Maternal Antibodies Enhance or Prevent Cytomegalovirus Infection in the Placenta by Neonatal Fc Receptor-Mediated Transcytosis
2006; Elsevier BV; Volume: 168; Issue: 4 Linguagem: Inglês
10.2353/ajpath.2006.050482
ISSN1525-2191
AutoresEkaterina Maidji, Susan McDonagh, Olga Genbačev, Takako Tabata, Lenore Pereira,
Tópico(s)Neonatal Health and Biochemistry
ResumoHow human cytomegalovirus (CMV) reaches the fetus across the placenta is unknown. The major viral cause of congenital disease, CMV infects the uterine-placental interface with varied outcomes depending on the strength of maternal humoral immunity and gestational age. Covering the surface of villi that float in blood, syncytiotrophoblasts express the neonatal Fc receptor (FcRn) that transports IgG for passive immunity. Immunohistochemical analysis of early-gestation biopsy specimens showed an unusual pattern of CMV replication proteins in underlying villus cytotrophoblasts, whereas syncytiotrophoblasts were spared. Found in placentas with low to moderate CMV-neutralizing antibody titers, this pattern suggested virion transcytosis across the surface. In contrast, syncytiotrophoblasts from placentas with high neutralizing titers contained viral DNA and caveolin-1-positive vesicles in which IgG and CMV glycoprotein B co-localized. In villus explants, IgG-virion transcytosis and macrophage uptake were blocked with trypsin-treatment and soluble protein A. Quantitative analysis in polarized epithelial cells showed that FcRn-mediated transcytosis was blocked by the Fc fragment of IgG, but not F(ab′)2. Our results suggest that CMV virions could disseminate to the placenta by co-opting the receptor-mediated transport pathway for IgG. These findings could explain the efficacy of hyperimmune IgG for treatment of primary CMV infection during gestation and support vaccination. How human cytomegalovirus (CMV) reaches the fetus across the placenta is unknown. The major viral cause of congenital disease, CMV infects the uterine-placental interface with varied outcomes depending on the strength of maternal humoral immunity and gestational age. Covering the surface of villi that float in blood, syncytiotrophoblasts express the neonatal Fc receptor (FcRn) that transports IgG for passive immunity. Immunohistochemical analysis of early-gestation biopsy specimens showed an unusual pattern of CMV replication proteins in underlying villus cytotrophoblasts, whereas syncytiotrophoblasts were spared. Found in placentas with low to moderate CMV-neutralizing antibody titers, this pattern suggested virion transcytosis across the surface. In contrast, syncytiotrophoblasts from placentas with high neutralizing titers contained viral DNA and caveolin-1-positive vesicles in which IgG and CMV glycoprotein B co-localized. In villus explants, IgG-virion transcytosis and macrophage uptake were blocked with trypsin-treatment and soluble protein A. Quantitative analysis in polarized epithelial cells showed that FcRn-mediated transcytosis was blocked by the Fc fragment of IgG, but not F(ab′)2. Our results suggest that CMV virions could disseminate to the placenta by co-opting the receptor-mediated transport pathway for IgG. These findings could explain the efficacy of hyperimmune IgG for treatment of primary CMV infection during gestation and support vaccination. Although the human placenta functions as a barrier to microorganisms, certain viruses that disseminate in blood, such as human cytomegalovirus (CMV), can be transmitted from the maternal to the fetal compartment. CMV is a ubiquitous virus that infects much of the adult population, causing asymptomatic infections in healthy persons. After a viremic period in primary infection, latency is established in granulocyte-macrophage progenitor cells.1Kondo K Kaneshima H Mocarski ES Human cytomegalovirus latent infection of granulocyte-macrophage progenitors.Proc Natl Acad Sci USA. 1994; 91: 11879-11883Crossref PubMed Scopus (324) Google Scholar Development of neutralizing antibodies correlates with clearance of circulating viral DNA and proteins and reduces the chance of fetal infection.2Revello MG Zavattoni M Sarasini A Percivalle E Simoncini L Gerna G Human cytomegalovirus in blood of immunocompetent persons during primary infection: prognostic implications for pregnancy.J