Produção Nacional
Revisado por pares
Detection of Medically Important Ehrlichia by Quantitative Multicolor TaqMan Real-Time Polymerase Chain Reaction of the dsb Gene
2005; Elsevier BV; Volume: 7; Issue: 4 Linguagem: Inglês
10.1016/s1525-1578(10)60581-8
ISSN1943-7811
AutoresC. Kuyler Doyle, Marcelo B. Labruna, Edward B. Breitschwerdt, Yi‐Wei Tang, Richard E. Corstvet, Barbara C. Hegarty, Karen C. Bloch, Ping Li, David H. Walker, Jere W. McBride,
Tópico(s)Vector-Borne Animal Diseases
ResumoEhrlichia species are the etiological agents of emerging and life-threatening tick-borne human zoonoses, in addition to causing serious and fatal infections in companion animals and livestock. We developed the first tricolor TaqMan real-time polymerase chain reaction assay capable of simultaneously detecting and discriminating medically important ehrlichiae in a single reaction. Analytical sensitivity of 50 copies per reaction was attained with templates from Ehrlichia chaffeensis, Ehrlichia ewingii, and Ehrlichia canis by amplifying the genus-specific disulfide bond formation protein gene (dsb). Ehrlichia genus-specific dsb primers amplified DNA from all known Ehrlichia species but not from other rickettsial organisms including Anaplasma platys, Anaplasma phagocytophilum, Rickettsia conorii, or Rickettsia typhi. High species specificity was attained as each species-specific TaqMan probe (E. chaffeensis, E. ewingii, and E. canis) identified homologous templates but did not cross-hybridize with heterologous Ehrlichia templates at concentrations as high as 108 copies. Identification of E. chaffeensis, E. ewingii, and E. canis from natural and experimental infections, previously confirmed by polymerase chain reaction and serological or microscopic evidence, demonstrated the comparable specificity and sensitivity of the dsb real-time assay. This assay provides a powerful tool for prospective medical diagnosis for human and canine ehrlichioses and for ecologic and epidemiological studies involving arthropod and mammalian hosts. Ehrlichia species are the etiological agents of emerging and life-threatening tick-borne human zoonoses, in addition to causing serious and fatal infections in companion animals and livestock. We developed the first tricolor TaqMan real-time polymerase chain reaction assay capable of simultaneously detecting and discriminating medically important ehrlichiae in a single reaction. Analytical sensitivity of 50 copies per reaction was attained with templates from Ehrlichia chaffeensis, Ehrlichia ewingii, and Ehrlichia canis by amplifying the genus-specific disulfide bond formation protein gene (dsb). Ehrlichia genus-specific dsb primers amplified DNA from all known Ehrlichia species but not from other rickettsial organisms including Anaplasma platys, Anaplasma phagocytophilum, Rickettsia conorii, or Rickettsia typhi. High species specificity was attained as each species-specific TaqMan probe (E. chaffeensis, E. ewingii, and E. canis) identified homologous templates but did not cross-hybridize with heterologous Ehrlichia templates at concentrations as high as 108 copies. Identification of E. chaffeensis, E. ewingii, and E. canis from natural and experimental infections, previously confirmed by polymerase chain reaction and serological or microscopic evidence, demonstrated the comparable specificity and sensitivity of the dsb real-time assay. This assay provides a powerful tool for prospective medical diagnosis for human and canine ehrlichioses and for ecologic and epidemiological studies involving arthropod and mammalian hosts. The emergence of multiple Ehrlichia species as etiological agents of newly discovered human zoonoses and the previous recognition of these agents as causing