Relationship between complotype and reported severity of systemic allergic reactions to peanut
2012; Elsevier BV; Volume: 129; Issue: 5 Linguagem: Inglês
10.1016/j.jaci.2011.10.049
ISSN1097-6825
AutoresStephanie Menikou, Mitali Patel, Kirsten L. Rose, Marina Botto, John O. Warner, Matthew C. Pickering, Robert Boyle,
Tópico(s)Eosinophilic Esophagitis
ResumoPeanut allergy affects up to 3% of children, but the severity of systemic allergic reactions to peanut is variable, and fatal peanut-induced anaphylaxis is rare.1Osborne N.J. Koplin J.J. Martin P.E. Gurrin L.C. Lowe A.J. Matheson M.C. et al.Prevalence of challenge-proven IgE-mediated food allergy using population-based sampling and predetermined challenge criteria in infants.J Allergy Clin Immunol. 2011; 127: 668-676Abstract Full Text Full Text PDF PubMed Scopus (726) Google Scholar The factors that determine the severity of allergic reactions to peanut are not clear, although reduced activity of platelet-activating factor acetylhydrolase has been reported.2Vadas P. Gold M. Perelman B. Liss G.M. Lack G. Blyth T. et al.Platelet-activating factor, PAF acetylhydrolase, and severe anaphylaxis.N Engl J Med. 2008; 358: 28-35Crossref PubMed Scopus (411) Google Scholar Recent murine data suggest that peanut extract activates complement more than other allergenic foods; this complement activation might influence sensitization to peanut or affect the threshold of reactivity, and it might be an important factor in the increased severity of clinical reactions seen with peanut compared with other food allergens.3Khodoun M. Strait R. Orekov T. Hogan S. Karasuyama H. Herbert D.R. et al.Peanuts can contribute to anaphylactic shock by activating complement.J Allergy Clin Immunol. 2009; 123: 342-351Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar We tested the hypothesis that genetic variations in control of complement activation might be associated with the severity of reaction to peanut in children with primary peanut allergy. We evaluated all known polymorphic variants in the regulatory complement Factors H, B, and C3, which have previously been associated with alterations in complement activation and with disease risk in human subjects, including polypoidal choroidal vasculopathy, meningococcal disease, and age-related macular degeneration.4Davila S. Wright V. Khor C. Sim S.K. Binder A. Breunis W. et al.Genome-wide association study identifies variants in the CFH region associated with host susceptibility to meningococcal disease.Nat Genet. 2010; 42: 772-776Crossref PubMed Scopus (221) Google Scholar, 5Montes T. Tortajada A. Morgan B.P. de Cordoba S.R. Harris C.L. Functional basis of protection against age-related macular degeneration conferred by a common polymorphism in complement factor B.Proc Natl Acad Sci U S A. 2009; 106: 4366-4371Crossref PubMed Scopus (89) Google Scholar, 6Nakanishi H. Yamashiro K. Yamada R. Gotoh N. Hayashi H. Nakata I. et al.Joint effect of cigarette smoking and CFH and LOC387715/HTRA1 polymorphisms on polypoidal choroidal vasculopathy.Invest Ophthalmol Vis Sci. 2010; 51: 61833-61837Google ScholarWe recruited children and adolescents with primary peanut allergy from a university-affiliated pediatric allergy clinic in the United Kingdom between April and August 2010. Inclusion criteria for the study were age 1 to 16 years, primary peanut allergy diagnosed by a pediatric allergist, and a prior clinical history of an acute allergic reaction to peanut ingestion. Patients with peanut allergy secondary to pollen sensitization (ie, oral allergy syndrome) were not included in the study. Ethics approval for the study was obtained from St Mary’s Hospital Research Ethics Committee, and written informed consent was obtained from each child’s parent/guardian.We assessed the severity of the worst prior reaction to peanut by questionnaire, using the severity scale of Ewan and Clark,7Ewan P.W. Clark A.T. Efficacy of a management plan based on severity assessment in longitudinal and case-controlled studies of 747 children with nut allergy: proposal for good practice.Clin Exp Allergy. 