Infect Dis. 1998; 177: 1170-1175Crossref PubMed Scopus (180) Google Scholar, 3Lazzarotto T Varani S Spezzacatena P Pradelli P Potena L Lombardi A Ghisetti V Gabrielli L Abate DA Magelli C Landini MP Delayed acquisition of high-avidity anti-cytomegalovirus antibody is correlated with prolonged antigenemia in solid organ transplant recipients.J Infect Dis. 1998; 178: 1145-1149Crossref PubMed Scopus (30) Google Scholar CMV is the leading cause of congenital infection and brain disease in children, with an incidence in the United States of ∼1% of live births.4Britt WJ Congenital Cytomegalovirus Infection.in: Hitchcock PJ MacKay HT Wasserheit JN ASM Press, Washington DC1999: 269-281Google Scholar, 5Pass BF Cytomegalovirus.in: Knipe DM Howley PM Lippincott-Raven, New York2001: 2675-2705Google Scholar In 40% of pregnancies complicated by primary CMV infection, virus is transmitted to the fetus. In contrast, reactivation of infection in the mother leads to fetal infection in only 2% of cases. Symptomatic infants die in the neonatal period (12%), and most survivors have permanent, debilitating sequelae, including mental retardation, vision loss, and sensorineural deafness.6Demmler GJ Congenital cytomegalovirus infection and disease.Adv Pediatr Infect Dis. 1996; 11: 135-162PubMed Google Scholar Birth defects from congenital CMV infection depend on maternal neutralizing antibody titers, gestational age,7Fowler KB Stagno S Pass RF Britt WJ Boll TJ Alford CA The outcome of congenital cytomegalovirus infection in relation to maternal antibody status.N Engl J Med. 1992; 326: 663-667Crossref PubMed Scopus (914) Google Scholar, 8Stagno S Pass RF Cloud G Britt WJ Henderson RE Walton PD Veren DA Page F Alford CA Primary cytomegalovirus infection in pregnancy. Incidence, transmission to fetus, and clinical outcome.JAMA. 1986; 256: 1904-1908Crossref PubMed Scopus (790) Google Scholar and the time between primary infection and conception.9Revello MG Zavattoni M Furione M Lilleri D Gorini G Gerna G Diagnosis and outcome of preconceptional and periconceptional primary human cytomegalovirus infections.J Infect Dis. 2002; 186: 553-557Crossref PubMed Scopus (95) Google Scholar Fetal damage is more severe when infection occurs during the first half of gestation, but the risk of virus transmission is present throughout pregnancy.8Stagno S Pass RF Cloud G Britt WJ Henderson RE Walton PD Veren DA Page F Alford CA Primary cytomegalovirus infection in pregnancy. Incidence, transmission to fetus, and clinical outcome.JAMA. 1986; 256: 1904-1908Crossref PubMed Scopus (790) Google Scholar Detection of antibodies with low avidity (ie, poor neutralizing activity) to CMV glycoprotein B (gB), the major neutralizing antigen on virions,10Boppana SB Britt WJ Antiviral antibody responses and intrauterine transmission after primary maternal cytomegalovirus infection.J Infect Dis. 1995; 171: 1115-1121Crossref PubMed Scopus (173) Google Scholar predicts congenital infection, but the means by which virus is transmitted to the fetus is unknown. The human placenta has a specialized architecture composed of villi that attach the fetus to the uterus (anchoring villi) and villi that float in maternal blood (floating villi).11Benirschke K Kaufmann P Pathology of the Human Placenta. Springer, New York2000Crossref Google Scholar, 12Zhou Y Fisher SJ Janatpour M Genbacev O Dejana E Wheelock M Damsky CH Human cytotrophoblasts adopt a vascular phenotype as they differentiate. A strategy for successful endovascular invasion?.J Clin Invest. 1997; 99: 2139-2151Crossref PubMed Scopus (831) Google Scholar The mechanics of supplying maternal blood to the embryo is accomplished by cytotrophoblasts, which are specialized epithelial cells of the placenta. In a stepwise process, these cells leave the basement membrane and differentiate along two independent pathways, depending on their location, to initiate blood flow to the placenta. In the first pathway, cytotrophoblasts fuse into a multinucleate syncytial covering attached at one end to the tree-like fetal portion of the placenta. The syncytiotrophoblast, specialized for exchange of nutrients and waste between maternal and fetal compartments, expresses the neonatal Fc receptor (FcRn), which binds maternal IgG and transcytoses it for passive immunity.13Simister NE Story CM Chen HL Hunt JS An IgG-transporting Fc receptor expressed in the syncytiotrophoblast of human placenta.Eur J Immunol. 