serious disease in companion animals and livestock have intensified the need for rapid diagnostics for medically important ehrlichiea. Ehrlichiae are tick-transmitted obligate intracellular gram-negative bacteria that are maintained in nature by persistent infection of mammalian hosts. Humans are incidental hosts of these pathogens, and the recent emergence of ehrlichiosis in humans has been associated with changes in ecology, demographics, and host susceptibility.1Paddock CD Childs JE Ehrlichia chaffeensis: a prototypical emerging pathogen.Clin Microbiol Rev. 2003; 16: 37-64Crossref PubMed Scopus (343) Google Scholar Ehrlichia chaffeensis,2Maeda K Markowitz N Hawley RC Ristic M Cox D McDade JE Human infection with Ehrlichia canis, a leukocytic rickettsia.N Engl J Med. 1987; 316: 853-856Crossref PubMed Scopus (398) Google Scholar, 3Breitschwerdt EB Hegarty BC Hancock SI Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii.J Clin Microbiol. 1998; 36: 2645-2651PubMed Google Scholar, 4Kocan AA Levesque GC Whitworth LC Murphy GL Ewing SA Barker RW Naturally occurring Ehrlichia chaffeensis infection in coyotes from Oklahoma.Emerg Infect Dis. 2000; 6: 477-480Crossref PubMed Scopus (69) Google Scholar Ehrlichia ewingii,5Buller RS Arens M Hmiel SP Paddock CD Sumner JW Rikhisa Y Unver A Gaudreault-Keener M Manian FA Liddell AM Schmulewitz N Storch GA Ehrlichia ewingii, a newly recognized agent of human ehrlichiosis.N Eng J Med. 1999; 341: 148-155Crossref PubMed Scopus (325) Google Scholar, 6Liddell AM Stockham SL Scott MA Sumner JW Paddock CD Gaudreault-Keener M Arens MQ Storch GA Predominance of Ehrlichia ewingii in Missouri dogs.J Clin Microbiol. 2003; 41: 4617-4622Crossref PubMed Scopus (44) Google Scholar and Ehrlichia canis7Perez M Rikihisa Y Wen B Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization.J Clin Microbiol. 1996; 34: 2133-2139PubMed Google Scholar, 8Ewing SA Canine ehrlichiosis.J Am Med Assoc. 1963; 143: 503-506Google Scholar cause ehrlichioses of medical and veterinary importance, with E. chaffeensis and E. canis being the primary agents of severe and sometimes fatal human monocytotropic ehrlichiosis (HME) and canine monocytic ehrlichiosis (CME), respectively. E. chaffeensis was first identified as an agent of human disease in 1987 in the United States,2Maeda K Markowitz N Hawley RC Ristic M Cox D McDade JE Human infection with Ehrlichia canis, a leukocytic rickettsia.N Engl J Med. 1987; 316: 853-856Crossref PubMed Scopus (398) Google Scholar whereas globally distributed E. canis was first identified in Africa as early as 19359Donatien A Lestoquard F Existence en Algeria d'une Rickettsia du chien.Bull Soc Pathol Exot. 1935; 28: 418-419Google Scholar and in North America in 1962.8Ewing SA Canine ehrlichiosis.J Am Med Assoc. 1963; 143: 503-506Google Scholar The potential for a severe life-threatening or fatal outcome of HME and CME emphasizes the need for early diagnosis. Currently, retrospective diagnosis of HME and CME is primarily determined serologically with paired sera using an indirect immunofluorescence assay (IFA). Accurate and reliable serological diagnosis of ehrlichiosis by IFA has inherent limitations related to the absence of antibodies early in the course of infection and in immunocompromised patients and lack of laboratory standardization of the procedure. At the time of presentation, a minority of patients will have developed antibodies to E. chaffeensis,10Standaert SM Dawson JE Schaffner W Childs JE Biggie KL Singleton JJ Gerhardt RR Knight ML Hutcheson RH Ehrlichiosis in a golf-oriented retirement community.N Eng J Med. 1995; 333: 420-425Crossref PubMed Scopus (106) Google Scholar, 11Childs JE Sumner JW Nicholson WL Massung RF Standaert SM Paddock CD Outcome of diagnostic tests using samples from patients with culture-proven human monocytic ehrlichiosis: implications for surveillance.J Clin Microbiol. 