2005; 35: 751-756Crossref PubMed Scopus (105) Google Scholar and recorded other variables that might affect reaction severity, namely sex, age and dose of peanut at the time of the reaction, and asthma diagnosis. DNA samples were collected with buccal swabs (Cell Projects, Harrietsham, United Kingdom). After DNA extraction, regions of interest were amplified by means of PCR with 1 to 2 μL of DNA with 1.25 μL of complex buffer, 0.5 μL of Certamp (Biotools, Madrid, Spain), 0.5 μL of 10 mmol/L deoxyribonucleoside triphosphate, 0.5 μL of 50 mmol/L MgCl2 (Biotools), and 2 μL of primers (Sigma-Aldrich, Milton Keynes, United Kingdom) made up to a total volume of 12.5 μL with dH2O.Primer sequences used are shown in Table E1 in this article’s Online Repository at www.jacionline.org. For complement Factor H, we analyzed rs3753394 in the promoter, rs800292 in exon 2, rs1061170 in exon 9, and rs3753396 in exon 14. For Factor B, we analyzed rs12614 and rs641153 in exon 2, and for Factor C3, we analyzed rs2230199 in exon 3 and rs2230201 and rs1047286 in exon 9. PCR products were visualized with a UV transilluminator and purified (Invitrogen, Carlsbad, Calif). Purified PCR products were sequenced with a 3730 xl DNA analyzer (Applied Biosystems Ltd, Foster City, Calif). For the purpose of analysis, a participant’s worst clinical reaction to peanut was classified as anaphylaxis (grade 4 or 5), cardiovascular anaphylaxis (grade 5), or no anaphylaxis (grades 1, 2, or 3). For analysis of complement polymorphisms, participants with a history of anaphylaxis versus no anaphylaxis were first compared for prevalence of individual single nucleotide polymorphisms and then compared for the prevalence of predefined “complotypes,” which are known to be associated with high levels of complement activation (FB-32 R/R: rs12614 [C] and rs641153 [G]; FH-62 V/V: rs800292 [G]; and C3-102 F/F: rs2230199 [G]) or low complement activation (FB-32 Q/Q: rs12614 [C] and rs641153 [A]; FH-62 I/I: rs800292 [A]; and C3-102 S/S: rs2230199 [C]).8Heurich M. Martinez-Barricate R. Francis N.J. Roberts D.L. Rodriguez de Cordoba S. Morgan B.P. et al.Common polymorphisms in C3, factor B, and factor H collaborate to determine systemic complement activity and disease risk.Proc Natl Acad Sci U S A. 2011; 108: 8761-8766Crossref PubMed Scopus (167) Google ScholarCategorical data were analyzed with the χ2 test, and backwards binary logistic regression was used for adjusted analyses with SPSS version 19.0 software (SPSS, Inc, Chicago, Ill). We intended to recruit 50 children with anaphylaxis and 50 without anaphylaxis to have 80% power to detect a difference in prevalence of a functional polymorphism between 70% and 42% between groups at a 2-sided α value of .05.Eighty-two children were successfully recruited and underwent complotype analysis: median age at assessment was 10.0 years (interquartile range, 6.0-12.0 years), and age at the time of the most severe reaction to peanut was 3.3 years (interquartile range, 1.5-6.8 years). Forty-two (51.2%) of 82 had a history of anaphylaxis (grade 4 or 5 reaction to peanut), and 9 (11%) had a history of cardiovascular anaphylaxis. There