Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

In Vitro Analysis of the Interaction between the FinO Protein and FinP Antisense RNA of F-like Conjugative Plasmids

1999; Elsevier BV; Volume: 274; Issue: 15 Linguagem: Inglês

10.1074/jbc.274.15.10356

ISSN

1083-351X

Autores

Lori Jerome, Laura S. Frost,

Tópico(s)

RNA modifications and cancer

Resumo

The FinO protein regulates the transfer potential of F-like conjugative plasmids through its interaction with FinP antisense RNA and its target, traJ mRNA. FinO binds to and protects FinP from degradation and promotes duplex formation between FinP and traJ mRNA in vitro. The FinP secondary structure consists of two stem-loop domains separated by a 4-base spacer and terminated by a 6-base tail. Previous studies suggested FinO bound to the smooth 14-base pair helix of stem-loop II. In this investigation, RNA mobility shift analysis was used to study the interaction between a glutathione S-transferase (GST)-FinO fusion protein and a series of synthetic FinP andtraJ mRNA variants. Mutations in 16 of the 28 bases in stem II of FinP that are predicted to disrupt base pairing did not significantly alter the GST-FinO binding affinity. Removal of the single-stranded regions on either side of stem-loop II led to a dramatic decrease in GST-FinO binding to FinP and to the complementary region of the traJ mRNA leader. While no evidence for sequence-specific contacts was found, the results suggest that FinO recognizes the overall shape of the RNA and is influenced by the length of the single-stranded regions flanking the stem-loop. The FinO protein regulates the transfer potential of F-like conjugative plasmids through its interaction with FinP antisense RNA and its target, traJ mRNA. FinO binds to and protects FinP from degradation and promotes duplex formation between FinP and traJ mRNA in vitro. The FinP secondary structure consists of two stem-loop domains separated by a 4-base spacer and terminated by a 6-base tail. Previous studies suggested FinO bound to the smooth 14-base pair helix of stem-loop II. In this investigation, RNA mobility shift analysis was used to study the interaction between a glutathione S-transferase (GST)-FinO fusion protein and a series of synthetic FinP andtraJ mRNA variants. Mutations in 16 of the 28 bases in stem II of FinP that are predicted to disrupt base pairing did not significantly alter the GST-FinO binding affinity. Removal of the single-stranded regions on either side of stem-loop II led to a dramatic decrease in GST-FinO binding to FinP and to the complementary region of the traJ mRNA leader. While no evidence for sequence-specific contacts was found, the results suggest that FinO recognizes the overall shape of the RNA and is influenced by the length of the single-stranded regions flanking the stem-loop. untranslated region stem-loop SL-binding protein glutathioneS-transferase base pair(s) polymerase chain reaction RNA-protein interactions are important in the post-transcriptional regulation of RNA metabolism and expression. An excellent example is the FinOP fertility inhibition system, which controls the transfer frequency of F-like conjugative plasmids. Expression of the plasmid transfer genes is positively regulated by the TraJ protein, which is required for activation of transcription from the major transfer operon promoter, pY. Expression of traJ is negatively regulated by the combined actions of the finO and finP gene products. FinP is a plasmid-specific ∼79-base antisense RNA molecule, complementary to part of the 5′-untranslated region (UTR)1 of traJmRNA (1Mullineaux P. Willetts N.S. Helinski D.R. Cohen S.N. Clewell D.B. Jackson D.A. Hollaender A. Plasmids in Bacteria. Plenum Publishing Corp., New York1985: 605-614Crossref Scopus (36) Google Scholar, 2Finlay B.B. Frost L.S. Paranchych W. Willetts N.S. J. Bacteriol. 1986; 167: 754-757Crossref PubMed Google Scholar, 3Dempsey W.B. Mol. Gen. Genet. 1987; 209: 533-544Crossref PubMed Scopus (24) Google Scholar), which includes the ribosome binding site and first two codons of traJ. The FinP secondary structure (GenBank accession number U01159) (4van Biesen T. Söderbom F. Wagner E.G.H. Frost L.S. Mol. Microbiol. 1993; 10: 35-43Crossref PubMed Scopus (35) Google Scholar) consists of 2 stem-loop (SL) domains, separated by a 4-base spacer and terminated by a 6-base tail (Fig.1). The 5′-UTR of traJmRNA forms the mirror image of FinP, with the traJ RBS and start codon being localized to SLIc (complementary to FinP SLI). The traJ leader also contains an extensive single-stranded region and a third stem-loop, SLIII, at its 5′ end. Binding of FinP to the traJ UTR is believed to sequester the traJRBS, preventing its translation and repressing plasmid transfer. FinP requires a protein cofactor, FinO, to exert its negative effect ontraJ expression. FinO is a 21.2-kDa basic protein (5van Biesen T. Frost L.S. Mol. Microbiol. 