1999; 37: 2997-3000PubMed Google Scholar and absence of antibodies at the time of therapeutic decisions when diagnosis is critical can contribute to a fatal outcome. Detection of E. chaffeensis in all culture-positive patients by polymerase chain reaction (PCR) during initial presentation of illness when only 44% were seropositive demonstrates its clinical utility for diagnosis and disease surveillance.11Childs JE Sumner JW Nicholson WL Massung RF Standaert SM Paddock CD Outcome of diagnostic tests using samples from patients with culture-proven human monocytic ehrlichiosis: implications for surveillance.J Clin Microbiol. 1999; 37: 2997-3000PubMed Google Scholar The development of molecular assays for ehrlichial agents has shown promise toward rapid, sensitive, and specific detection required for prospective diagnosis of the ehrlichioses. A limited number of gene targets have been available for genus- and species-specific detection of Ehrlichia infections because of the inability to culture some Ehrlichia species and the lack of genomic sequence information. PCR and reverse transcriptase PCR-based assays for E. chaffeensis, E. ewingii, and E. canis have most commonly targeted the 16S rRNA gene,3Breitschwerdt EB Hegarty BC Hancock SI Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii.J Clin Microbiol. 1998; 36: 2645-2651PubMed Google Scholar, 12McBride JW Corstvet RE Gaunt SD Chinsangaram J Akita GY Osburn BI PCR detection of acute Ehrlichia canis infection in dogs.J Vet Diagn Invest. 1996; 8: 441-447Crossref PubMed Scopus (66) Google Scholar, 13Anderson BE Sumner JW Dawson JE Tzianabos T Greene CR Olson JG Fishbein DB Olsen-Rasmussen M Holloway BP George EH Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction.J Clin Microbiol. 1992; 30: 775-780PubMed Google Scholar, 14Felek S Unver A Stich RW Rikihisa Y Sensitive detection of Ehrlichia chaffeensis in cell culture, blood, and tick specimens by reverse transcription-PCR.J Clin Microbiol. 2001; 39: 460-463Crossref PubMed Scopus (34) Google Scholar, 15Paddock CD Folk SM Shore GM Machado LJ Huycke MM Slater LN Liddell AM Buller RS Storch GA Monson TP Rimland D Sumner JW Singleton J Bloch KC Tang YW Standaert SM Childs JE Infections with Ehrlichia chaffeensis and Ehrlichia ewingii in persons coinfected with human immunodeficiency virus.Clin Infect Dis. 2001; 33: 1586-1594Crossref PubMed Scopus (121) Google Scholar but other genes including the variable-length PCR target, groESL, and p28 have been used for detection of these ehrlichiae.11Childs JE Sumner JW Nicholson WL Massung RF Standaert SM Paddock CD Outcome of diagnostic tests using samples from patients with culture-proven human monocytic ehrlichiosis: implications for surveillance.J Clin Microbiol. 1999; 37: 2997-3000PubMed Google Scholar, 16Sumner JW Childs JE Paddock CD Molecular cloning and characterization of the Ehrlichia chaffeensis variable-length PCR target: an antigen-expressing gene that exhibits interstrain variation.J Clin Microbiol. 1999; 37: 1447-1453PubMed Google Scholar, 17Stich RW Rikihisa Y Ewing SA Needham GR Grover DL Jittapalapong S Detection of Ehrlichia canis in canine carrier blood and in individual experimentally infected ticks with a p30-based PCR assay.J Clin Microbiol. 2002; 40: 540-546Crossref PubMed Scopus (44) Google Scholar, 18Gusa AA Buller RS Storch GA Huycke MM Machado LJ Slater LN Stockham SL Massung RF Identification of a p28 gene in Ehrlichia ewingii: evaluation of gene for use as a target for a species-specific PCR diagnostic assay.J Clin Microbiol. 