Molecular Profiling of Giant Cell Tumor of Bone and the Osteoclastic Localization of Ligand for Receptor Activator of Nuclear Factor κB
2005; Elsevier BV; Volume: 167; Issue: 1 Linguagem: Inglês
10.1016/s0002-9440(10)62959-8
ISSN1525-2191
AutoresTeresa Morgan, Gerald J. Atkins, Melanie Trivett, Sandra Johnson, Maya Kansara, Stephen L. Schlicht, John Slavin, Paul J. Simmons, Ian C. Dickinson, Gerald F. Powell, Peter Choong, Andrew Holloway, David M. Thomas,
Tópico(s)Bone health and treatments
ResumoGiant cell tumor of bone (GCT) is a generally benign, osteolytic neoplasm comprising stromal cells and osteoclast-like giant cells. The osteoclastic cells, which cause bony destruction, are thought to be recruited from normal monocytic pre-osteoclasts by stromal cell expression of the ligand for receptor activator of nuclear factor κB (RANKL). This model forms the foundation for clinical trials in GCTs of novel cancer therapeutics targeting RANKL. Using expression profiling, we identified both osteoblast and osteoclast signatures within GCTs, including key regulators of osteoclast differentiation and function such as RANKL, a C-type lectin, osteoprotegerin, and the wnt inhibitor SFRP4. After ex vivo generation of stromal- and osteoclast-enriched cultures, we unexpectedly found that RANKL mRNA and protein were more highly expressed in osteoclasts than in stromal cells, as determined by expression profiling, flow cytometry, immunohistochemistry, and reverse transcriptase-polymerase chain reaction. The expression patterns of molecules implicated in signaling between stromal cells and monocytic osteoclast precursors were analyzed in both primary and fractionated GCTs. Finally, using array-based comparative genomic hybridization, neither GCTs nor the derived stromal cells demonstrated significant genomic gains or losses. These data raise questions regarding the role of RANKL in GCTs that may be relevant to the development of molecularly targeted therapeutics for this disease. Giant cell tumor of bone (GCT) is a generally benign, osteolytic neoplasm comprising stromal cells and osteoclast-like giant cells. The osteoclastic cells, which cause bony destruction, are thought to be recruited from normal monocytic pre-osteoclasts by stromal cell expression of the ligand for receptor activator of nuclear factor κB (RANKL). This model forms the foundation for clinical trials in GCTs of novel cancer therapeutics targeting RANKL. Using expression profiling, we identified both osteoblast and osteoclast signatures within GCTs, including key regulators of osteoclast differentiation and function such as RANKL, a C-type lectin, osteoprotegerin, and the wnt inhibitor SFRP4. After ex vivo generation of stromal- and osteoclast-enriched cultures, we unexpectedly found that RANKL mRNA and protein were more highly expressed in osteoclasts than in stromal cells, as determined by expression profiling, flow cytometry, immunohistochemistry, and reverse transcriptase-polymerase chain reaction. The expression patterns of molecules implicated in signaling between stromal cells and monocytic osteoclast precursors were analyzed in both primary and fractionated GCTs. Finally, using array-based comparative genomic hybridization, neither GCTs nor the derived stromal cells demonstrated significant genomic gains or losses. These data raise questions regarding the role of RANKL in GCTs that may be relevant to the development of molecularly targeted therapeutics for this disease. Giant cell tumors of bone (GCT) are rare, usually benign connective tissue neoplasms characterized by localized bone destruction. They comprise osteoclast-like giant cells, stromal cells, and CD68-positive monocytes.1Golding SR Roelke MS Petrison KK Bhan AK Human giant cell tumor of bone: identification and characterisation of cell types.J Clin Invest. 