1992; 6: 771-780Crossref PubMed Scopus (24) Google Scholar), which has been shown to bind FinP SLII and traJ mRNA in vitro, increasing the rate of duplex formation (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar). Binding of FinO to FinP also protects FinP from RNase E-mediated degradation (7Lee S.H. Frost L.S. Paranchych W. Mol. Gen. Genet. 1992; 235: 131-139Crossref PubMed Scopus (32) Google Scholar,8Jerome L.J. Frost L.S. J. Mol. Biol. 1999; 285: 1457-1473Crossref PubMed Scopus (66) Google Scholar), increasing its steady-state concentration to a level that allows sequestration and reduced expression of the traJ mRNA (9Koraimann G. Teferle K. Markolin G. Woger W. Högenauer G. Mol. Microbiol. 1996; 21: 811-821Crossref PubMed Scopus (45) Google Scholar). The F plasmid is derepressed for transfer (i.e. it transfers constitutively) due to the insertion of an IS3element within its finO gene (10Cheah K.-C. Skurray R. J. Gen. Microbiol. 1986; 132: 3269-3275PubMed Google Scholar, 11Yoshioka Y. Ohtsubo H. Ohtsubo E. J. Bacteriol. 1987; 169: 619-623Crossref PubMed Google Scholar). This effect can be overcome by supplying a functional finO gene from a related plasmid such as R6–5 (5van Biesen T. Frost L.S. Mol. Microbiol. 1992; 6: 771-780Crossref PubMed Scopus (24) Google Scholar) or R100 (12Finnegan D.J. Willetts N.S. Mol. Gen. Genet. 1973; 127: 307-316Crossref PubMed Scopus (46) Google Scholar) in trans, resulting in a 100–1000-fold reduction in F plasmid transfer. The focus of this study is the specificity of the RNA-protein interaction between FinP antisense RNA and the FinO protein. Eight alleles of FinP have been described for F-like conjugative plasmids (Fig. 2), with sequence identity residing in the stem, spacer and tail regions and variability in the two loops (2Finlay B.B. Frost L.S. Paranchych W. Willetts N.S. J. Bacteriol. 1986; 167: 754-757Crossref PubMed Google Scholar, 13Frost L.S. Ippen-Ihler K. Skurray R.A. Microbiol. Rev. 1994; 58: 162-210Crossref PubMed Google Scholar). Two alleles of FinO exist (13Frost L.S. Ippen-Ihler K. Skurray R.A. Microbiol. Rev. 1994; 58: 162-210Crossref PubMed Google Scholar), which show very little sequence variation, but are classified on the basis of their levels of repression of F-like plasmids which is tied to their levels of expression (5van Biesen T. Frost L.S. Mol. Microbiol. 1992; 6: 771-780Crossref PubMed Scopus (24) Google Scholar). FinO is not plasmid-specific, which suggests that the loops are unimportant for RNA-protein recognition. The FinO protein does not share homology with any of the protein sequence motifs found in other RNA-binding proteins (14Mattaj I.W. Cell. 1993; 73: 837-840Abstract Full Text PDF PubMed Scopus (221) Google Scholar, 15Burd C.G. Dreyfuss G. Science. 1994; 265: 615-621Crossref PubMed Scopus (1726) Google Scholar, 16Draper D.E. Annu. Rev. Biochem. 1995; 64: 593-620Crossref PubMed Scopus (198) Google Scholar), providing no clues to the amino acid residues involved in RNA recognition. This report presents a preliminary characterization of the RNA targets recognized by FinO. RNA mobility shift analysis was used to determine the binding affinity of a glutathione S-transferase (GST)-FinO fusion protein for a series of synthetic FinP andtraJ mRNA variants. High affinity binding by GST-FinO was shown to be dependent on the presence of SLII, flanked on either side by single-stranded regions. Unexpectedly, mutations that disrupted base pairing in SLII were tolerated, as was the introduction of internal loops. Furthermore, decreasing the length of the 3′ tail reduced GST-FinO binding while altering the sequence had no effect. The same structural features were recognized in traJ mRNA, suggesting that FinO does not make sequence-specific contacts with the RNA, but recognizes its overall shape. Plasmid pLJ5–13 contains a 105-base pair PCR product with the finP gene fused to the T7 promoter sequence in pUC19 (8Jerome L.J. Frost L.S. J. Mol. Biol. 1999; 285: 1457-1473Crossref PubMed Scopus (66) Google Scholar). During the construction of pLJ5–13, seven spontaneous mutant clones were obtained with single base mutations in stem II (G42:A, G45:A, C46:T, A47:G, G48:A, G49:A, A51:G) and one clone with a double mutation in stem II (C41:T C46:T). RNAs were generated by in vitro transcription from these BamHI-linearized pLJ5–13 mutant plasmids, resulting in the addition of 7 bases (GGGGAUC) to their 3′ ends derived from the BamHI site in the vector. All other RNAs were transcribed from gel-purified PCR products prepared with VentTM DNA polymerase (New England Biolabs) using the appropriate primers