was a difference between anaphylactic and nonanaphylactic patients for age at reaction (median for the anaphylactic group, 4.00 years [interquartile range, 1.75-7.00 years]; median for the nonanaphylactic group, 2.00 years (interquartile range, 1.00-4.00 years]; P = .04), for dose of peanut protein at the time of reaction (20/38 [53%] with anaphylaxis and 7/35 (20%) without anaphylaxis ingested a high dose [>40 mg9Wensing M. Penninks A.H. Hefle S.L. Koppelman S.J. Bruijnzeel-Koomen C.A. Knulst A.C. The distribution of individual threshold doses eliciting allergic reactions in a population with peanut allergy.J Allergy Clin Immunol. 2002; 110: 915-920Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar; odds ratio, 4.44; 95% CI, 1.56-12.63]), for asthma prevalence (present in 32/42 [76%] with and 16/40 [40%] without anaphylaxis [odds ratio, 4.80; 95% CI, 1.85-12.42]), and for prevalence of other food allergies (present in 34/42 [81%]) with and 21/37 [57%] without anaphylaxis [odds ratio, 3.24; 95% CI, 1.18-8.87]). These variables were therefore included in adjusted analyses. There was no difference between groups in sex (23/42 [55%] male patients with and 19/40 [48%] male patients without anaphylaxis [odds ratio, 1.34; 95% CI, 0.56-3.19]).Analysis of complotype showed all genotypes to be in Hardy-Weinberg equilibrium. There was no significant difference between groups in the frequency of individual alleles for the 9 known complotypes in either adjusted or unadjusted analyses (Table I). When complotypes were grouped according to known functional significance, we found no difference in the prevalence of functional complotypes between groups in either unadjusted or adjusted analyses (Table II). For those with a history of cardiovascular anaphylaxis (grade 5 reaction: extreme pallor, requirement for intravenous fluid resuscitation, or collapse/loss of consciousness), we found no difference in complotype (see Tables E2 and E3 in this article’s Online Repository at www.jacionline.org).Table IRelationship between complement gene polymorphisms and reported severity of peanut allergyLocus of SNPGenotypeNo anaphylaxis (n = 40)Anaphylaxis (n = 42)P valueOR (95% CI)Adjusted OR∗Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and presence of at least 1 other food allergy. (95% CI)FH rs800292GG18 (45)21 (50)1.22 (0.51-2.91)1.23 (0.38-3.98)GA16 (40)9 (21)0.41 (0.15-1.08)0.66 (0.19-2.28)AA6 (15)12 (29)2.27 (0.76-6.78)2.38 (0.53-10.63)Frequency G:A52:2851:33.440.83 (0.44-1.57)—FB rs641153GG31 (79)31 (76)0.80 (0.28-2.30)0.58 (0.14-2.52)GA7 (18)9 (22)1.29 (0.43-3.87)1.37 (0.29-6.45)AA1 (3)1 (2)0.95 (0.06-15.73)4.22 (0.16-113.25)Frequency G:A69:971:11.510.84 (0.33-2.16)—FB rs12614CC29 (74)27 (66)0.67 (0.25, 1.75)0.50 (0.14-1.84)CT10 (26)13 (32)1.35 (0.51-3.57)1.56 (0.42-5.77)TT0 (0)1 (2)2.93 (0.12-74.00)—Frequency C:T68:1067:15.220.66 (0.28-1.57)—FH rs1061170TT14 (35)18 (43)1.39 (0.57-3.40)2.59 (0.69-9.66)CT24 (60)21 (50)0.67 (0.28-1.60)0.30 (0.08-1.15)CC2 (5)3 (7)1.46 (0.23-9.24)3.29 (0.16-67.67)Frequency T:C52:2857:27.651.14 (0.59-2.17)—FH rs3753396AA31 (78)30 (73)0.79 (0.29-2.18)0.54 (0.14-2.17)GA8 (20)9 (22)1.13 (0.39-3.28)1.30 (0.31-5.49)GG1 (3)2 (5)2.00 (0.17-22.97)7.44 (0.22-256.93)Frequency A:G70:1069:13.420.76 (0.31-1.84)—FH rs3753394CC25 (63)25 (60)0.88 (0.36-2.15)1.22 (0.36-4.15)CT13 (33)13 (31)0.93 (0.37-2.36)0.72 (0.20-2.60)TT2 (5)4 (10)2.00 (0.35-11.58)1.39 (0.15-12.61)Frequency C:T63:1763:21.780.81 (0.39-1.68)—C3 rs2230199CC30 (75)29 (69)0.74 (0.28-1.96)0.71 (0.19-2.64)CG7 (18)10 (24)1.47 (0.50-4.34)1.38 (0.35-5.53)GG3 (8)3 (7)0.95 (0.18-5.00)1.34 (0.06-29.34)Frequency