1987; 79: 483-491Crossref PubMed Scopus (126) Google Scholar, 2Wulling M Kaiser E The origin of the neoplastic stromal cell in giant cell tumor of bone.Hum Pathol. 2003; 34: 983-993Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar The stromal cells are thought to be the neoplastic component of the tumor, as they can be propagated in culture and stain positive for the proliferation marker, Ki67.2Wulling M Kaiser E The origin of the neoplastic stromal cell in giant cell tumor of bone.Hum Pathol. 2003; 34: 983-993Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar There is evidence that the stromal cells are of the osteoblastic lineage2Wulling M Kaiser E The origin of the neoplastic stromal cell in giant cell tumor of bone.Hum Pathol. 2003; 34: 983-993Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 3Joyner CJ Quinn JM Triffit JT Owen ME Athanasou NA Phenotypic characterisation of mononuclear and multinucleated cells of giant cell tumor of bone.Bone Miner. 1992; 16: 37-48Abstract Full Text PDF PubMed Scopus (63) Google Scholar, 4James IE Dodds RA Olivera DL Nuttall ME Gowen M Human osteoclastoma-derived stromal cells: correlation of the ability to form mineralized nodules in vitro with formation of bone in vivo.J Bone Miner Res. 1996; 11: 1453-1460Crossref PubMed Scopus (54) Google Scholar and are thought to support the recruitment and formation of mature osteoclasts from precursor cells.5Atkins GJ Hayes DR Graves SE Evadokiou A Hay S Bouralexis S Findlay DM Expression of osteoclast differentiation signals by stromal elements of giant cell tumors.J Bone Miner Res. 2000; 15: 640-649Crossref PubMed Scopus (155) Google Scholar It is the bone resorptive activity of osteoclasts that causes the destructive osteolysis and consequent morbidity seen in GCT.6Boyle WJ Simonet SW Lacey DL Osteoclast differentiation and activation.Nature. 2003; 423: 337-342Crossref PubMed Scopus (4723) Google Scholar The molecules that mediate this interaction therefore represent potentially important therapeutic targets. Osteoclast differentiation and activation is critically dependent on the tumor necrosis factor (TNF) receptor/TNF-like proteins, osteoprotegerin (OPG), and ligand for receptor activator of nuclear factor κB (RANKL).5Atkins GJ Hayes DR Graves SE Evadokiou A Hay S Bouralexis S Findlay DM Expression of osteoclast differentiation signals by stromal elements of giant cell tumors.J Bone Miner Res. 2000; 15: 640-649Crossref PubMed Scopus (155) Google Scholar, 7Simonet WS Lacey DL Dunstan CR Kelley M Chang MS Luthy R Nguyen HQ Wooden S Bennet L Boone T Shimamoto G DeRose M Elliot R Colombero A Tan HL Trail TM Sullivan J Davy E Eucay N Renshaw-Gegg L Hughes TM Hill D Pattison W Campbell P Sander S Van G Tarpley J Derby P Lee R Boyle WJ Osteoprotegerin: a novel secreted protein involved in the regulation of bone density.Cell. 1997; 89: 309-319Abstract Full Text Full Text PDF PubMed Scopus (4261) Google Scholar, 8Yasuda H Shima N Nakagawa N Yamaguchi K Kinosaki M Mochizuki S Tomoyasu A Yano K Goto M Murakami A Tsuda E Morinaga T Higashio K Udagawa N Takahashi N Suda T Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis inhibitory factor and is identical to TRANCE/RANKL.Proc Natl Acad Sci USA. 1998; 95: 3597-3602Crossref PubMed Scopus (3500) Google Scholar RANKL expression has been observed in GCT-derived stromal cells,5Atkins GJ Hayes DR Graves SE Evadokiou A Hay S Bouralexis S Findlay DM Expression of osteoclast differentiation signals by stromal elements of giant cell tumors.J Bone Miner Res. 2000; 15: 640-649Crossref PubMed Scopus (155) Google Scholar and these cells support osteoclast formation in the RAW264.7 murine monocytic cell line.9Huang L Xu J Wood DJ Zheng MH Gene expression of osteoprotegerin ligand, osteoprotegerin, and receptor activator NF-κB in giant cell tumor of bone.Am J Pathol. 