1996; 26: 1527-1531Crossref PubMed Scopus (260) Google Scholar, 14Firan M Bawdon R Radu C Ober RJ Eaken D Antohe F Ghetie V Ward ES The MHC class I-related receptor, FcRn, plays an essential role in the maternofetal transfer of gamma-globulin in humans.Int Immunol. 2001; 13: 993-1002Crossref PubMed Scopus (260) Google Scholar The rest of the villus floats in a stream of maternal blood, which optimizes exchange of substances between the mother and the fetus across the placenta. In the second pathway that gives rise to anchoring villi, cytotrophoblasts aggregate into columns of nonpolarized mononuclear cells that attach to and penetrate the uterine wall. The ends of the columns terminate within the superficial endometrium and give rise to invasive cytotrophoblasts. A subset of these cells, either individually or in clusters, commingle with resident decidual and immune cells. During endovascular invasion, masses of cytotrophoblasts open the termini of uterine arteries and migrate into the vessels, thereby diverting blood flow to the placenta. Together, the two components of cytotrophoblast invasion anchor the placenta to the uterus and permit a steady increase in the supply of maternal blood that is delivered to the developing fetus. In human pregnancies, patterns of CMV proteins in biopsy specimens from early gestation show that uterine infection spreads to floating and anchoring villi via different routes.15Pereira L Maidji E McDonagh S Tabata T Insights into viral transmission at the uterine-placental interface.Trends Microbiol. 2005; 13: 164-174Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar In the maternal compartment, CMV replicates in the uterine vasculature, glandular epithelium, and stromal fibroblasts in the decidualized endometrium.16Pereira L Maidji E McDonagh S Genbacev O Fisher S Human cytomegalovirus transmission from the uterus to the placenta correlates with the presence of pathogenic bacteria and maternal immunity.J Virol. 2003; 77: 13301-13314Crossref PubMed Scopus (97) Google Scholar In the placental compartment, the extent of infection is inversely proportional to the level of maternal neutralizing IgG and co-infections.16Pereira L Maidji E McDonagh S Genbacev O Fisher S Human cytomegalovirus transmission from the uterus to the placenta correlates with the presence of pathogenic bacteria and maternal immunity.J Virol. 2003; 77: 13301-13314Crossref PubMed Scopus (97) Google Scholar, 17McDonagh S Maidji E Ma W Chang HT Fisher S Pereira L Viral and bacterial pathogens at the maternal-fetal interface.J Infect Dis. 2004; 190: 826-834Crossref PubMed Scopus (103) Google Scholar We also observed an enigmatic pattern of viral infected cell proteins in clusters of underlying cytotrophoblast progenitor cells, whereas the syncytiotrophoblast was spared in placentas with low to moderate CMV-neutralizing antibody titers.16Pereira L Maidji E McDonagh S Genbacev O Fisher S Human cytomegalovirus transmission from the uterus to the placenta correlates with the presence of pathogenic bacteria and maternal immunity.J Virol. 2003; 77: 13301-13314Crossref PubMed Scopus (97) Google Scholar, 18Fisher S Genbacev O Maidji E Pereira L Human cytomegalovirus infection of placental cytotrophoblasts in vitro and in utero: implications for transmission and pathogenesis.J Virol. 2000; 74: 6808-6820Crossref PubMed Scopus (278) Google Scholar This pattern suggested virions were transported across the surface and infected villus cytotrophoblasts below. Inexplicably, placentas from mothers with strong humoral immunity to CMV (high-avidity IgG) were not infected, but syncytiotrophoblasts contained nucleocapsids.16Pereira L Maidji E McDonagh S Genbacev O Fisher S Human cytomegalovirus transmission from the uterus to the placenta correlates with the presence of pathogenic bacteria and maternal immunity.J Virol. 