMet21–Leu261 of wild type CD40L3.pF-Wild+F-WildN-Flag + wild type CD40L (Ile2–Leu261)4.pF-Stalk+F-StalkN-Flag + Ile2–Met113 of wild type CD40L5.pF-DM+F-DMN-Flag + CD40L with S128R and E129GpF-T147N+F-T147NN-Flag + CD40L with T147NpF-Y170C+F-Y170CN-Flag + CD40L with Y170CpF-G227V+F-G227VN-Flag + CD40L with G227VpF-A235P+F-A235PN-Flag + CD40L with A235PpF-T254M+F-T254MN-Flag + CD40L with T254MpF-L258S+F-L258SN-Flag + CD40L with L258S6.pF-W140X+F-W140XN-Flag + CD40L with W140X7.pF-Q186X+F-Q186XN-Flag + CD40L with Q186X8.pE2skip−E2skipIn-frame deletion from Ile53 to Lys96 of CD40L9.pE2ins−E2insMet1–Lys96 of CD40L + 21 extra amino acids10.pF-E2ins+F-E2insN-Flag + Ile2–Lys96 of CD40L + 21 extra amino acids11.pE3skip−E3skipMet1–Lys96 of CD40L + 11 extra amino acids12.pF-E3skip−F-E3skipN-Flag + Ile2–Lys96 of CD40L + 11 extra amino acids13.pF-HybFasL+F-HybFasLN-Flag + Ile2–Leu46 of CD40L + Gln103–Leu281of FasIpF-HybCD30L+F-HybCD3OLN-Flag + Ile2–Leu46 of CD40L + Gln63–Asp234 of CD30LExpression plasmids and proteins expressed by them when transfected to COS cells were named arbitrarily for convenience on explaining the experimental results. See also Fig. 1 since the numbers in the left column correspond to those of Fig. 1 in which structure of protein is shown schematically.a N-Flag means that Flag peptide (DKYDDDDL) was added at the N terminus of protein and preceded by initiation methionine. Open table in a new tab Expression plasmids and proteins expressed by them when transfected to COS cells were named arbitrarily for convenience on explaining the experimental results. See also Fig. 1 since the numbers in the left column correspond to those of Fig. 1 in which structure of protein is shown schematically. COS cells were electroporated with supercoiled expression plasmid under the following conditions: 10 μg of plasmid and 4 × 106 cells were mixed in 0.4 ml of serum- and antibiotic-free DMEM and electroporated at 210 V and 960 microfarads using GenePulser (Bio-Rad). Forty eight hours after electroporation, cells were harvested after incubation in phosphate-buffered saline (PBS), 0.5% bovine serum albumin, 5 mm EDTA for 10 min and used either to examine surface expression of the transduced gene product by flow cytometry or to biochemically characterize the expressed proteins. Forty eight hours after electroporation, cells were harvested as described above. When co-transfection with an expression plasmid of wild type CD40L (pWild) and of a CD40L mutant was intended, 5 μg of each plasmid was mixed and electroporated under the same conditions. Cells were resuspended at a concentration of 5 × 106/ml and kept for 30 min on ice in lysis buffer containing 1% Triton X-100, 10 mmTris-HCl (pH 7.5), 150 mm NaCl, 0.025% NaN3, freshly supplemented with 200 μg/ml phenylmethylsulfonyl fluoride (Sigma), 10 μg/ml aprotinin (Roche Molecular Biochemicals), 10 μg/ml leupeptin (Roche Molecular Biochemicals), and 10 mmiodoacetamide (Sigma). For surface biotinylation, cells were washed with PBS twice, suspended at 5 × 106/ml in PBS, and Sulfo-NHS-biotin (Pierce) added to a final concentration of 500 μg/ml. Cells were incubated for 30 min with rotation at room temperature and then lysed. The lysate was cleared by centrifugation at 14,000 × g for 10 min at 4 °C. Protein concentration was measured using Bio-Rad DC Protein Assay (Bio-Rad) and bovine γ-globulin as standard. The lysate was adjusted to 200 μg of protein in 200 μl of lysis buffer and precleared overnight with 20 μl of protein G-Sepharose or protein A-Sepharose (50% slurry) (Pierce) at 4 °C, followed by immunoprecipitation with 3 μg of specific antibody or 5 μg of CD40-Ig for 1.5 h at 4 °C. The immune complexes were collected using 10 μl of protein G-Sepharose or protein A-Sepharose. The Sepharose beads were washed three times with 0.1% Triton X-100, 10 mm Tris-HCl (pH 7.5), 150 mm NaCl, 0.025% NaN3, followed by a single wash with 10 mm Tris-HCl (pH 7.5), 150 mm NaCl, 0.025% NaN3, and with 50 mm Tris-HCl (pH 6.8). The Sepharose beads-absorbed immune complexes were treated with 20 μl of 2× Laemmli's sample buffer containing β-mercaptoethanol and were incubated for 5 min in boiling water. The eluted proteins were resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The Sepharose beads-absorbed immune complexes were suspended in 20 μl of 0.5% SDS, 0.1 m β-mercaptoethanol and incubated for 5 min in boiling water. After centrifugation, the supernatant was mixed with or without 5 units of protease-free N-glycosidase F (Roche Molecular Biochemicals) in a total volume of 60 μl containing 50 mm sodium phosphate buffer (pH 7.2), 1%n-octyl glucoside (Roche Molecular Biochemicals) and incubated for 18 h at 37 °C. The reaction mixture was then treated with 12 μl of 6× Laemmli's sample buffer containing β-mercaptoethanol for 5 min in boiling water and resolved by SDS-PAGE. Following immunoprecipitation from the lysate of transfected COS cells, proteins were resolved on SDS-PAGE and transferred