2000; 156: 761-767Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar These and other observations have led to the widely accepted proposition that the expression of RANKL by the neoplastic stromal cell causes the recruitment of osteoclasts.5Atkins GJ Hayes DR Graves SE Evadokiou A Hay S Bouralexis S Findlay DM Expression of osteoclast differentiation signals by stromal elements of giant cell tumors.J Bone Miner Res. 2000; 15: 640-649Crossref PubMed Scopus (155) Google Scholar Unexpectedly, the expression of RANKL mRNA and protein has been reported in osteoclasts, including GCTs.10Kartsogiannis V Zhou H Horwood NJ Thomas RJ Hards DK Quinn JMW Niforas P Ng KW Martin TJ Gillespie MT Localisation of RANKL (receptor activator of NFκB ligand) mRNA and protein in skeletal and extraskeletal tissues.Bone. 1999; 25: 525-534Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar, 11Roux S Amazit L Meduri G Guiochon-Mantel A Milgrom E Mariette X RANK (receptor activator of nuclear factor kappa B) and RANK ligand are expressed in giant cell tumors of bone.Am J Clin Pathol. 2002; 117: 210-216Crossref PubMed Scopus (133) Google Scholar Perhaps because of methodologic issues affecting immunohistochemical and in situ hybridization techniques, these incidental findings have not been widely appreciated, and their significance remains unclear. Because several cell types are involved in the genesis of GCT and a network of 60 proteins are involved in osteoclastogenesis,6Boyle WJ Simonet SW Lacey DL Osteoclast differentiation and activation.Nature. 2003; 423: 337-342Crossref PubMed Scopus (4723) Google Scholar elucidating the nature and sources of these molecules is important. To address this issue, we have undertaken genome-wide transcriptional profiling of GCTs. A number of studies have demonstrated the value of molecular profiling of connective tissue neoplasms in general, shedding light on the molecular identity of subclasses of this heterogeneous group of disorders.12Khan J Wei JS Ringner M Saal LH Ladanyi M Westermann F Schwab M Antonescu C Peterson C Meltzer PS Classification and diagnostic prediction of cancers using gene expression profiling and artificial neural networks.Nat Med. 2001; 7: 673-678Crossref PubMed Scopus (2104) Google Scholar, 13Nielsen TO West RB Linn SC Alter O Knowling MA O'Connell JX Zhu S Fero M Sherlock G Pollack JR Brown PO Botstein D van de Rijn M Molecular characterisation of soft tissue tumors: a gene expression study.Lancet. 2002; 359: 1301-1307Abstract Full Text Full Text PDF PubMed Scopus (482) Google Scholar, 14Segal NH Pavlidis P Antonescu CR Maki RG Noble WS DeSantis D Woodruff JM Lewis JJ Brennan MF Houghton AN Cordon-Cardo C Classification and subtype prediction of adult soft tissue sarcoma by functional genomics.Am J Pathol. 2003; 163: 691-700Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar Our studies have focused on human GCT within the context of 48 sarcomas. GCTs form a distinct group within soft-tissue sarcomas by unsupervised hierarchical clustering. After supervised clustering, we identified genes reported to be expressed in osteoclasts and osteoblasts. Identification of the molecules that modulate osteoclastogenesis using genetic profiling and functional assays may lead to the discovery of novel therapeutic targets. As expected, RANKL expression was high in GCTs, and its inhibitor (osteoprotegerin) showed low expression. Using ex vivo cellular fractionation methods, we generated osteoclast- and stromal cell-enriched fractions and unexpectedly found that RANKL expression was greater in the