2001; 39: 3871-3876Crossref PubMed Scopus (29) Google Scholar Because of increased analytical sensitivity, nested PCR has been used routinely for detection of ehrlichemia,3Breitschwerdt EB Hegarty BC Hancock SI Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii.J Clin Microbiol. 1998; 36: 2645-2651PubMed Google Scholar, 10Standaert SM Dawson JE Schaffner W Childs JE Biggie KL Singleton JJ Gerhardt RR Knight ML Hutcheson RH Ehrlichiosis in a golf-oriented retirement community.N Eng J Med. 1995; 333: 420-425Crossref PubMed Scopus (106) Google Scholar, 11Childs JE Sumner JW Nicholson WL Massung RF Standaert SM Paddock CD Outcome of diagnostic tests using samples from patients with culture-proven human monocytic ehrlichiosis: implications for surveillance.J Clin Microbiol. 1999; 37: 2997-3000PubMed Google Scholar, 19Goodman RA Hawkins EC Olby NJ Grindem CB Hegarty B Breitschwerdt EB Molecular identification of Ehrlichia ewingii infection in dogs: 15 cases (1997–2001).J Am Vet Med Assoc. 2003; 222: 1102-1107Crossref PubMed Scopus (45) Google Scholar, 20Kordick SK Breitschwerdt EB Hegarty BC Southwick KL Colitz CM Hancock SI Bradley JM Rumbough R Mcpherson JT MacCormack JN Coinfection with multiple tick-borne pathogens in a Walker Hound kennel in North Carolina.J Clin Microbiol. 1999; 37: 2631-2638PubMed Google Scholar but it involves additional cost and labor and can be more susceptible to false positives as a result of exogenous contamination. A newly developed species-specific TaqMan real-time PCR assay targeting the 16S rRNA gene has detected E. chaffeensis with analytical sensitivity (10 copies) comparable with that provided by nested PCR.21Loftis AD Massung RF Levin ML Quantitative real-time PCR assay for detection of Ehrlichia chaffeensis.J Clin Microbiol. 2003; 41: 3870-3872Crossref PubMed Scopus (41) Google Scholar However, a PCR assay capable of simultaneous species-specific detection of the three medically important Ehrlichia species in the United States has not been reported. We herein report the development of the first multicolor real-time PCR assay capable of detection and discrimination of medically important Ehrlichia species in a single reaction by amplification of a genus-specific disulfide bond formation protein gene (dsb). The analytical sensitivity of the assay is comparable with the most sensitive molecular assays reported and is able to specifically distinguish amplicons from E. chaffeensis, E. ewingii, and E. canis and detect co-infections within the same sample. This powerful closed-system assay will provide new capabilities that will be useful in the diagnosis and treatment of infected patients and companion animals and can also be used in epidemiological studies. Dsb proteins (thio-disulfide oxidoreductases) have conserved protein domains and are functionally conserved among bacteria, yet nucleic acid sequences encoding dsb genes among different bacterial genera are significantly divergent. Hence, they are excellent targets for genus-specific molecularly based assays. The dsb genes of E. chaffeensis and E. canis were previously identified and functionally characterized, and the sequences were determined to be unique to the genus Ehrlichia.22McBride JW Ndip LM Popov VL Walker DH Identification and functional analysis of an immunoreactive DsbA-like thio-disulfide oxidoreductase of Ehrlichia spp.Infect Immun. 