2003; 77: 13301-13314Crossref PubMed Scopus (97) Google Scholar Co-localization of IgG and gB suggested retention of immune complexes in vesicular compartments proximal to the microvillus surface in contact with blood. Here we report CMV virions co-opt FcRn-mediated transcytosis and are transported across syncytiotrophoblasts in immune complexes that infect underlying cytotrophoblasts and are captured by macrophages in the villus core. First- and second-trimester placentas were obtained from women with normal pregnancies before elective termination for nonmedical reasons. Approval for this project was obtained from the Institutional Review Board of the University of California, San Francisco. Biopsy specimens were analyzed from 45 first-trimester placentas, chorionic villi were dissected, and explants (10 to 20 tree-like villi) were established.18Fisher S Genbacev O Maidji E Pereira L Human cytomegalovirus infection of placental cytotrophoblasts in vitro and in utero: implications for transmission and pathogenesis.J Virol. 2000; 74: 6808-6820Crossref PubMed Scopus (278) Google Scholar Dissected villi (5 to 10 mg) were cultured on 12-mm Millicell-CM inserts with 0.4-μm pores (Millipore Inc., Bedford, MA) coated with 100 μl of Matrigel (BD Discovery Lab Inc, Bedford, MA) in 24-well culture dishes. T-84 cells (human colon carcinoma) were a gift from K. Barrett, University of California, San Diego. Cells (2 × 105 cells/ml) were seeded onto semipermeable polycarbonate Transwell filters (6.5 or 12 mm, 3-μm pore size) (Corning Inc., Corning, NY) coated with 10 μg/cm2 of mouse laminin (Sigma-Aldrich Co., St. Louis, MO) and cultured until polarized. Genetic content of laboratory strain AD16919Chee MS Bankier AT Beck S Bohni R Brown CM Cerny R Horsnell T Hutchison CA Kouzarides T Martignetti JA Preddie E Satchwell SC Tomlinson P Weston KM Barrell BG Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169.Curr Top Microbiol Immunol. 1990; 154: 125-170Crossref PubMed Scopus (1075) Google Scholar and clinical strain Toledo20Cha TA Tom E Kemble GW Duke GM Mocarski ES Spaete RR Human cytomegalovirus clinical isolates carry at least 19 genes not found in laboratory strains.J Virol. 1996; 70: 78-83Crossref PubMed Google Scholar was published. Construction and properties of the CMV strain Toledo expressing the enhanced green fluorescent protein (EGFP) gene, Toledo β2.7 EGFP, have been reported.21Wang Z Mo C Kemble G Duke G Development of an efficient fluorescence-based microneutralization assay using recombinant human cytomegalovirus strains expressing green fluorescent protein.J Virol Methods. 2004; 120: 207-215Crossref PubMed Scopus (17) Google Scholar Briefly, the EGFP gene insertion in plasmid pRC2.7 EGFP was located between the transcription start site and the first open reading frame in the Toledo TRL4 RNA transcript. Filtered and immune-precipitated EGFP-Toledo virions were visualized by immunofluorescence, indicating EGFP-labeled TRL4 transcripts could be packaged in virions.22Bresnahan WA Shenk T A subset of viral transcripts packaged within human cytomegalovirus particles.Science. 2000; 288: 2373-2376Crossref PubMed Scopus (153) Google Scholar, 23Sarcinella E Brown M Tellier R Petric M Mazzulli T Detection of RNA in purified cytomegalovirus virions.Virus Res. 2004; 104: 129-137Crossref PubMed Scopus (13) Google Scholar Villus explants were infected with CMV strains AD169, Toledo, and Toledo-EGFP (5 to 10 × 105 PFU) in serum-free media. After 2 hours of incubation, explants were washed with phosphate-buffered saline and fresh culture medium was added. Murine monoclonal antibodies reacted with CMV immediate-early (IE1&2) proteins (CH160) and gB (CH28).24Dondero DV Pereira L Monoclonal Antibody Production.in: Emmons R Schmidt N American Public Health Association, Washington DC1990: 101-124Google Scholar, 25Qadri I Navarro D Paz P Pereira L Assembly of conformation-dependent neutralizing domains on human cytomegalovirus glyco-protein B.J Gen Virol. 1992; 73: 2913-2921Crossref PubMed Scopus (56) Google Scholar Guinea pig antiserum to gB was a gift from Chiron Corp. (Emeryville, CA). Rat anti-human cytokeratin antibody (7D3),26Damsky CH Fitzgerald ML Fisher SJ Distribution patterns of extracellular matrix components and adhesion receptors are intricately modulated during first trimester cytotrophoblast differentiation along the invasive pathway, in vivo.J Clin Invest. 