osteoclast-enriched hemopoietic fraction. This finding was confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR), flow cytometry, and immunohistochemistry, suggesting that the neoplastic component is derived from cells of the osteoclast lineage or that a molecule other than RANKL is responsible for osteoclast recruitment by the stromal cells or that both cell components are derived from a common precursor. Forty-eight primary tumor samples were obtained from the Tissue Bank at The Peter MacCallum Cancer Center and St Vincent's Hospital in Melbourne, Australia and the Princess Alexandra Hospital, Brisbane, Australia (Table 1). Separate Institutional Review Board approval was obtained for the collection of samples. The samples are stored at the tissue bank at The Peter MacCallum Cancer Center. Resected specimens underwent blinded pathological review by a dedicated sarcoma pathologist (JS) to ensure at least 80% viable tumor content. The samples obtained and arrayed are shown in Table 1.Table 1Tumor Type and Numbers of Each ArrayedTumor typeNo. arrayedMalignant fibrous histiocytoma11Liposarcoma15Leiomyosarcoma9Synovial cell sarcoma4Giant cell tumor of bone9 Open table in a new tab Tumor samples were added to Trizol reagent (1 ml per 25 mg of tissue) and homogenized for 30 seconds. The sample was then extracted in Trizol reagent, purified using the Qiagent RNeasy kit (Qiagen Ltd, Sussex, UK), and quantified by spectrophotometry. First-strand synthesis of cDNA was achieved using the Eberwine method.15Van Gelder RN von Zastrow ME Yool A Dement DC Barchas JD Eberwine JH Amplified RNA synthesized from limited quantities of heterogeneous cDNA.Proc Natl Acad Sci USA. 1990; 87: 1663-1667Crossref PubMed Scopus (1023) Google Scholar Briefly, total RNA (3 μg) was reverse transcribed to cDNA using a T7 promoter tagged anchored PolyT primer. Subsequently, second-strand synthesis was achieved using DNA polymerase I (40 U; Promega, Madison, WI), DNA ligase (10 U; Invitrogen, Carlsbad, CA), RNase H (2 U; Invitrogen), dNTP (10 mmol/L each) and 10× DNA polymerase I buffer with an incubation at 16°C for 2 hours. The double-stranded cDNA sample was then used as a template in an in vitro transcription reaction using a T7 Megascript kit (Ambion, Austin, TX) following the protocol supplied and then purified using an RNeasy column (Qiagen, Doncaster, Victoria, Australia). The sample was dry eluted to 12 μl using a vacuum centrifuge and quantified using a spectrophotometer. Amplified RNA (4–10 μg) was indirectly labeled by incorporation of amino allyl dUTP (Sigma, Sydney, Australia) during reverse transcription. The sample was then purified using the Qiagen QIAquick Purification kit as per the protocol provided with the exception that the sample is not eluted but left on the column for the subsequent coupling step. Cyanine-5 fluorophor (Amersham, Castle Hill, NSW, Australia) was resuspended in 20 μl of 0.1 mol/L Na bicarbonate buffer and added to the center of the column above for all of the test samples. Cyanine-3 fluorophor was used for a reference sample, which consists of pooled and amplified RNA from 11 human tumor cell lines.16Pollack JR RNA common reference sets.in: Bowtell DDL Sambrook J DNA Microarrays: A Molecular Cloning Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY2002: pp 168-172Google Scholar, 17Pollack JR Sorlie T Perou CM Rees CA Jeffrey SS Lonning PE Tibshirani R Botstein D Borresen-Dale AL Brown PO Microarray analysis reveals a major direct role of DNA copy number alteration in the transcriptional program of human breast tumors.Proc Natl Acad Sci USA. 2002; 99: 12963-12968Crossref PubMed Scopus (942) Google Scholar A 1-hour incubation of the column (in the dark) was then required. The sample was then eluted