to an Immobilon™-P membrane (Millipore Corp., Bedford, MA). The blotted membrane was incubated in a blocking solution containing 5% blocking non-fat milk (Bio-Rad) in 20 mmTris-HCl (pH 7.6), 137 mm NaCl, 0.1% Tween 20 (TBS-T), for 2 h at room temperature or overnight at 4 °C and then probed with a specific antibody at 2 μg/ml in blocking solution for 1 h at room temperature. Membranes were washed three times with TBS-T and then incubated with TBS-T containing 1:2000-diluted streptavidin-horseradish peroxidase conjugate (Life Technologies, Inc.) or 1:5000-diluted goat anti-rabbit immunoglobulin-horseradish peroxidase conjugate (BioSource International) for 1 h at room temperature. After washing three times with TBS-T, proteins recognized by the specific antibody were visualized by the ECL system (Amersham Pharmacia Biotech) according to the manufacturer's instructions. Metabolic radiolabeling of activated interleukin-2-dependent CD4+ T cell lines was performed in Met/Cys-free RPMI 1640 medium (Sigma) supplemented with 10% dialyzed heat-inactivated FCS, 100 units/ml penicillin, and 100 μg/ml streptomycin. CD4+ T cells were suspended at 5 × 106 cells/ml in labeling medium containing 0.2 mCi/ml EXPRE35S35S (NEN Life Science Products) and activated with 1 μg/ml ionomycin and 10 ng/ml phorbol 12-myristate 13-acetate (Sigma) for 4 h at 37 °C. Radiolabeled cells were lysed at 5 × 107 cells/ml in lysis buffer. The resultant lysate was precleared and immunoprecipitated as described above. Proteins were resolved by 13% SDS-PAGE, and fluorography was performed using ENTENSIFY™ (NEN Life Science Products) according to the manufacturer's instruction. For metabolic radiolabeling of transiently transfected COS cells, the cells were washed 36 h after transfection with PBS and incubated in Met/Cys-free DMEM (Sigma) supplemented with 5% dialyzed heat-inactivated FCS, 100 units/ml penicillin, 100 μg/ml streptomycin, and 0.2 mCi/ml EXPRE35S35S for 4 h and processed similarly. Surface expression of wild type CD40L, mutant CD40L species, and control hybrid proteins (F-HybFasL and F-HybCD30L) by transfected COS cells was confirmed by flow cytometry (data not shown). Wild type CD40L and Flag-tagged wild type CD40L (F-Wild) were expressed abundantly by transfected COS cells and detected by mAb 5c8 as well as CD40-Ig construct, suggesting that the Flag peptide at the N terminus does not affect the structure and function of CD40L. Two unique truncated mutants, CytDel and E2skip, both found in XHIM patients (11Seyama K. Nonoyama S. Gangsaas I. Hollenbaugh D. Pabst H.F. Aruffo A. Ochs H.D. Blood. 1998; 92: 2421-2434Crossref PubMed Google Scholar), were detected in transfected COS cells using mAb 5c8 and the CD40-Ig construct, respectively. The expression of other mutated CD40L species, including mutants with amino acid substitutions and truncated mutants, was confirmed by the binding of a polyclonal anti-CD40L antiserum. Similarly, both F-HybFasL and F-HybCD30L expressed by transfected COS cells were detected well by mAb NOK1 and three different anti-CD30L mAb preparations (M80, M81, and M82), respectively. Since NOK1 recognizes the antigenic epitope consisting of two FasL monomers, it seems likely that F-HybFasL retains the inherent structural integrity of FasL and forms a trimer. The finding that F-HybCD30L expression was detectable by three different anti-CD30L mAbs suggests that this hybrid construct also retains the inherent structural integrities of CD30L and forms a trimer. The biochemical characteristics of proteins expressed by COS cells transfected with pWild, pCytDel, and pF-Wild were analyzed by immunoprecipitation followed by Western blotting. From COS cells transfected with pWild, CD40-Ig immunoprecipitated two CD40L species, one with an apparent molecular mass of 33 kDa (p33) and the other of 31 kDa (p31) when probed with mAb bio-106. CD40Ls obtained from pCytDel-transfected cells were found to have an apparent molecular mass of 29 (p29) and 27 kDa (p27), and those obtained from pF-Wild-transfected COS cells had a molecular mass of 34 (p34), 32 kDa (p32), and p29, respectively (Fig.2 A). Because CD40L has two potential N-glycosylation sites, one in the cytoplasmic domain and the other in the C terminus of the TNF homology (TNFH) domain, N-glycosidase F treatment was performed to determine whether glycosylation contributes to the existence of multiple species of CD40L. After deglycosylation, p31 and p27 were detected in pWild-transfected cells, a single band, p27, in pCytDel-transfected cells, and p32 and p27 in pF-Wild-transfected cells (Fig.2 A). These results suggest that COS cells express full-length CD40L as well as CD40L lacking the cytoplasmic domain and that both species exist in glycosylated (p33, p29, respectively) and unglycosylated forms (p31, p27, respectively) when transfected with pWild. This interpretation was further supported by the results of probing the same preparation with Rb784 (Fig. 2

Referência(s)