1992; 89: 210-222Crossref PubMed Scopus (620) Google Scholar mouse anti-human placental lactogen antibodies, and sheep antiserum to human transferrin receptor were obtained from Serotec Ltd. (Raleigh, NC). Rabbit antiserum to Rab5 was from Quality Controlled Biochemicals (Hopkinton, MA); to Rab11, from Zymed (South San Francisco, CA); and to caveolin-1 from Transduction Laboratories, Lexington, KY. Antibodies to EGFR and isotype controls were purchased from BD Biosciences (San Diego, CA). Rabbit antiserum to FcRn was a generous gift from Neil Simister (Brandeis University, Waltham, MA).27McCarthy KM Yoong Y Simister NE Bidirectional transcytosis of IgG by the rat neonatal Fc receptor expressed in a rat kidney cell line: a system to study protein transport across epithelia.J Cell Sci. 2000; 113: 1277-1285Crossref PubMed Google Scholar Goat anti-human IgG and fluorescein isothiocyanate (FITC)-conjugated Affini Pure F(ab′)2 fragment were obtained from Jackson ImmunoResearch, West Grove, PA. Secondary antibodies were goat anti-mouse IgG labeled with FITC or horseradish peroxidase, goat anti-rat IgG labeled with tetramethyl rhodamine isothiocyanate (TRITC), goat anti-guinea pig IgG labeled with TRITC, goat anti-rabbit IgG labeled with FITC, and goat anti-human IgG labeled with FITC, TRITC, or horseradish peroxidase. Nuclei were counterstained with TO-PRO-3 iodide (Molecular Probes, Eugene, OR). The villus explants and placental biopsy specimens were processed for immunohistochemistry as described.18Fisher S Genbacev O Maidji E Pereira L Human cytomegalovirus infection of placental cytotrophoblasts in vitro and in utero: implications for transmission and pathogenesis.J Virol. 2000; 74: 6808-6820Crossref PubMed Scopus (278) Google Scholar Briefly, placental tissues were fixed in 3% paraformaldehyde, infiltrated with 5 to 15% sucrose followed by embedding in optimal-cutting temperature compound (OCT), and frozen in liquid nitrogen. Polarized T-84 cells were fixed with 3% paraformaldehyde in phosphate-buffered saline (PBS) (15 minutes) and permeabilized with 0.1% Triton X-100 in PBS (5 minutes). For double labeling, cells were simultaneously incubated with primary antibodies from different species and secondary antibodies labeled with FITC or TRITC. For surface protein staining the primary antibodies were added to live cells and incubated on ice for 30 minutes. Then cells were washed with ice cold PBS and fixed with 3% paraformaldehyde in PBS (5 minutes). Tissue sections and cells were analyzed with a MRC1024 confocal OptiPhot II Nikon microscope using Comos software (Bio-Rad, Hercules, CA). Data analysis was performed using NIH Image and Adobe Photoshop software. For immunoblot assays, lysates of CMV-infected fibroblasts were separated using denaturing 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and reacted with purified maternal IgG (see below). Bands were visualized using enhanced chemiluminescence (GE HealthCare Biosciences Corp., Piscataway, NJ). Internalized and transcytosed IgG-virion complexes were precipitated from cell lysates and output media, respectively, using protein A beads (Sigma-Aldrich Co., St. Louis, MO). The complexes were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrotransferred to nitrocellulose. Blots were probed with mouse monoclonal antibody (mAb) CH28 to CMV gB followed by secondary specific antibodies conjugated with horseradish peroxidase. Donkey anti-human horseradish peroxidase-conjugated IgG was used to detect IgG. Sections (5 to 7 μm) were cut from frozen blocks of tissue fixed as described above on a Hacker-Slee cryostat and collected on silane-coated glass slides. DNA-DNA hybridization was performed using the DNA Detector FISH kit (KPL, Inc., Gaithersburg, MD). YOYO-1-iodide (Molecular Probes) was used for nuclear counterstaining. CMV probe, EcoRI-A, -B, -C, -D, and -E fragments of AD169 (a gift from Deborah Spector, University of California, San Diego, La Jolla, CA28Spector DH Hock L Tamashiro JC Cleavage maps for human cytomegalovirus DNA strain AD169 for restriction endonucleases EcoRI, BglII, and HindIII.J Virol. 