and DNA templates, as detailed in Tables I andII. pOX38-Km has been described previously (17Chandler M. Galas D. J. Mol. Biol. 1983; 170: 61-91Crossref PubMed Scopus (81) Google Scholar).Table IPCR primers used in this studyPrimerSequenceLJE1ATACATAGGAACCTCLJE5AAAATCGCCGATGCAGGGLJE6TCGAATTCTAATACGACTCACTATAGATACATAGGAACCTCCTCCTCACAAAGGLJE7CGGAATTCTAATACGACTCACLJE8CATAGAAACCTTTGTGAGGALJE9AAAATCGCAGATGAAGGGAGLJE10AAAATCGCCGATGCATTTAGLJE11GCCGATGCAGGGAGACLJE12TCGAATTCTAATACGACTCACTATAGGTCGATGCAGGGAGTTCLJE13TTTTTCGCCGATGCAGGGLJE14AAAATCCATAGAATCCTTTGTGAGGALJE17TGTCCATAGAATCCTTTGTGAGGALJE19TCGCCGATGCAGGGAGACLJE20AATCGCCGATGCAGGGAGLJE21TGTCGCCGATGCAGGGAGLJE22TCGAATTCTAATACGACTCACTATAGCATAGGAACCTCCTCACAAAGGLJE24AAAATCTAATATGCAGGGAGACGLJE25GACAGTCGATGCAGGGAGLJE27AAAAGGGCCGATGCAGGGAGLJE28CGATGCAGGGAGTTCACGTVB14CCTGAATAACTGCCGTCAGTVB15TCGAATTCTAATACGACTCACTATAGACGTGGTTAATGCCACGTVB18CATAGAATCCTTTGTGAGGATVB24TCGAATTCTAATACGACTCACTATAGGACAGTCGATGCAGGGAGTTCBase changes are underlined, and the T7 promoter sequence is shown in bold. Open table in a new tab Table IIRNAs derived by in vitro transcription from PCR-generated templatesRNA5′ primer3′ primerPCR templateFinPLJE7LJE5pLJ5-13FinP G66:U G71:ULJE7LJE9pLJ5-13FinP C46:U G66:U G71:ULJE7LJE9pLJ5-13 C46:TFinP C41:U C46:U G66:U G71:ULJE7LJE9pLJ5-13 C41:T C46:TFinP C62:A C63:A C64:ALJE7LJE10pLJ5-13FinP C70:A G71:U G72:U C73:ALJE7LJE24pLJ5-13FinP G75:C A76:CLJE7LJE27pLJ5-13FinP ΔA2,U3,A4LJE22LJE5pLJ5-13Spacer-SLII-GAUUUUTVB24LJE5pLJ5-13Spacer-SLII-GAUUTVB24LJE20pLJ5-13Spacer-SLII-GACATVB24LJE21pLJ5-13Spacer-SLII-GATVB24LJE19pLJ5-13Spacer-SLIITVB24LJE11pLJ5-13SLII-GAUUUULJE12LJE5pLJ5-13SLII-GAAAAALJE12LJE13pLJ5-13SLIILJE12LJE11pLJ5-13SLILJE7TVB18pLJ5-13SLI A12:ULJE7LJE8pLJ5-13SLI-spacerLJE7LJE17pLJ5-13SLI-tailLJE7LJE14pLJ5-13traJ184TVB15TVB14pOX38-KmtraJ110TVB15LJE1pOX38-KmtraJ77TVB15LJE25pOX38-KmtraJ71TVB15LJE28pOX38-KmColB2LJE6LJE5ColB2R100-1LJE6LJE5R100-1 Open table in a new tab Base changes are underlined, and the T7 promoter sequence is shown in bold. Uniformly labeled RNAs were prepared byin vitro transcription of DNA templates in reaction mixtures containing 1× T7 RNA polymerase buffer (Boehringer Mannheim), 1 unit/μl RNAguard (Amersham Pharmacia Biotech), 10 μCi of [α-32P]UTP (Mandel Scientific), 0.5 mm GTP, ATP, and CTP, and 0.02 mm UTP at 37 °C for 1 h. DNA was removed with 10 units of RNase-free DNase I (Boehringer Mannheim) for 15 min at 37 °C, and the labeled RNA was gel-purified as described (8Jerome L.J. Frost L.S. J. Mol. Biol. 1999; 285: 1457-1473Crossref PubMed Scopus (66) Google Scholar). RNA was stored at −20 °C for 1 week without noticeable degradation. A step of RNA denaturation-renaturation did not improve or modify the binding affinity of the protein; therefore, gel-purified RNA was used directly for gel-shift analysis. pGEX-FO2 (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar) was used for expression of a protein fusion between GST and R6–5 FinO. GST-FinO was purified using glutathione-agarose affinity as described (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar), except that the cells were lysed using a French press, rather than by sonication (18Sandercock J.R. Frost L.S. Mol. Gen. Genet. 1998; 259: 622-629Crossref PubMed Scopus (17) Google Scholar). The ability of GST-FinO to bind each RNA was assessed by RNA mobility shift analysis (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar). 7.5 fmol of32P-labeled RNA was incubated with increasing amounts of GST-FinO (0–31.9 pmol) in a total volume of 30 μl for 30 min at room temperature in buffer containing 50 mm Tris-HCl, pH 8.0, 1 mm EDTA, 10 mm NaCl, 100 μg/ml bovine serum albumin (RNase/DNase-free; Boehringer Mannheim), 7.6 units of RNAguard (Amersham Pharmacia Biotech), 10% glycerol. Samples were loaded onto a continuously running (150 V) 6% or 8% nondenaturing polyacrylamide gel in 1× TBE buffer and electrophoresed at room temperature for 1.5 h. Bands were visualized by autoradiography and phosphorimaging and quantified using a Molecular Dynamics PhosphorImager 445 SI. The equilibrium association constant (K a) for GST-FinO binding was calculated from the protein concentration that caused 50% of the labeled RNA to shift in the gel (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar, 19Tsai M.-M. Fu Y.-H.F. Deonier R.C. J. Bacteriol. 1990; 172: 4603-4609Crossref PubMed Google Scholar). For RNA variants that gave more than one band shift,Ka values were calculated by considering all bound RNA as a single species. Except where noted,K a values were calculated from three independent determinations. The percent binding relative to FinP was calculated as 100 × (K a variant/K aFinP). We have previously shown that a fusion of FinO from the related plasmid, R6–5, to GST is active in vivo and in vitro (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar, 18Sandercock J.R. Frost L.S. Mol. Gen. Genet. 