with 80 μl of water and 13,000 rpm for 1 minute. Five volumes of buffer PB (Qiagen QIAquick kit) was added to each sample. The eluted cyanine-3-coupled reference sample was added to a new Qiagen column, the eluate was discarded, and then the cyanine-5-coupled test sample was applied to the same column. It was washed with buffer PE, and the sample was eluted with buffer EB (Qiagen). A hybridization mix consisting of tRNA, cot-1 DNA, PolydA, and 50× Denharts containing herring sperm DNA was added to the eluted sample, and the sample was then concentrated in a centrifugal evaporator. Standard saline citrate (SSC; 20×) and 100% deionized formamide were added to the sample; it was denatured at 100°C for 3 minutes. Sodium dodecyl sulfate (10%) was then added, and the samples were ready to apply to the slide and hybridize for 14 to 16 hours in a humidified chamber at 42°C. The slides were then placed in 0.5× SSC and 0.01% sodium dodecyl sulfate until the coverslips came off and then incubated a further 1 minute in the same solution. The next wash was in 0.5% SSC for 3 minutes, and the final wash was in 0.06% SSC for 3 minutes. The slides were then centrifuged dry at 800 rpm for 5 minutes. All experiments were performed using two-color competitive hybridization of fluorescently labeled cDNA to a glass slide array. The cDNA microarrays used contain 9386 cDNA clones representing almost all named genes and several thousand additional expressed sequence tag clones (Unigene build no. 172). Each test sample was compared with a reference sample consisting of pooled RNA from 11 cell lines. The slides were scanned using an Agilent scanner and analyzed using Genepix Pro 4.1 and Genespring software (Silicon Genetics). The following transformations were applied to the raw data. First, adjustments were made for three dye-swapped GCT samples followed by locally weighted regression scatterplot smoothing normalization, and finally, all data were median normalized for gene expression. Spots flagged as absent in more than 3 of 48 samples were excluded from further analysis, yielding 6822 genes (supplemental data at http://ajp.amjpathol.org), and then these genes were filtered on the basis of raw signal (>300), yielding 3376 genes. For supervised hierarchical clustering, we applied Welch's analysis of variance with a P value cut-off of 0.05 and Bonferroni's multiple test correction to generate a list of 171 genes that reliably discriminated between histological subtypes (supplemental data at http://ajp.amjpathol.org). For experiments using osteoblast- and osteoclast-enriched cultures, filtered data were manually analyzed using Microsoft Excel (supplemental data at http://ajp.amjpathol.org). DNA was extracted from tumor samples or cell culture using standard protocols.18Strauss WM Preparation of genomic DNA from mammalian tissue.in: Ausubel FM Brent R Kingston RE Moore DD Smith JA Seidman JG Struhl S Current Protocols in Molecular Biology. John Wiley & Sons, New York1990: 2.2.1-2.2.3Google Scholar A total of 3 μg of DNA was sent to the Microarray Shared Resource at the Comprehensive Cancer Center, University of California, San Francisco, and subjected to array-based comparative genomic hybridization as previously described.19Snijders AM Norma Nowak N Segraves R Blackwood S Brown N Conroy J Hamilton G Hindle AK Huey B Kimura K Law S Myambo K Palmer J Ylstra B Yue JP Gray JW Jain AN Pinkel D Albertson DG Assembly of microarrays for genome-wide measurement of DNA copy number by CGH.Nat Genet. 