1982; 42: 558-582PubMed Google Scholar) was labeled with biotin-16-dUTP using a nick-translation kit (Roche Diagnostic Inc., Indianapolis, IN).29Yamamoto T Suzuki S Radsak K Hirai K The UL112/113 gene products of human cytomegalovirus which colocalize with viral DNA in infected cell nuclei are related to efficient viral DNA replication.Virus Res. 1998; 56: 107-114Crossref PubMed Scopus (29) Google Scholar Briefly, slides were heated for 3 hours at 65°C and digested with 0.2% pepsin (Sigma-Aldrich Co.) in 0.2 mol/L HCl for 5 minutes at 37°C. Target DNA was denatured in 70% formamide in 2× standard saline citrate for 2 minutes at 70°C before hybridization overnight at 37°C. Maternal IgG was purified from conditioned medium from villus explants (35 to 70 μg/g tissue) using the ImmunoPure IgG purification kit (Pierce, Rockford, IL). Subclasses were determined using the human IgG subclass profile ELISA kit (Zymed). Virus was incubated with 100 μg/ml of purified IgG, cells were infected, and those expressing CMV IE1&2 were quantified in a rapid infectivity assay.30Navarro D Paz P Tugizov S Topp K La Vail J Pereira L Glycoprotein B of human cytomegalovirus promotes virion penetration into cells, transmission of infection from cell to cell, and fusion of infected cells.Virology. 1993; 197: 143-158Crossref PubMed Scopus (209) Google Scholar Titers were calculated as percent neutralization compared with positive and negative controls.16Pereira L Maidji E McDonagh S Genbacev O Fisher S Human cytomegalovirus transmission from the uterus to the placenta correlates with the presence of pathogenic bacteria and maternal immunity.J Virol. 2003; 77: 13301-13314Crossref PubMed Scopus (97) Google Scholar Experiments to block transcytosis by treating villus explants with trypsin and protein A were performed 12 hours after culture. First, villus explants were washed three times with ice-cold serum-free medium containing 20 mmol/L HEPES and incubated with trypsin (1 mg/ml, Sigma-Aldrich Co.) on ice for 30 minutes. Then trypsin was immediately neutralized with 0.5 mg/ml of trypsin inhibitor (Sigma-Aldrich Co.). The explants were washed with ice-cold serum-free medium and Toledo-EGFP (5 × 105 PFU) virions alone or complexed with placenta-associated IgG were added. After 30 minutes adsorption on ice, the explants were washed and incubated in medium containing 10% fetal bovine serum for 60 minutes at 37°C. Untreated control explants were incubated with serum-free medium and subjected to the same handling. In the second set of experiments, villus explants were washed with serum-free medium and incubated for 60 minutes with soluble protein A (10 μg/ml) at 37°C. The medium was aspirated, a fresh mixture containing Toledo-EGFP (5 × 105 PFU) and protein A was added and explants incubated for 60 minutes at 37°C. For untreated controls, explants were incubated with the same titer of Toledo-EGFP. Transcellular resistance of T-84 intestinal epithelial cells grown on Transwell filters was monitored using a Millicell-ERS voltohmmeter and reached 1000 to 1200 Ω/cm2 at 10 to 12 days. Polarity was evaluated as described31Gulino D Delachanal E Concord E Genoux Y Morand B Valiron MO Sulpice E Scaife R Alemany M Vernet T Alteration of endothelial cell monolayer integrity triggers resynthesis of vascular endothelium cadherin.J Biol Chem. 1998; 273: 29786-29793Crossref PubMed Scopus (59) Google Scholar by adding horseradish peroxidase-conjugated goat anti-mouse IgG (Fab′)2 (Jackson ImmunoResearch) to the upper filter compartment, and the medium from the lower compartment was assayed photometrically for horseradish peroxidase with o-phenylenediamine dihydrochloride as the substrate. Cells were incubated for 2 hours in serum-free medium buffered to pH 7.4 with 20 mmol/L HEPES (Sigma-Aldrich Co.), washed with ice-cold Hanks' balanced salt solution (HBSS+) at pH 7.4 with 10 mmol/L HEPES, and cooled for 30 minutes. Before applying IgG-virion complexes, cells were washed with cold 1% bovine serum albumin in HBSS+, pH 6.0 (HBSS+ buffered with 10 mmol/L MES), on the apical (input) surface and with cold 1% bovine serum albumin in HBSS+, pH 7.4 (HBSS+ buffered with 10 mmol/L HEPES), on the opposite (output) surface. IgG-virion complexes were formed by mixing CMV Toledo-EGFP virions, strain AD169 or Toledo (5 × 105 PFU) with human IgG (100 μg/ml) at 37°C for 1 hour. In some experiments, soluble protein A (10 μg/ml) was added to the complexes before applying to cells. IgG-virion complexes in cold 1% bovine serum albumin in HBSS+, pH 6.0, were added to the input surface on ice for 30 minutes for FcRn binding and then incubated at 37°C for 60 to 120 minutes during transcytosis. In