2002; 70: 2700-2703Crossref PubMed Scopus (33) Google Scholar The dsb genes of Ehrlichia muris and a yet to be named Ehrlichia sp. (Anan strain, designated “IOE”) isolated from Ixodes ovatus ticks were previously determined and are available in GenBank (accession nos. AY236484 and AY236485). The dsb gene of Ehrlichia ruminantium was identified by performing a BLASTn of the Entrez nucleotide databases at the National Center for Biotechnology Information with the E. chaffeensis dsb gene sequence and is available in GenBank (accession no. AF308669, clone 18hw). The dsb gene sequence (partial) of E. ewingii was determined by PCR amplification of infected tick DNA (kindly provided by Wesley Long, University of Texas Medical Branch) with dsb primers Dsb-330, 5′-GAT GAT GTC TGA AGA TAT GAA ACA AAT-3′ (forward), and Dsb-728, 5′-CTG CTC GTC TAT TTT ACT TCT TAA AGT-3′ (reverse). The amplicon was purified using a PCR purification kit (Qiagen, Valencia, CA) and sequenced directly with the same primers and the sequence deposited in GenBank (accession no. AY428950). Dsb gene sequences for all known Ehrlichia spp. were aligned using the CLUSTAL algorithm by the MegAlign program (DNAstar; Lasergene, Madison, WI). The dsb gene is conserved (69.5–91.5%) within the genus, with E. ruminantium and E. ewingii being the most divergent, and E. muris and IOE the most similar. Ehrlichial dsb genes have highly conserved and heterologous nucleic acid regions necessary to develop genus-specific primers and species-specific probes. Genus-specific dsb primers were manually designed complementary to highly conserved regions of dsb that flank heterogeneous regions used for species-specific probe design. Oligonucleotide primers (Sigma-Genosys, The Woodlands, TX) consisted of a single forward primer for all Ehrlichia species and two reverse primers: one reverse primer for E. chaffeensis and E. canis containing a single degenerate nucleotide position, and a completely complementary reverse primer for E. ewingii (Table 1). Amplification with these primers produces a product that is 378 bp from each of the ehrlichiae. A region of heterogeneity and higher G + C content (bases 411 to 441) in the dsb gene among the three Ehrlichia species was identified, and TaqMan probes with Tm ∼10°C higher than the primer Tm complementary to this region were designed for species-specific detection. Dual-labeled fluorescent TaqMan probes for E. chaffeensis, E. ewingii, and E. canis were synthesized and labeled with 5′Quasar 670/3′Black Hole Quencher (BHQ) 2, 5′ TAMRA/3′ BHQ-2, and 5′ FAM/3′BHQ-1, respectively (Biosearch Technologies, Navato, CA) (Table 2). Primers and probes were evaluated for potential sequence complementarity with the oligo analysis and plotting tool (Qiagen; http://qiagen.com).Table 1Multicolor Real-Time PCR Ehrlichia Genus-Specific dsbPrimers and Homology to Each SpeciesEhrlichia species (GenBank accession)Primer Dsb-321*The Ehrlichia forward primer sequence corresponds to nucleotides 321 to 350 from dsb in each species. (forward, 5′– 3′) TTGCAAAATGATGTCTGAAGATATGAAACA Tm(°C) =66.4Primer Dsb-671†All Ehrlichia reverse primer sequences correspond to the reverse complement of nucleotides 671 to 698 from dsbin each respective species. ‡Y = T or C. (reverse, 5′–3′) GCTGCTCCACCAATAAATGTATCYCCTA Tm(°C) =66.1E. chaffeensis (AF403711)… . … … … … … … … … …. . … … … … … … … . . T… .E. canis(AF403710)… . … … … … … … … … …. . … . . A… . . G… … … . . C… .E. ewingii(AY428950)NDGCAGCTCCACCAATGAATGTATTTCCAA§Dsb-671-ew reverse primer is 100% complementary to the E. ewingii dsb sequence.ND, not determined.* The Ehrlichia forward primer sequence corresponds to nucleotides 321 to 350 from dsb in each species.† All Ehrlichia reverse primer sequences correspond to the reverse complement of nucleotides 671 to 698 from dsbin each respective species.‡ Y = T or C.