C:G67:1368:16.830.82 (0.37-1.85)—C3 rs1047286CC28 (70)29 (69)0.96 (0.37-2.45)0.54 (0.14-2.11)CT11 (28)12 (29)1.05 (0.40-2.77)1.93 (0.49-7.66)TT1 (3)1 (2)0.95 (0.06-15.74)0.63 (0.00-133.75)Frequency C:T67:1370:14.940.97 (0.42-2.22)—C3 rs2230201GG31 (78)31 (74)0.82 (0.30-2.25)0.51 (0.13-2.02)GA8 (20)11 (26)1.42 (0.50-4.00)2.05 (0.51-8.32)AA1 (3)0 (0)0.31 (0.01-7.83)—Frequency G:A70:1073:11.860.95 (0.38-2.37)—Data shown are the number (percentage) of patients with a history of anaphylactic and nonanaphylactic peanut allergy, with each polymorphic variation in 9 different complement genes and the frequency of each allele as a ratio for each complement gene.OR, Odds ratio; SNP, single nucleotide polymorphism.∗ Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and presence of at least 1 other food allergy. Open table in a new tab Table IIRelationship between known functional complotypes and reported severity of peanut allergyComplotypeComplement activationNo anaphylaxis (n = 40)Anaphylaxis (n = 42)P valueOR (95% CI)Adjusted OR∗Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and presence of at least 1 other food allergy. (95% CI)FB rs12614/rs641153High (C/A)0 (0)0 (0)——Low (C/G)1 (3)1 (2)0.95 (0.06-15.74)4.40 (0.16-119.77)FH rs800292High (G/G)18 (45)23 (50)1.48 (0.62-3.53)1.23 (0.38-3.98)Low (A/A)6 (15)12 (29)2.27 (0.76-6.78)2.38 (0.53-10.63)C3 rs2230199High (G/G)3 (8)3 (8)0.95 (0.18-5.00)1.34 (0.06-29.34)Low (C/C)30 (75)29 (69)0.74 (0.28-1.96)0.71 (0.19-2.64)Overall complotypeHigh6 (15)12 (29).192.27 (0.76-6.78)2.40 (0.52-11.14)Low18 (45)21 (50).551.22 (0.51-2.91)2.01 (0.60-6.70)Complotypes were defined as homozygous alleles associated with high or low levels of complement activation. Overall complotype was defined as “High” for participants with 1 or more complotype associated with high-level complement activation and no complotypes associated with low activation and vice versa for “Low” overall complotype.OR, Odds ratio.∗ Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and presence of at least 1 other food allergy. Open table in a new tab These data confirm previous observations that most peanut-induced anaphylaxis involves respiratory compromise with a relatively low prevalence of recognized cardiovascular involvement. They also confirm previous findings that a diagnosis of asthma is associated with increased reported severity of peanut-induced allergic reactions. However, our data do not support a role for genetic variations in complement activation in determining the severity of systemic allergic reactions to peanut. Despite animal studies demonstrating activation of complement by peanut extract and the established role of the complotype in several human disease processes, our findings suggest that known complotypes are not an important determinant of outcome in patients with peanut allergy. Further studies are needed to identify the genetic and physiologic determinants of reaction severity in patients with peanut allergy. Peanut allergy affects up to 3% of children, but the severity of systemic allergic reactions to peanut is variable, and fatal peanut-induced anaphylaxis is rare.1Osborne N.J. Koplin J.J. Martin P.E. Gurrin L.C. Lowe A.J. Matheson M.C. et al.Prevalence of challenge-proven IgE-mediated food allergy using population-based sampling and predetermined challenge criteria in infants.J Allergy Clin Immunol. 