1998; 259: 622-629Crossref PubMed Scopus (17) Google Scholar). Furthermore, GST-FinO and FinO obtained from thrombin cleavage of the fusion protein bind to FinP RNA with equal affinity. 2M. J. Gubbins and L. S. Frost, unpublished data. In the present study, the relative equilibrium association constants for GST-FinO binding to FinP variants were determined by performing gel-shift assays in which radiolabeled RNA was combined with increasing amounts of purified GST-FinO protein. Labeled RNA was synthesized by in vitro run-off transcription using PCR-generated templates or cloned fragments (see "Experimental Procedures"). Transcripts prepared from cloned fragments contained 7 additional bases (GGGGAUC) at their 3′ ends derived from the BamHI site in the vector used to linearize the plasmids. To ensure that the 7 bases from the vector did not alter the binding constants, FinP RNA and the quadruple mutant, FinP C41:U/C46:U/G66:U/G71:U, with or without the additional 3′ bases, were synthesized. The presence of the 7 extra bases at the 3′ end had no effect on GST-FinO binding (data not shown). A comparison of GST-FinO binding affinities to FinP, SLI (nucleotides 1–34, Fig. 1) and SLII (nucleotides 35–79), which were transcribed from PCR-generated templates, is shown in Fig.3. The K a for GST-FinO binding to FinP was 2.0 × 107m−1, 50-fold higher than that for SLI and 2-fold higher than SLII (summarized in TableIII). These values are higher than previously reported (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar) and likely reflect an increase in the fraction of active GST-FinO in preparations using the French press method for cell lysis, rather than sonication. Since the fraction of GST-FinO that is active was not determined, these values may still be underestimated. As a negative control, incubation of either FinP, SLI or SLII with GST alone did not result in the formation of shifted species in the gel (data not shown). This indicated that the complexes formed in the presence of the fusion protein were the result of RNA interaction with FinO.Table IIIGST-FinO binding to FinP variantsFinP variantaVariants are F unless otherwise stated.107 K abKa values are an average of two or more independent gel shifts.BindingcPercentage of binding relative to F FinP [= 100 × (Ka variant/KaF FinP)].m−1%FinP2.00100SLII1.1055SLI0.042SLI A12:U0.042Stem II mutationsG42:A1.3970G45:A1.5477C46:U1.5779A47:G1.3970G48:A1.1457G49:A1.8291A51:G1.1357C41:U/C46:U1.3668G66:U/G71:U1.3065C46:U/G66:U/G71:U1.5075C41:U/C46:U/G66:U/G71:U1.8090C62:A/C63:A/C64:A1.7085C70:A/G71:U/G72:U/C73:A1.4068OtherColB21.9598R100-12.34117Measurement of GST-FinO binding to FinP variants was determined by gel-shift analysis using 7.5 fmol of uniformly labelled RNAs in the presence of increasing amounts of GST-FinO, as described under "Experimental Procedures." Ka values were calculated from the GST-FinO concentration that caused 50% of the RNA to shift in the gel.a Variants are F unless otherwise stated.b Ka values are an average of two or more independent gel shifts.c Percentage of binding relative to F FinP [= 100 × (Ka variant/KaF FinP)]. Open table in a new tab Measurement of GST-FinO binding to FinP variants was determined by gel-shift analysis using 7.5 fmol of uniformly labelled RNAs in the presence of increasing amounts of GST-FinO, as described under "Experimental Procedures." Ka values were calculated from the GST-FinO concentration that caused 50% of the RNA to shift in the gel. In agreement with the results of van Biesen and Frost (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar), these results suggest that the major determinants for FinO binding reside in SLII, which prompted us to look for differences between SLI and SLII. The most notable structural difference between SLI and SLII is an A-A mismatch within stem I (Fig. 1). SLI A12:U, which creates an A:U base pair (bp) at this site, results in a fully duplexed SLI. Its ability to bind GST-FinO was tested and when compared with SLI with the natural A-A mismatch, was not increased (Table III). Thus, this 11-bp helix was not sufficient for recognition. A second obvious difference between stem-loops I and II is the sequence of the loops. To determine if the loops contributed to the specificity of GST-FinO binding, FinP RNAs from ColB2 and R100–1 were synthesized. ColB2 loop I is identical to F, but differs at 6 of the 7 bases comprising loop II (Fig. 2). R100–1 differs from F at 1 base in loop I and 2 bases in loop II, which is also 1 base smaller than F loop II. The K a for GST-FinO binding to ColB2 was almost identical to F and was slightly increased for R100–1 (Table III). These results indicate that the sequences of the loops are unimportant for FinO binding. The sequences of the two FinP stems, although highly conserved among the finP alleles (Fig. 2), differ significantly from each other and could account for the preference of GST-FinO for SLII. The effect of mutations in stem II of full-length FinP on GST-FinO binding were examined, and the binding data are summarized in Table III. Spontaneous single base mutations on the 5′ side of stem II (G42:A, G45:A, C46:U) reduced the corresponding affinity constants by no more than 30% when compared with wild-type. In the 5′ upper half of stem II, A47:G (naturally present in R100–1) and G49:A did not significantly reduce GST-FinO binding, whereas G48:A and A51:G reduced binding by about 50%. Each of these mutations is expected to disrupt Watson-Crick base pairing, reducing the helical length of stem II. The C41:U/C46:U double mutant, which could lead to formation of two non-Watson-Crick G:U base pairs and maintain the helicity of SLII, showed a 30% reduction in binding constant. To disrupt these potential interactions, FinP variants G66:U/G71:U, C46:U/G66:U/C71:U and C41:U/C46:U/G66:U/G71:U were constructed (Table III). None of these mutations significantly altered GST-FinO binding, suggesting that a continuous duplex is not important for efficient binding. In agreement with this, mutation of 4 consecutive base pairs at the base of stem II (C70:A/G71:U/G72:U/C73:A) and 3 base pairs in the 3′ upper half of stem II (C62:A/C63:A/C64:A) had only minimal effects on GST-FinO binding (Table III). Since the stem II point mutants examined did not significantly alter the binding affinity of GST-FinO, we turned our attention to the conserved single-stranded regions of FinP: the 5′ leader, spacer, and 3′ tail. Removal of 3 bases from the 5′ leader following the initiating G required for T7 RNA polymerase transcription (FinP ΔA2,U3,A4) had little effect on binding affinity (TableIV); however, the spacer and tail regions proved to be important, as shown in Fig.4 and summarized in Table IV. Deletion of either the spacer or 3′ tail from SLII had minor to moderate effects on GST-FinO binding, reducing the K a values by 1.3-fold and 5.5-fold, respectively. Deletion of both the spacer and 3′ tail from SLII had a profound effect, reducing the binding constant 14-fold.Table IVThe tail length, but not sequence, is critical for FinP recognitionF FinP variant107 K aaUnless otherwise stated, K a values are averages ± standard deviation of at least three independent gel shifts.BindingbPercentage binding relative to F FinP [=100 × (K a variant/KaF FinP)].m−1%FinP2.00 ± 0.20100FinP ΔA2, U3, A41.50cK a values are averages of two independent gel shifts.75FinP G74:C/A75:C1.40cK a values are averages of two independent gel shifts.68SLIISpacer-SLII-GAUUUU1.10 ± 0.0255Spacer-SLII (no tail)0.20 ± 0.0410SLII-GAUUUU (no spacer)0.82 ± 0.0541SLII (no spacer, no tail)0.08 ± 0.014Spacer-SLII-GAUU0.38 ± 0.0519Spacer-SLII-GA0.06 ± 0.013SLII-GAAAAA0.69cK a values are averages of two independent gel shifts.35Spacer-SLII-GACA0.36cK a values are averages of two independent gel shifts.18SLISLI0.04 ± 0.012SLI-spacer0.13 ± 0.036SLI-tail0.43 ± 0.0521Binding of GST-FinO to FinP variants was assessed by gel-shift analysis using 7.5 fmol of uniformly labelled RNAs in the presence of various concentrations of GST-FinO, as described under "Experimental Procedures." K a values were calculated from the GST-FinO concentration that caused 50% of the RNA to shift in the gel.a Unless otherwise stated, K a values are averages ± standard deviation of at least three independent gel shifts.b Percentage binding relative to F FinP [=100 × (K a variant/KaF FinP)].c K a values are averages of two independent gel shifts. Open table in a new tab Binding of GST-FinO to FinP variants was assessed by gel-shift analysis using 7.5 fmol of uniformly labelled RNAs in the presence of various concentrations of GST-FinO, as described under "Experimental Procedures." K a values were calculated from the GST-FinO concentration that caused 50% of the RNA to shift in the gel. In order to determine whether FinO had a nonspecific affinity for single-stranded RNA, the ability of polyuridylic acid to compete with FinP for GST-FinO binding was tested. The results (data not shown) indicate that the GST-FinO/FinP interaction was unaffected by the presence of a large molar excess of polyuridylic acid. These results suggest that the single-stranded spacer and 3′ tail make important contributions to a higher order structure recognized by FinO. The nucleotide sequences of synthetic stem-loops I and II were arbitrarily chosen (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar) such that SLI includes the 