2001; 29: 263-264Crossref PubMed Scopus (761) Google Scholar Selected GCT samples were subfractionated according to the method published by Atkins et al.5Atkins GJ Hayes DR Graves SE Evadokiou A Hay S Bouralexis S Findlay DM Expression of osteoclast differentiation signals by stromal elements of giant cell tumors.J Bone Miner Res. 2000; 15: 640-649Crossref PubMed Scopus (155) Google Scholar Briefly, GCT samples were used fresh, treated with collagenase, and cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. The cultured sample consisted of giant cells in a stromal cell mass. The stromal cell fraction was removed by trypsin digestion (0.1% w/v in phosphate-buffered saline (PBS)) and replated into a separate flask while the giant cells and mononuclear fan-shaped cells remained attached to the flask. After 48 hours, the process was repeated until giant cells were no longer seen in the stromal fraction, yielding a stromal cell-enriched fraction and a giant cell-enriched fraction. For bioassays of RANKL production, we used RAW264.7 cells, a monocytic cell line that forms osteoclasts in the presence of recombinant human RANKL.20Chin S-L Price JT Quinn JMW Mirosavljevic D Thomas DM A role for aV integrin subunit in osteoclastogenesis.Biochem Biophys Res Commun. 2003; 307: 1051-1058Crossref PubMed Scopus (13) Google Scholar Briefly, either supernatants from primary stromal cell cultures were added to RAW264.7 cells or stromal cells were co-cultured with RAW264.7 cells. RAW264.7 cells were then cultured for up to 10 days before staining for tartrate-resistant acid phosphatase (TRAP) as described previously.20Chin S-L Price JT Quinn JMW Mirosavljevic D Thomas DM A role for aV integrin subunit in osteoclastogenesis.Biochem Biophys Res Commun. 2003; 307: 1051-1058Crossref PubMed Scopus (13) Google Scholar Control cultures were conducted using recombinant human RANKL to ensure that these cells formed TRAP-positive osteoclast like cells. GCT, osteoblast, and osteoclast cDNAs were diluted 1 in 25, and 1 μL was used for PCR. cDNA was amplified using the PCR primers listed in Table 2 to generate mRNA products encoding the specific human genes. The 25-μL PCR reaction consisted of 1 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, CT), 0.4 mmol/L dNTPs (Pharmacia Biotech, Uppsala, Sweden), 1.5 mmol/L magnesium chloride, 50 nmol/L of each primer, and 1× PCR buffer and was made to volume with RNase-free water. The conditions used were: 95°C for 5 minutes to activate the polymerase and 40 cycles of 95°C for 30 seconds to denature, 50 to 56°C gradient for 30 seconds to anneal, and 72°C for 30 seconds for extension; the 40 cycles were followed by an additional extension of 72°C for 5 minutes, and then the samples were kept at 4°C before the addition of loading buffer (6×). They were then run on a 1.8% agarose gel and visualized via ethidium bromide staining.Table 2Primers to Osteoclast, Osteoblast, and Giant Cell Tumor Markers Selected through Microarray Expression Signatures as well as Published Data5Atkins GJ Hayes DR Graves SE Evadokiou A Hay S Bouralexis S Findlay DM Expression of osteoclast differentiation signals by stromal elements of giant cell tumors.J Bone Miner Res. 2000; 15: 640-649Crossref PubMed Scopus (155) Google ScholarTarget geneSense (5′ to 3′)Antisense (5′ to 3′)Melting temperature (°C)Product (bp)OPGTGCTGTTCCTACAAAGTTTACGCTTTGAGTGCTTTAGTGCGTG62435M-CSFCAGTTGTCAAGGACAGCACGCTGGAGGATCCCTTCGGACTG58670SFRP4TGCTGCCGACTGGAGTTTGTGAGGTCCCACGTTTACCC63529RANKLAATAGAATATCAGAAGATGGCACTCTAAGGAGGGGTTGGAGACCTCG62668C-type lectinTCCAGGCTGTCTCTTCCACGTGTGCCTATCTGGTGCCTCTG65557CTRGCAATGCTTTCACTCCTGAGAAAAGTGCATCACGTAATCATATATC58782TRAPCTGGCTGATGGTGCCACCCCTGCTCTCAGGCTGCAGGCTGAGG65469CSF1RGCTTGGCATGGTCAGGGAATGGGCCCTGGGATGACTTTCT65898Cathepsin KGATCACTGGAGCTGACTTCCGGGGCTCTACCTTCCCATTCTG66470OSF1TCCTAGGAGGCGACGGTTGTCGTGGCAAGCCCAGTATAAGG63495OSF2GGACCAAGGCCCAAATGTCTCCCATGGATGATTCGAGCA63653OsteonectinGCAAGAAGCCCTGCCTGATGGGAATTCGGTCAGCTCAGA62548GAPDHCACTGACACCTTGGCAGTGGCATGGAGAAGGCTGGGGCTC60414 