2011; 127: 668-676Abstract Full Text Full Text PDF PubMed Scopus (726) Google Scholar The factors that determine the severity of allergic reactions to peanut are not clear, although reduced activity of platelet-activating factor acetylhydrolase has been reported.2Vadas P. Gold M. Perelman B. Liss G.M. Lack G. Blyth T. et al.Platelet-activating factor, PAF acetylhydrolase, and severe anaphylaxis.N Engl J Med. 2008; 358: 28-35Crossref PubMed Scopus (411) Google Scholar Recent murine data suggest that peanut extract activates complement more than other allergenic foods; this complement activation might influence sensitization to peanut or affect the threshold of reactivity, and it might be an important factor in the increased severity of clinical reactions seen with peanut compared with other food allergens.3Khodoun M. Strait R. Orekov T. Hogan S. Karasuyama H. Herbert D.R. et al.Peanuts can contribute to anaphylactic shock by activating complement.J Allergy Clin Immunol. 2009; 123: 342-351Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar We tested the hypothesis that genetic variations in control of complement activation might be associated with the severity of reaction to peanut in children with primary peanut allergy. We evaluated all known polymorphic variants in the regulatory complement Factors H, B, and C3, which have previously been associated with alterations in complement activation and with disease risk in human subjects, including polypoidal choroidal vasculopathy, meningococcal disease, and age-related macular degeneration.4Davila S. Wright V. Khor C. Sim S.K. Binder A. Breunis W. et al.Genome-wide association study identifies variants in the CFH region associated with host susceptibility to meningococcal disease.Nat Genet. 2010; 42: 772-776Crossref PubMed Scopus (221) Google Scholar, 5Montes T. Tortajada A. Morgan B.P. de Cordoba S.R. Harris C.L. Functional basis of protection against age-related macular degeneration conferred by a common polymorphism in complement factor B.Proc Natl Acad Sci U S A. 2009; 106: 4366-4371Crossref PubMed Scopus (89) Google Scholar, 6Nakanishi H. Yamashiro K. Yamada R. Gotoh N. Hayashi H. Nakata I. et al.Joint effect of cigarette smoking and CFH and LOC387715/HTRA1 polymorphisms on polypoidal choroidal vasculopathy.Invest Ophthalmol Vis Sci. 2010; 51: 61833-61837Google Scholar We recruited children and adolescents with primary peanut allergy from a university-affiliated pediatric allergy clinic in the United Kingdom between April and August 2010. Inclusion criteria for the study were age 1 to 16 years, primary peanut allergy diagnosed by a pediatric allergist, and a prior clinical history of an acute allergic reaction to peanut ingestion. Patients with peanut allergy secondary to pollen sensitization (ie, oral allergy syndrome) were not included in the study. Ethics approval for the study was obtained from St Mary’s Hospital Research Ethics Committee, and written informed consent was obtained from each child’s parent/guardian. We assessed the severity of the worst prior reaction to peanut by questionnaire, using the severity scale of Ewan and Clark,7Ewan P.W. Clark A.T. Efficacy of a management plan based on severity assessment in longitudinal and case-controlled studies of 747 children with nut allergy: proposal for good practice.Clin Exp Allergy. 2005; 35: 751-756Crossref PubMed Scopus (105) Google Scholar and recorded other variables that might affect reaction severity, namely sex, age and dose of peanut at the time of the reaction, and asthma diagnosis. DNA samples were collected with buccal swabs (Cell Projects, Harrietsham, United Kingdom). After DNA extraction, regions of interest were amplified by means of PCR with 1 to 2 μL of DNA with 1.25 μL of complex buffer, 0.5 μL of Certamp (Biotools, Madrid, Spain), 0.5 μL of 10 mmol/L deoxyribonucleoside triphosphate, 0.5 μL of 50 mmol/L