some experiments, human IgG Fc fragments or chicken IgY Fc fragments (Jackson ImmunoResearch) in cold 1% bovine serum albumin in HBSS+, pH 6.0, were added to the input surface (100 μg/ml) for 30 minutes. After transcytosis, the media from input and output chambers were collected for polymerase chain reaction (PCR), infectivity, immune precipitation, and immunoblot assays. QIAamp DNA mini kit (Qiagen Inc., Valencia, CA) was used to extract DNA from media. Products were analyzed using real-time quantitative PCR and TaqMan probes. Primers and probes were designed for the UL83 gene of CMV using Primer Express (Applied Biosystems, Foster City, CA). Forward primer (TGGA-CCTGCGTACCAACATAGA), reverse primer (GCGGAGATTTGTTCTCCTGAAA), probe (CCGGCCCTC-GGTTCTCTGCTG). Primers were manufactured by Qiagen, and FAM/TAMRA-labeled probes by Biosearch Technologies (Novato, CA). Real-time PCR was done in duplicate using the Applied Biosystems 9700HT. Using immunohistochemistry, we studied the pattern of CMV proteins in chorionic villi of placentas infected in utero. The cytotrophoblasts stained for cytokeratin and the CMV proteins IE1&2, indicating viral infection. Representative placentas showed a remarkable staining pattern (Figure 1a). The syncytiotrophoblast covering the surface was spared whereas underlying villus cytotrophoblasts were susceptible, as indicated by expression of CMV infected-cell proteins IE1&2 in the nuclei. The staining pattern in eight villus explants infected in vitro was remarkably similar to that of natural infection (Figure 1b). Again, we observed CMV IE1&2 protein-positive nuclear staining of isolated clusters of cytotrophoblasts. These patterns suggested that some internalized virions are transported across the syncytiotrophoblast and infect cytotrophoblasts—the earliest steps in transmission. While examining 23 paired decidual and placental biopsy specimens from healthy early-gestation pregnancies, using confocal immunohistochemistry, we often observed a vesicular staining pattern for virion gB in the syncytiotrophoblast that correlated with viral replication in the decidua.16Pereira L Maidji E McDonagh S Genbacev O Fisher S Human cytomegalovirus transmission from the uterus to the placenta correlates with the presence of pathogenic bacteria and maternal immunity.J Virol. 2003; 77: 13301-13314Crossref PubMed Scopus (97) Google Scholar Frequently, maternal IgG and CMV gB co-localized in large vesicles near the microvillus surface without viral replication (Figure 2a) in donors with moderate to high neutralizing antibody activity. The vesicular pattern, co-stained IgG and gB, contrasted with the homogeneous cytoplasmic staining of placental lactogen, a syncytium-specific protein (Figure 2b). When sections were stained with rabbit antisera to FcRn and a rat monoclonal antibody to cytokeratin, FcRn localized in apical microvilli of the syncytiotrophoblast that covers villus cytotrophoblasts immunostained with cytokeratin, an epithelial cell marker (Figure 2c). Similar staining was seen in 12 placentas. Controls included staining of adjacent sections in parallel with rabbit preimmune serum (data not shown). Localization of the transferrin receptor, a membrane transport protein, was comparable to that of FcRn on the apical surface (Figure 2d). When chorionic villi were co-stained for FcRn and CMV gB, the virion protein was detected in vesicles beneath FcRn-containing microvilli that sometimes co-stained (Figure 3a). To identify vesicles containing IgG-CMV gB complexes, we immunostained sections with antibodies to proteins associated with vesicular trafficking and clathrin- and caveolin-mediated endocytosis. Small gB-containing vesicles weakly co-stained with the GTPases Rab5 and Rab11, which regulate trafficking of endosomes and recycling vesicles, suggesting transient associations (not shown). In contrast, caveolin-1 showed strong co-localization with CMV virion gB-containing vesicular compartments (0.5 to 2 μm in size) located throughout the apical compartment of the syncytiotrophoblast (Figure 3b). In addition, caveolin-1 staining was detected in selected cytotrophoblasts and cells in the villus core. Immunostaining for EGFR, one receptor for CMV virions,32Wang X Huong SM Chiu ML Raab-Traub N Huang ES Epidermal growth
Referência(s)