§ Dsb-671-ew reverse primer is 100% complementary to the E. ewingii dsb sequence. Open table in a new tab Table 2Ehrlichia Species-Specific Dual-Labeled TaqMan Fluorogenic Probes for dsb Multicolor Real-Time PCREhrlichia spp.dsbTaqMan probe sequence*All TaqMan Ehrlichia species-specific probe sequences correspond to reverse complement of dsbnucleotides 411 to 441 from each respective species.Tm(°C)Fluorophore/quencherExcitation/emission wavelength (nm)E. chaffeensis5′-TGCTAGTGCTGCTTGAACAGCTTTCAGTGAT-3′72.15′ Quasar 670/BHQ-2 3′649/670E. ewingii5′-AGCCAATGCTGCACGTACTGCTTTCAATGAT-3′74.45′ TAMRA/BHQ-2 3′555/576E. canis5′-AGCTAGTGCTGCTTGGGCAACTTTGAGTGAA-3′74.05′ FAM/BHQ-1 3′494/534* All TaqMan Ehrlichia species-specific probe sequences correspond to reverse complement of dsbnucleotides 411 to 441 from each respective species. Open table in a new tab ND, not determined. The dsb gene was amplified from E. chaffeensis (Arkansas strain) genomic DNA, E. ewingii from an infected tick, and E. canis (Jake strain) genomic DNA with primers Dsb-330 and Dsb-728 and cloned into a pCR 2.1 TOPO vector (Invitrogen, Carlsbad, CA). Escherichia coli was transformed with the dsb-containing plasmids and grown overnight, and plasmid was purified using a plasmid purification kit (Qiagen). The plasmid DNA was quantified using NanoDrop ND-1000 spectrophotometer (Nanodrop Technologies, Montchanin, DE). Plasmids containing dsb genes were used to optimize the PCR conditions. Optimal conditions for amplification of ehrlichiae were determined using an annealing temperature gradient (55–65°C) and by testing a range of concentrations to establish optimal concentrations of MgCl2, primer, and TaqMan probe. The optimized real-time PCR assay used in all subsequent amplifications was performed using iQ Supermix (BioRad Laboratories, Hercules, CA) in a reaction volume of 50 μl containing primers Dsb-321 and Dsb-671 (400 nmol/L each), Dsb-671-ew (200 nmol/L), and 25 μmol/L of each TaqMan probe (three probes) with final concentration of 4 mmol/L MgCl2. The thermal cycling protocol consisted of a single melting cycle of 95°C for 5 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The real-time PCR was performed in 96-well plates on an iCycler iQ multicolor real-time PCR detection system equipped with the appropriate filter sets and analyzed with iQ software version 3.1 (BioRad Laboratories). A sample was considered positive and threshold cycle (CT) was determined after it crossed the minimum threshold level above background fluorescence after base-line subtraction. The sensitivity of the real-time PCR assay was determined using 10-fold serial dilutions of the respective plasmid DNA in reactions that included all three TaqMan probes in the presence and absence of human DNA (250 ng; amount of DNA typically recovered from blood samples [100 μl] is 20 to 35 ng/μl, and 5 to10 μl of template DNA is used per reaction) in five replicates. The number of dsb-containing plasmid copies was determined according to the formula (X g/μl DNA/[plasmid length in bp × 660]) × 6.022 × 1023 = plasmid copies/μl. Specificity was determined similarly, except dsb plasmids from E. chaffeensis, E. ewingii, E. canis, and E. muris were included separately as templates in reactions that each contained all of the species-specific probes. Intergenus specificity of the dsb primers was determined using genomic DNA from closely related organisms, Anaplasma platys, Anaplasma phagocytophilum, Rickettsia conorii, and Rickettsia typhi. The analytical sensitivity of the dsb real-time assay was compared with another recently published real-time assay for detection of the E. chaffeensis 16S rRNA gene.21Loftis AD Massung RF Levin ML Quantitative real-time PCR assay for detection of Ehrlichia chaffeensis.J Clin Microbiol. 