Open table in a new tab Some of the primer sequences used were obtained from Atkins et al,5Atkins GJ Hayes DR Graves SE Evadokiou A Hay S Bouralexis S Findlay DM Expression of osteoclast differentiation signals by stromal elements of giant cell tumors.J Bone Miner Res. 2000; 15: 640-649Crossref PubMed Scopus (155) Google Scholar whereas the remainder were generated from sequences corresponding to accession numbers for cDNAs contained in our microarrays. Fresh GCT samples were collagenase treated as described above. Cells were disaggregated and passed through a 19-gauge needle to remove debris. All subsequent steps were carried out at 4°C. Cells were incubated with PerCP-conjugated monoclonal anti-human CD45 (DAKO) for 15 minutes, followed by washing (PBS and 1% bovine serum albumin). After fixation in 2% paraformaldehyde for 10 minutes on ice, cells were incubated with monoclonal anti-human RANKL (MAB626; R&D Systems) at 1 μg/ml for 10 minutes. After washing, cells were blocked in PBS containing 10% mouse serum for 10 minutes on ice. After three more washes, cells were incubated with fluorescein isothiocyanate (FITC)-conjugated donkey anti-mouse immunoglobulin (Jackson Immunoresearch) for 10 minutes before three washes in PBS/bovine serum albumin. Appropriate negative controls were included. Cells were then subject to flow cytometry (FACScalibur, Becton Dickinson). Paraffin-embedded tissue sections were cut and mounted onto slides. These were stained with TRAP using an alkaline leukocyte phosphatase kit (Sigma), CD68 antibody, CD45 antibody, CD4 antibody, RANKL antibody, and vimentin. Immunostaining for RANKL was performed using the same antibody described above (MAB626). We undertook expression profiling of 48 sarcomas, including 9 GCTs. Using unsupervised hierarchical clustering, GCTs formed a distinct subgroup, consistent with the striking morphology of these tumors (Figure 1A). Supervised clustering (Figure 1B), based on genes that accurately discriminated between subclasses of sarcomas (P < 0.01), reinforced the impression that GCTs formed a remarkably homogeneous subgroup. A full discussion of the remaining classes of sarcoma lies beyond the scope of this paper, but the raw data are provided as supplemental information (http://ajp.amjpathol.org). We next examined those genes most highly expressed in GCTs, ranked according to their median expression (Table 3). This gene list comprises the top 20 genes and their median expression in GCTs. As expected, the list included several genes known to be highly expressed in osteoclasts, including cathepsin K21Zaidi M Troen B Moonga BS Abe E Cathepsin K, osteoclastic resorption, and osteoporosis therapy.J Bone Miner Res. 2001; 16: 1747-1749Crossref PubMed Scopus (68) Google Scholar, the brain isoform of creatine kinase,22Sakai D Tong HS Minkin C Osteoclast molecular phenotyping by random cDNA sequencing.Bone. 1995; 17: 111-119Abstract Full Text PDF PubMed Scopus (41) Google Scholar calcineurin-dependent nuclear factor of activated T-cells,23Ikeda F Nishimura R Matsubara T Tanaka S Inoue J Reddy SV Hata K Yamashita K Hiraga T Watanabe T Kukita T Yoshioka K Rao A Yoneda T Critical roles of c-Jun signaling in regulation of NFAT family and RANKL-regulated osteoclast differentiation.J Clin Invest. 2004; 114: 475-484Crossref PubMed Scopus (389) Google Scholar and subunit of a membrane-associated ATP-dependent proton pump.24Chen TF Zhang YL Xu WL Li ZQ Hou B Wang CL Fan M Qian LJ Zhou RP Zhang CG Prokaryotic expression, polyclonal antibody preparation, and sub-cellular localization analysis of Na(+), K(+)-ATPase beta2 subunit.Protein Expr Purif. 