5′ leader and stem-loop I, whereas SLII includes the spacer, stem-loop II and 3′ tail (Fig. 1). Since GST-FinO binding to SLII was strongly dependent on the presence of both single-stranded flanking sequences, the observed low affinity of GST-FinO for SLI might be due to the absence of a 3′ single-stranded region. To test this hypothesis, SLI variants were constructed that had either the spacer or tail sequence added to their 3′ ends. When assayed for GST-FinO binding, the K avalues for SLI-spacer and SLI-tail were increased 3-fold and 10-fold, respectively (Fig. 5; Table IV). These results clearly demonstrate the importance of the 3′ flanking sequence to the structure recognized by GST-FinO. The effect of decreasing the length of the 3′ tail following SLII on GST-FinO binding was examined since addition of a 7-base extension had no effect (see above). Shortening of the SLII 3′ tail from 6 bases (GAUUUU) to 4 bases (GAUU) decreased theK a 3-fold to 0.38 × 107m−1 (Fig. 6; Table IV). A further reduction in tail length to 2 bases (GA) decreased the K a another 6-fold to 0.06 × 107m−1. These results suggest that a minimum 6-base 3′ tail is necessary for efficient binding by GST-FinO. To determine whether the presence of the 3′ tail reflected a sequence-specific or general requirement for additional bases flanking SLII, variants SLII-GAAAAA, spacer-SLII-GACA, and FinP G74:C/A75:C were constructed (Table IV). The sequence of each variant was chosen to avoid introducing any other obvious secondary structural features. Comparison of the variant pairs (SLII-GAAAAA with SLII-tail; spacer-SLII-GACA with spacer-SLII-GAUU and FinP G74:C/A75:C with wild-type FinP) in Table IV shows that these base transversions in the 3′ tail had minor effects on GST-FinO binding. These results indicate that the length, but not sequence, of the FinP 3′ tail is important for high affinity binding by GST-FinO. The results of an earlier study (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar) showed that GST-FinO binds to a truncated 184-base version of the sense mRNA,traJ, with a K a similar to that for FinP. The sequence and secondary structure of the first 117 bases of FtraJ are shown in Fig. 1. The secondary structure oftraJ RNA between nucleotides 33 and 111 is almost identical to FinP, with the following exceptions: SLIc of traJmRNA has an additional mismatch (A-C), which is paired in FinP SLI; SLIIc of traJ is 2 bases shorter than SLII of FinP, resulting in a 6-base traJ spacer, as compared with 4 bases for FinP. To further characterize the interaction between GST-FinO and F plasmid-encoded traJ184 (previously called TraJ211, Ref. 6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar), a series of 3′ truncated traJ variants were created and their binding to GST-FinO was compared with that of FinP. As seen in Fig. 7, addition of increasing amounts of GST-FinO led to the conversion of low molecular weight bands to one or more higher molecular weight bands (see "Discussion" for further comments). GST-FinO bound traJ184 almost as well as FinP (95%), with a K a of 1.9 × 107m−1. Deletion of 74 bases from the 3′ end oftraJ184, creating traJ110 (see Fig. 1), yielded a modest 25% reduction in GST-FinO binding to 1.4 × 107m−1. Removal of SLIc fromtraJ110, which results in a transcribed product of 77 bases (traJ77; similar to SLII of FinP, Fig. 1) reduced GST-FinO binding by 48% to 0.73 × 107m−1. This is similar to the 45% reduction in the binding constant observed for the removal of SLI from FinP (see Fig. 3; Table III). Further mutation of traJ77 to eliminate the spacer residues 3′ to SLIIc (A72 to C77), creatingtraJ71, decreased the K a for GST-FinO binding another 53% to 0.34 × 107m−1. As with FinP, this result suggests that SLIIc and its 3′ flanking sequence are important determinants for high affinity GST-FinO binding. This report describes the structural features of RNA recognized by the FinO protein. RNA-binding proteins have generally been shown to target single-stranded regions caused by loops, bulges, and mismatches or between helical stems, rather than the duplexed regions themselves (14Mattaj I.W. Cell. 1993; 73: 837-840Abstract Full Text PDF PubMed Scopus (221) Google Scholar, 20Steitz T.A. Gesteland R.F. Atkins J.F. The RNA World. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1993: 219-237Google Scholar, 21Varani G. Pardi A. Nagai K. Mattaj I.W. RNA-Protein Interactions. Oxford University Press, Oxford1994: 1-24Google Scholar). Duplexed regions are necessary, however, for spacing and presentation of the single-stranded nucleotides in the correct orientation (20Steitz T.A. Gesteland R.F. Atkins J.F. The RNA World. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1993: 219-237Google Scholar). The hairpin loops represent an obvious single-stranded region of FinP available for protein binding. Three lines of evidence suggest that FinO does not make sequence-specific contacts with bases in the FinP loops. First, although the loop sequences vary between finP alleles (2Finlay B.B. Frost L.S. Paranchych W. Willetts N.S. J. Bacteriol. 1986; 167: 754-757Crossref PubMed Google Scholar), FinO is exchangeable among F-like plasmids (5van Biesen T. Frost L.S. Mol. Microbiol. 1992; 6: 771-780Crossref PubMed Scopus (24) Google Scholar, 22Willetts N.S. Maule J. Genet. Res. 1986; 47: 1-11Crossref PubMed Scopus (56) Google Scholar). Second, the traJmRNA loops are complementary in sequence to FinP, and yet GST-FinO bound traJ and FinP with nearly equal affinity (Figs. 3 and7). Third, GST-FinO bound F, ColB2, and R100–1 FinPs with the same relative affinity, even though the sequences of the loops vary considerably, especially within loop II. The results reported by van Biesen and Frost (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar) and in this study indicate that the sequence between nucleotides 35 and 79 (SLII) of FinP is sufficient and necessary for high affinity GST-FinO binding. Stem II is fully duplexed in FinP and presents a relatively poor sequence-specific target for FinO. Attempts to disrupt the helical nature of SLII by introduction of internal loops and base substitutions were freely tolerated, indicating that a continuous duplex is not necessary for FinO binding. In agreement with this, single mutations at three of the sites tested (C41, C46, G49) and at G50, had no effect on FinP repressor activity from the related conjugative plasmid R1, as measured by conjugation frequency (23Koraimann G. Koraimann C. Koronakis V. Schlager S. Högenauer G. Mol. Microbiol. 1991; 5: 77-87Crossref PubMed Scopus (43) Google Scholar). Thus, the mutant FinP RNAs are also fully stabilized in vivo by FinO (9Koraimann G. Teferle K. Markolin G. Woger W. Högenauer G. Mol. Microbiol. 1996; 21: 811-821Crossref PubMed Scopus (45) Google Scholar). These results indirectly demonstrate that FinO binding is not affected by these base substitutions in vivo, in accord with the results obtained in this study, in vitro. Earlier studies (6van Biesen T. Frost L.S. Mol. Microbiol. 1994; 14: 427-436Crossref PubMed Scopus (61) Google Scholar) showed that GST-FinO could bind to a FinP/traJ184 duplex or a duplex formed between SLI and the complementary sequence of traJ mRNA. However, the present results indicate that the 14-bp duplex, SLII alone, was not sufficient for high affinity binding by GST-FinO. These apparently conflicting results can be reconciled by the finding that single-stranded regions adjacent to the duplexed RNA were necessary for binding by GST-FinO. In this respect, FinO resembles the stem-loop binding protein (SLBP), which binds to the 3′ end of histone mRNA in mammalian cells (24Williams A.S. Marzluff W.F. Nucleic Acids Res. 1995; 23: 654-662Crossref PubMed Scopus (93) Google Scholar). Efficient binding by SLBP requires at least three nucleotides each 3′ and 5′ of a stem-loop. FinO requires at least 6 nucleotides 3′ to SLII and as many as 4 nucleotides 5′ to SLII, although the length of the 5′ spacer was not examined in this study. Like FinO, SLBP does not have a strict loop size requirement, suggesting that specific contacts do not involve the loop. However, unlike the interaction between FinO and FinP, the sequence of the stem and flanking regions is important for SLBP binding. Since no evidence was obtained for sequence-specific contacts between GST-FinO and FinP, our data suggest that FinO recognizes the overall shape of the RNA conferred by a stem-loop structure, flanked on either side by single-stranded regions. Congruent with this, GST-FinO recognizes the same structural features in traJ mRNA. The requirement for a 6-nucleotide flanking region 3′ to SLIIc is fulfilled by the traJ spacer, which is 2 bases longer than the FinP spacer (Fig. 1). In addition the traJ spacer, which differs from the FinP 3′ tail at 4 of the 6 bases, can serve as a functional 3′ flanking region, indicating that sequence is unimportant for binding by FinO. Addition of the FinP tail sequence (GAUUUU) to the 3′ side of SLI conferred moderate GST-FinO binding, although the binding constant was 2-fold lower than that for SLII with the equivalent 3′ tail. These results suggest that the RNA conformation recognized by GST-FinO can be adopted quite efficiently by three different sequences: traJ mRNA with its 6-base single-stranded spacer, SLI with the FinP 3′ tail, and SLII with the 3′ tail. The functionally related RNA-binding protein, Rom, has also been shown to recognize RNA in a structure-dependent, rather than sequence-dependent fashion. Rom binds to an unstable complex formed between the complementary hairpin loops of RNA I and RNA II of ColE1 plasmids (25Tomizawa J. Som T. Cell. 1984; 38: 871-878Abstract Full Text PDF PubMed Scopus (174) Google Scholar). The results of three independent studies indicate that Rom is capable of binding and stabilizing any complex formed by pairs containing fully complementary loop sequences (26Eguchi Y. Tomizawa J.