2003; 41: 3870-3872Crossref PubMed Scopus (41) Google Scholar The E. chaffeensis 16S rRNA real-time assay was extensively compared with other published PCR assays used for detection of E. chaffeensis and was found to be one of the most sensitive and specific. Because comparable sensitivity was obtained with plasmid dilutions of E. chaffeensis, E. ewingii, and E. canis in this study, E. chaffeensis was chosen to perform comparative analysis of the relative assay sensitivity. E. chaffeensis genomic DNA was quantified and diluted fivefold; the relative sensitivity of E. chaffeensis detection by the 16S rRNA gene was determined (five replicates) with Brilliant Quantitative-PCR core reagents (Stratagene, La Jolla, CA) as previously described;21Loftis AD Massung RF Levin ML Quantitative real-time PCR assay for detection of Ehrlichia chaffeensis.J Clin Microbiol. 2003; 41: 3870-3872Crossref PubMed Scopus (41) Google Scholar and the dsb real-time PCR on E. chaffeensis DNA was performed as described above. The dsb real-time PCR was evaluated with human and canine clinical samples with detectable E. chaffeensis or E. ewingii DNA using nested 16S rRNA PCR assays.15Paddock CD Folk SM Shore GM Machado LJ Huycke MM Slater LN Liddell AM Buller RS Storch GA Monson TP Rimland D Sumner JW Singleton J Bloch KC Tang YW Standaert SM Childs JE Infections with Ehrlichia chaffeensis and Ehrlichia ewingii in persons coinfected with human immunodeficiency virus.Clin Infect Dis. 2001; 33: 1586-1594Crossref PubMed Scopus (121) Google Scholar, 19Goodman RA Hawkins EC Olby NJ Grindem CB Hegarty B Breitschwerdt EB Molecular identification of Ehrlichia ewingii infection in dogs: 15 cases (1997–2001).J Am Vet Med Assoc. 2003; 222: 1102-1107Crossref PubMed Scopus (45) Google Scholar E. canis-infected dogs were experimentally inoculated and monitored for ehrlichiae in peripheral blood by PCR amplification of the p28 gene. PCR of E. canis p28 was conducted by the Louisiana State University Veterinary Medical Diagnostic Laboratory using primers ECa282F239, 5′-CAA GCA GCA GCC ACA CAA T-3′ (forward), and ECa28R701, 5′-GAT GCT TCT GGG CTT ATG GAG TA-3′ (reverse), with thermal cycling protocol of 10 minutes at 95°C, 40 cycles of 95°C for 30 seconds, 50°C for 1 minute, and 72°C for 1 minute and finished with 10 minutes at 72°C as previously described.23McBride JW Yu X Walker DH A conserved, transcriptionally active p28 multigene locus of Ehrlichia canis.Gene. 2000; 254: 245-252Crossref PubMed Scopus (30) Google Scholar DNA was extracted from 100 μl of whole blood using a DNeasy kit (Qiagen) from naturally infected human samples (eight) and canine samples (nine) with detectable ehrlichial DNA by nested 16S rRNA PCR for ehrlichiosis.19Goodman RA Hawkins EC Olby NJ Grindem CB Hegarty B Breitschwerdt EB Molecular identification of Ehrlichia ewingii infection in dogs: 15 cases (1997–2001).J Am Vet Med Assoc. 2003; 222: 1102-1107Crossref PubMed Scopus (45) Google Scholar Total DNA template added to each reaction was between 100 and 200 ng contained in a maximum of 10 μl. In addition, peripheral blood was collected from three dogs experimentally infected with E. canis and monitored weekly for 9 weeks after inoculation. DNA was extracted similarly and amplified by the dsb real-time PCR assay. The analytical sensitivity of the dsb real-time PCR for each ehrlichial species (E. chaffeensis, E. ewingii, and E. canis) independently was determined to be 50 copies per reaction using single species-specific dsb gene plasmids diluted 10-fold (data not shown). The effect of eukaryotic DNA that would routinely be found in clinical samples on assay sensitivity was evaluated by testing the efficiency of the assay with plasmid templates in the presence and absence of human DNA (250 ng). No reduction in the analytical sensitivity (CT value) of the assay by the addition of host DNA was observed over the range of four plasmid dilutions (102–105; data not shown). A comparison of analytical sensitivity of the dsb real-time PCR with another reported real-time PCR assay for detection of E. chaffeensis was performed. The 16S rRNA gene assay was previously reported to have a sensitivity of 10 copies for E. chaffeensis.21Loftis AD Massung RF Levin ML Quantitative real-time PCR assay for detection of Ehrlichia chaffeensis.J Clin Microbiol. 