MgCl2 (Biotools), and 2 μL of primers (Sigma-Aldrich, Milton Keynes, United Kingdom) made up to a total volume of 12.5 μL with dH2O. Primer sequences used are shown in Table E1 in this article’s Online Repository at www.jacionline.org. For complement Factor H, we analyzed rs3753394 in the promoter, rs800292 in exon 2, rs1061170 in exon 9, and rs3753396 in exon 14. For Factor B, we analyzed rs12614 and rs641153 in exon 2, and for Factor C3, we analyzed rs2230199 in exon 3 and rs2230201 and rs1047286 in exon 9. PCR products were visualized with a UV transilluminator and purified (Invitrogen, Carlsbad, Calif). Purified PCR products were sequenced with a 3730 xl DNA analyzer (Applied Biosystems Ltd, Foster City, Calif). For the purpose of analysis, a participant’s worst clinical reaction to peanut was classified as anaphylaxis (grade 4 or 5), cardiovascular anaphylaxis (grade 5), or no anaphylaxis (grades 1, 2, or 3). For analysis of complement polymorphisms, participants with a history of anaphylaxis versus no anaphylaxis were first compared for prevalence of individual single nucleotide polymorphisms and then compared for the prevalence of predefined “complotypes,” which are known to be associated with high levels of complement activation (FB-32 R/R: rs12614 [C] and rs641153 [G]; FH-62 V/V: rs800292 [G]; and C3-102 F/F: rs2230199 [G]) or low complement activation (FB-32 Q/Q: rs12614 [C] and rs641153 [A]; FH-62 I/I: rs800292 [A]; and C3-102 S/S: rs2230199 [C]).8Heurich M. Martinez-Barricate R. Francis N.J. Roberts D.L. Rodriguez de Cordoba S. Morgan B.P. et al.Common polymorphisms in C3, factor B, and factor H collaborate to determine systemic complement activity and disease risk.Proc Natl Acad Sci U S A. 2011; 108: 8761-8766Crossref PubMed Scopus (167) Google Scholar Categorical data were analyzed with the χ2 test, and backwards binary logistic regression was used for adjusted analyses with SPSS version 19.0 software (SPSS, Inc, Chicago, Ill). We intended to recruit 50 children with anaphylaxis and 50 without anaphylaxis to have 80% power to detect a difference in prevalence of a functional polymorphism between 70% and 42% between groups at a 2-sided α value of .05. Eighty-two children were successfully recruited and underwent complotype analysis: median age at assessment was 10.0 years (interquartile range, 6.0-12.0 years), and age at the time of the most severe reaction to peanut was 3.3 years (interquartile range, 1.5-6.8 years). Forty-two (51.2%) of 82 had a history of anaphylaxis (grade 4 or 5 reaction to peanut), and 9 (11%) had a history of cardiovascular anaphylaxis. There was a difference between anaphylactic and nonanaphylactic patients for age at reaction (median for the anaphylactic group, 4.00 years [interquartile range, 1.75-7.00 years]; median for the nonanaphylactic group, 2.00 years (interquartile range, 1.00-4.00 years]; P = .04), for dose of peanut protein at the time of reaction (20/38 [53%] with anaphylaxis and 7/35 (20%) without anaphylaxis ingested a high dose [>40 mg9Wensing M. Penninks A.H. Hefle S.L. Koppelman S.J. Bruijnzeel-Koomen C.A. Knulst A.C. The distribution of individual threshold doses eliciting allergic reactions in a population with peanut allergy.J Allergy Clin Immunol. 