2004; 37: 47-52Crossref PubMed Scopus (3) Google Scholar Additionally, a number of osteoblast-related genes were identified, including decorin, lumican, and collagen IX, consistent with the proposition that the stromal element in GCTs is of osteoblastic origin. Almost all remaining genes identified in our study have been implicated in osteoclast biology. Foremost among these, RANKL (tumor necrosis factor superfamily member 11) was extremely highly expressed in these tumors, whereas OPG was expressed at very low levels (data not shown). Because OPG is a decoy inhibitor of RANKL signaling, this is consistent with a potent osteoclastogenic signal in GCTs. C-type lectin (member 6) belongs to a class of molecules previously identified as inhibitors of osteoclast formation (osteoclast-inhibitory lectin).25Zhou H Kartsogiannis V Quinn JM Ly C Gange C Elliott J Ng KW Gillespie MT Osteoclast inhibitory lectin, a family of new osteoclast inhibitors.J Biol Chem. 2002; 277: 48808-48815Crossref PubMed Scopus (44) Google Scholar C-type lectin 6 and murine osteoclast-inhibitory lectin are 23% identical and 51% similar at the protein level, suggesting overlapping functions. Similarly, SFRP4 belongs to a family of secreted frizzled-related proteins, one of which (SFRP1) has aroused interest as an inhibitor of osteoclastogenesis.26Bodine PV Zhao W Kharode YP Bex FJ Lambert AJ Goad MB Gaur T Stein GS Lian JB Komm BS The Wnt antagonist secreted frizzled-related protein-1 is a negative regulator of trabecular bone formation in adult mice.Mol Endocrinol. 2004; 18: 1222-1237Crossref PubMed Scopus (396) Google Scholar, 27Hausler KD Horwood NJ Chuman Y Fisher JL Ellis J Martin TJ Rubin JS Gillespie MT Secreted frizzled-related protein-1 inhibits RANKL-dependent osteoclast formation.J Bone Miner Res. 2004; 19: 1873-1881Crossref PubMed Scopus (121) Google Scholar It is not clear whether C-type lectin 6 or SFRP4 are acting as inhibitors or activators of osteoclast formation in GCTs, because homologs may act in an antagonistic function, as seen with OPG and RANKL. Decysin 1 is a member of the ADAM family (a disintegrin and metalloprotease), which has been implicated in regulation of osteoclast recruitment and function.28Boissy P Lenhard TR Kirkegaard T Peschon JJ Black RA Delaisse JM del Carmen Ovejero M An assessment of ADAMs in bone cells: absence of TACE activity prevents osteoclast recruitment and the formation of the marrow cavity in developing long bones.FEBS Lett. 2003; 553: 257-261Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar Protein kinase A mediates signals downstream of a number of osteoclastogenic stimuli, including parathyroid hormone and prostaglandins.29Bakre MM Zhu Y Yin H Burton DW Terkeltaub R Deftos LJ Varner JA Parathyroid hormone-related peptide is a naturally occurring, protein kinase A-dependent angiogenesis inhibitor.Nat Med. 2002; 8: 995-1003Crossref PubMed Scopus (88) Google Scholar, 30Sakuma Y Li Z Pilbeam CC Alander CB Chikazu D Kawaguchi H Raisz LG Stimulation of cAMP production and cyclooxygenase-2 by prostaglandin E2 and selective prostaglandin receptor agonists in murine osteoblastic cells.Bone. 2004; 34: 827-834Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar Lymphotoxin-β receptor binds and transduces signals from tumor necrosis factor family proteins, to which RANKL and OPG belong.31Kong YY Yoshida H Sarosi I Tan HL Timms E Capparelli C Moroney S Oliveira-dos-Santos AJ Van G Itie A Khoo W Wakeham A Dunstan CR Lacey DL Mak TW Boyle WJ Penninger JM OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis.Nature. 1999; 397: 315-323Crossref PubMed Scopus (2799) Google Scholar, 32Roux S Orcel P Bone loss: factors that regulate osteoclast differentiation: an update.Arthritis Res. 2000; 2: 451-456Crossref PubMed Scopus (107) Google Scholar Thrombospondin-1 ha
Referência(s)