2003; 41: 3870-3872Crossref PubMed Scopus (41) Google Scholar Dilutions (fivefold) of genomic E. chaffeensis DNA were amplified by both PCR assays to compare the analytical sensitivity. There was a fivefold difference in analytical sensitivity between the 16S rRNA real-time PCR and dsb real-time PCR using dilutions of E. chaffeensis DNA (fivefold), but both assays were capable of detecting relatively low copy E. chaffeensis DNA (Table 3). Because Ehrlichia DNA is purified along with varying amounts of host cell DNA, the DNA per reaction is expressed as dilutions and not as concentrations of ehrlichial DNA. The reported analytical sensitivity of 16S rRNA using plasmid template (10 copies) and limits of detection using E. chaffeensis genomic DNA as template were similarly observed with the dsb real-time PCR assay (50 copies) (Table 3).Table 3Sensitivity Comparison of dsband 16S rRNA Real-Time TaqMan PCR Assays for Detection of E. chaffeensisGenomic DNAGenomic DNA dilution (5-fold)E. chaffeensis dsb*Sensitivity determined to be 50 copies of dsb gene plasmid.E. chaffeensis16S rRNA†Sensitivity of 10 plasmid copies as reported by Loftis et al.211/50++1/250++1/1250++1/6250++1/31,250++1/156,250++1/781,250−+1/3,906,250−−* Sensitivity determined to be 50 copies of dsb gene plasmid.† Sensitivity of 10 plasmid copies as reported by Loftis et al.21Loftis AD Massung RF Levin ML Quantitative real-time PCR assay for detection of Ehrlichia chaffeensis.J Clin Microbiol. 2003; 41: 3870-3872Crossref PubMed Scopus (41) Google Scholar Open table in a new tab Dilutions of plasmids containing the dsb genes from each species were tested in separate reactions containing all three species-specific probes. Amplicons were detected by the corresponding species-specific probe, but no signal was detected in fluorescent channels corresponding to either of the heterologous probes even with plasmid concentrations equivalent to 108 organisms (Table 4). A sample containing dsb plasmids from each of the three species was able to simultaneously detect each of the species. Amplicons for all Ehrlichia species tested were amplified by the dsb primers as detected by SYBR Green (data not shown). Intra- and intergenus specificity was determined using purified genomic DNA from other ehrlichiae and related rickettsial agents. DNA from E. muris, IOE, A. platys, A. phagocytophilum, R. conorii, and R. typhi were all negative by the multicolor TaqMan assay (Table 4). Amplicons from E. muris and IOE were detected by SYBR Green but were not observed with non-Ehrlichia genus templates. For comparison, the 16S rRNA real-time PCR for E. chaffeensis was tested for specificity with the same rickettsial controls, and a positive signal was detected by the 16S rRNA assay in samples that contained the IOE template, but not by the dsb assay (data not shown).Table 4Specificity of Ehrlichia dsb TaqMan Real-Time Multicolor PCR AssaySpecificity with templates fromDNAE. chaffeensis dsbE. canis dsbE. ewingii dsbQuasar 670FAMTAMRAE. chaffeensis*Results with dsbplasmid template copies of 108 to 101.+−−E. canis*Results with dsbplasmid template copies of 108 to 101.−+−E. ewingii*Results with dsbplasmid template copies of 108 to 101.−−+E. muris†DNA from P388D1-infected cells.−−−Ehrlichia sp. (IOE)‡DNA from infected mouse spleen
Referência(s)