2002; 110: 915-920Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar; odds ratio, 4.44; 95% CI, 1.56-12.63]), for asthma prevalence (present in 32/42 [76%] with and 16/40 [40%] without anaphylaxis [odds ratio, 4.80; 95% CI, 1.85-12.42]), and for prevalence of other food allergies (present in 34/42 [81%]) with and 21/37 [57%] without anaphylaxis [odds ratio, 3.24; 95% CI, 1.18-8.87]). These variables were therefore included in adjusted analyses. There was no difference between groups in sex (23/42 [55%] male patients with and 19/40 [48%] male patients without anaphylaxis [odds ratio, 1.34; 95% CI, 0.56-3.19]). Analysis of complotype showed all genotypes to be in Hardy-Weinberg equilibrium. There was no significant difference between groups in the frequency of individual alleles for the 9 known complotypes in either adjusted or unadjusted analyses (Table I). When complotypes were grouped according to known functional significance, we found no difference in the prevalence of functional complotypes between groups in either unadjusted or adjusted analyses (Table II). For those with a history of cardiovascular anaphylaxis (grade 5 reaction: extreme pallor, requirement for intravenous fluid resuscitation, or collapse/loss of consciousness), we found no difference in complotype (see Tables E2 and E3 in this article’s Online Repository at www.jacionline.org). Data shown are the number (percentage) of patients with a history of anaphylactic and nonanaphylactic peanut allergy, with each polymorphic variation in 9 different complement genes and the frequency of each allele as a ratio for each complement gene. OR, Odds ratio; SNP, single nucleotide polymorphism. Complotypes were defined as homozygous alleles associated with high or low levels of complement activation. Overall complotype was defined as “High” for participants with 1 or more complotype associated with high-level complement activation and no complotypes associated with low activation and vice versa for “Low” overall complotype. OR, Odds ratio. These data confirm previous observations that most peanut-induced anaphylaxis involves respiratory compromise with a relatively low prevalence of recognized cardiovascular involvement. They also confirm previous findings that a diagnosis of asthma is associated with increased reported severity of peanut-induced allergic reactions. However, our data do not support a role for genetic variations in complement activation in determining the severity of systemic allergic reactions to peanut. Despite animal studies demonstrating activation of complement by peanut extract and the established role of the complotype in several human disease processes, our findings suggest that known complotypes are not an important determinant of outcome in patients with peanut allergy. Further studies are needed to identify the genetic and physiologic determinants of reaction severity in patients with peanut allergy. AppendixTable E1Primer sequences used for PCR of complement gene regions of interestRegionForward sequence 5′-3′Reverse sequenceProduct size (bp)FH promoterTCTTTACCTTCTCAATATCCAGCACTCCTGTGAAAAGCATCATTAG867FH exon 2ATAGACCTGTGACTGTCTAGGAGGTGACAGAGCCAGACTC417FH exon 9CCTTTGTTAGTAACTTTAGTTCGTCGGTCCATTGGTAAAACAAGG490FH exon 14TATATTGTAAAACAGACAATTTAACCATACAAAATACAAAAGTTTTGACAAG289FB exon 2CAAGCCAGGACACACCATCTCTTCCGCTTCTGTTGTTCC1800C3 exon 3-4GAAGACCAAGAATAATGGGCATCTTTCTCTGTCTCTCTCGAT511C3 exon 9TCAAGCGCATTCCGGTACCTGAGCCTGGCCTTCAGACT260 Open table in a new tab Table E2Relationship between known complement gene polymorphisms and odds of cardiovascular anaphylaxis in children with peanut allergyLocus of SNPGenotypeNo cardiovascular anaphylaxis (n = 73)Cardiovascular anaphylaxis (n = 9)P valueOR (95% CI)Adjusted OR∗Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and the presence of at least 1 other food allergy. (95% CI)FH rs800292GG23 (32)2 (22)0.62 (0.12-3.23)0.40 (0.08-1.98)GA36 (49)3 (33)0.51 (0.12-2.21)0.65 (0.11-3.97)AA14 (19)4 (44)3.37 (0.80-14.20)4.06 (0.83-19.82)Frequency G:A82:647:11.170.50 (0.18-1.35)—FB rs641153GG54 (76)8 (89)2.52 (0.29-21.60)2.37 (0.26-21.86)GA15 (21)1 (11)0.47 (0.05-4.03)0.49 (0.05-4.65)AA2 (3)0 (0)1.46 (0.07-32.84)—Frequency G:A123:1917:1.342.63 (0.33-20.89)—FB rs12614CC50 (70)6 (67)0.84 (0.19-3.68)0.73 (0.15-3.55)CT20 (28)3 (33)1.27 (0.29-5.60)1.41 (0.29-6.90)TT1 (1)0 (0)2.47 (0.09-65.18)—Frequency C:T120:2215:3.900.92 (0.24-3.43)—FH rs1061170TT28 (38)4 (44)1.29 (0.32-5.20)1.83 (0.40-8.41)CT41 (56)4 (44)0.62 (0.15-2.52)0.41 (0.09-1.87)CC4 (5)1 (11)2.16 (0.21-21.73)3.03 (0.24-39.00)Frequency T:C97:4912:6.991.01 (0.36-2.85)—FH rs3753396AA55 (76)6 (67)0.62 (0.14-2.74)0.80 (0.16-4.00)GA14 (19)3 (33)2.07 (0.46-9.32)1.75 (0.35-8.75)GG3 (4)0 (0)1.05 (0.05-21.84)—Frequency A:G124:2015:3.750.81 (0.21-3.04)—FH rs3753394CC44 (60)6 (67)1.32 (0.31-5.69)1.52 (0.31-7.32)CT23 (32)3 (33)1.09 (0.25-4.73)1.05 (0.21-5.14)TT6 (8)0 (0)0.55 (0.03-10.50)—Frequency C:T111:3515:3.491.58 (0.43-5.76)—C3 rs2230199CC51 (70)8 (89)3.45 (0.41-29.28)3.97 (0.44-35.42)CG16 (22)1 (11)0.45 (0.05-3.83)0.37 (0.04-3.40)GG6 (8)0 (0)0.55 (0.03-10.50)—Frequency C:G118:2817:1.154.03 (0.51-31.60)—C3 rs1047286CC50 (68)7 (78)1.61 (0.31-8.36)1.47 (0.26-8.36)CT21 (29)2 (22)0.71 (0.14-3.69)0.84 (0.15-4.83)TT2 (3)0 (0)1.51 (0.07-33.78)—Frequency C:T121:2516:2.521.65 (0.36-7.65)—C3 rs2230201GG56 (77)6 (67)0.61 (0.14-2.69)0.50 (0.10-2.53)GA16 (22)3 (33)1.78 (0.40-7.93)2.08 (0.41-10.62)AA1 (1)0 (0)0.31 (0.01-7.83)—Frequency G:A128:1815:3.600.70 (0.19-2.67)—Data shown are the number (percentage) of patients with a reported history of a peanut-induced allergic reaction involving cardiovascular symptoms (extreme pallor, requirement for intravenous fluid resuscitation, or collapse/loss of consciousness) or a history of a noncardiovascular reaction to peanut, with each polymorphic variation in 9 different complement genes and the frequency of each allele as a ratio for each complement gene.OR, Odds ratio; SNP, single nucleotide polymorphism.∗ Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and the presence of at least 1 other food allergy. Open table in a new tab Table E3Relationship between functional complotypes and reported cardiovascular reactions to peanut in children with peanut allergyComplotypeComplement activationNo cardiovascular anaphylaxis (n = 73)Cardiovascular anaphylaxis (n = 9)P valueOR (95% CI)Adjusted OR∗Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and the presence of at least 1 other food allergy. (95% CI)FB rs12614/rs641153High (C/A)0 (0)0 (0)——Low (C/G)2 (3)0 (0)1.51 (0.07-33.78)—FH rs800292High (G/G)23 (32)2 (22)0.62 (0.12-3.23)0.40 (0.08-1.98)Low (A/A)14 (19)4 (44)3.37 (0.80-14.20)4.12 (0.43-39.52)C3 rs2230199High (G/G)6 (8)0 (0)0.55 (0.03-10.50)—Low (C/C)51 (70)8 (89)3.45 (0.41-29.28)3.97 (0.44-35.42)Overall complotypeHigh17 (23)1 (11).680.41 (0.05-3.53)0.36 (0.04-3.29)Low33 (45)6 (67).302.42 (0.56-10.44)3.29 (0.67-16.21)OR, Odds ratio.∗ Adjusted for age at the time of the reaction, presence of asthma, dose of peanut at the time of the reaction, and the presence of at least 1 other food allergy. Open table in a new tab Data shown are the number (percentage) of patients with a reported history of a peanut-induced allergic reaction involving cardiovascular symptoms (extreme pallor, requirement for intravenous fluid resuscitation, or collapse/loss of consciousness) or a history of a noncardiovascular reaction to peanut, with each polymorphic variation in 9 different complement genes and the frequency of each allele as a ratio for each complement gene. OR, Odds ratio; SNP, single nucleotide polymorphism. OR, Odds ratio.
Referência(s)