-I. J. Mol. Biol. 1991; 220: 831-842Crossref PubMed Scopus (90) Google Scholar, 27Predki P.F. Nayak L.M. Gottlieb M.B.C. Regan L. Cell. 1995; 80: 41-50Abstract Full Text PDF PubMed Scopus (84) Google Scholar, 28Gregorian R.Z. Crothers D.M. J. Mol. Biol. 1995; 248: 968-984Crossref PubMed Scopus (70) Google Scholar). Furthermore, Rom has been shown to extend the average half-life of general pulse-labeled Escherichia coli mRNA (29Sozhamannan S. Stitt B.L. J. Mol. Biol. 1997; 268: 689-703Crossref PubMed Scopus (26) Google Scholar). Like Rom, FinO might have many targets in the cell, but the role of FinO in promoting duplex formation can occur only when it is bound to complementary RNAs. GST-FinO binds pBR322 antisense RNA I with an affinity constant of 1.4 × 107m−1, 70% of that for FinP. 3L. J. Jerome and L. S. Frost, unpublished data. The secondary structure of pBR322 RNA I consists of a 9-base leader followed by three stem-loop domains, with a 2-base spacer between stem-loops I and II (30Helmer-Citterich M. Anceschi M.M. Banner D.W. Cesareni G. EMBO J. 1988; 7: 557-566Crossref PubMed Scopus (40) Google Scholar, 31Tamm J. Polisky B. Nucleic Acids Res. 1983; 11: 6381-6397Crossref PubMed Scopus (40) Google Scholar). Although the region of RNA I bound by FinO has not been determined, it is conceivable that FinO has a nonspecific affinity for the third stem-loop, which lacks a 3′ tail, but is longer than 14 bp. Further experiments are needed to define the binding site and establish the specificity of this interaction. Interestingly, binding of GST-FinO to traJ184 gave rise to four shifted bands of different mobility, with the largest complex being retained in the well (Fig. 7). The fastest migrating complex was converted to more slowly migrating complexes with increasing GST-FinO concentration. GST-FinO interaction with traJ110 resulted in three distinct complexes, whereas two complexes were formed with eithertraJ77 or traJ71. One possible explanation for the formation of multiple complexes may be stepwise binding of GST-FinO monomers to multiple sites on its RNA target. The bands retained in the well likely represent complexes formed due to GST-FinO aggregation. Cooperative binding has been reported for the human immunodeficiency virus Rev-RRE interaction (32Iwai S. Pritchard C. Mann D.A. Karn J. Gait M.J. Nucleic Acids Res. 1992; 20: 6465-6472Crossref PubMed Scopus (120) Google Scholar, 33Kjems J. Brown M. Chang D.D. Sharp P.A. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 683-687Crossref PubMed Scopus (185) Google Scholar, 34Heaphy S. Dingwall C. Ernberg I. Gait M.J. Green S.M. Karn J. Lowe A.D. Singh M. Skinner M.A. Cell. 1990; 60: 685-693Abstract Full Text PDF PubMed Scopus (258) Google Scholar, 35Malim M.H. Cullen B.R. Cell. 1991; 65: 241-248Abstract Full Text PDF PubMed Scopus (339) Google Scholar) and between p24 (a 220-amino acid truncated polypeptide of the protein kinase, PKR) and human immunodeficiency virus dsTAR RNA (36Bevilacqua P.C. Cech T.R. Biochemistry. 1996; 35: 9983-9994sCrossref PubMed Scopus (202) Google Scholar). A closer look at GST-FinO binding to its antisense RNA targets (Fig. 3) shows that only one complex was formed between GST-FinO and either SLI or SLII, whereas two complexes were formed with full-length FinP (more readily distinguishable by under-exposure of this gel; data not shown). Although the strongest GST-FinO binding was achieved with SLII, low affinity binding was observed between GST-FinO and SLI with its attached 4-base spacer. Thus, binding of GST-FinO to its primary binding site, SLII, may promote binding to the low affinity site, SLI, resulting in the more slowly migrating complex observed at high GST-FinO concentrations. Similarly, the higher molecular weight complexes observed with the traJ RNA variants may represent successive GST-FinO binding to stem-loops IIc, Ic, and III. Further experiments are needed to determine the specificity of FinO binding to these potential low affinity sites. In addition, since the physiological FinO concentration is not presently known but is thought to be low, based on mRNA levels (5van Biesen T. Frost L.S. Mol. Microbiol. 1992; 6: 771-780Crossref PubMed Scopus (24) Google Scholar), the relevance of the higher molecular weight complexes, which are formed at high FinO concentrations, remains to be established.

Referência(s)