Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Trs85 (Gsg1), a Component of the TRAPP Complexes, Is Required for the Organization of the Preautophagosomal Structure during Selective Autophagy via the Cvt Pathway

2005; Elsevier BV; Volume: 280; Issue: 39 Linguagem: Inglês

10.1074/jbc.m501701200

ISSN

1083-351X

Autores

Khuyen Meiling-Wesse, Ulrike D. Epple, Roswitha Krick, Henning Barth, Anika Appelles, Christiane Voss, Eeva‐Liisa Eskelinen, Michael Thumm,

Tópico(s)

Ubiquitin and proteasome pathways

Resumo

Autophagosomes and Cvt vesicles are limited by two membrane layers. The biogenesis of these unconventional vesicles and the origin of their membranes are hardly understood. Here we identify in Saccharomyces cerevisiae Trs85, a nonessential component of the TRAPP complexes, to be required for the biogenesis of Cvt vesicles. The TRAPP complexes function in endoplasmic reticulum-to-Golgi and Golgi trafficking. Growing trs85Δ cells show a defect in the organization of the preautophagosomal structure. Although proaminopeptidase I is normally recruited to the preautophagosomal structure, the recruitment of green fluorescent protein-Atg8 depends on Trs85. Autophagy proceeds in the absence of Trs85, albeit at a reduced rate. Our electron microscopic analysis demonstrated that the reduced autophagic rate of trs85Δ cells does not result from a reduced size of the autophagosomes. Growing and starved cells lacking Trs85 did not show defects in vacuolar biogenesis; mature vacuolar proteinase B and carboxypeptidase Y were present. Also vacuolar acidification was normal in these cells. It is known that mutations impairing the integrity of the ER or Golgi block both autophagy and the Cvt pathway. But the phenotypes of trs85Δ cells show striking differences to those seen in mutants with defects in the early secretory pathway. This suggests that Trs85 might play a direct role in the Cvt pathway and autophagy. Autophagosomes and Cvt vesicles are limited by two membrane layers. The biogenesis of these unconventional vesicles and the origin of their membranes are hardly understood. Here we identify in Saccharomyces cerevisiae Trs85, a nonessential component of the TRAPP complexes, to be required for the biogenesis of Cvt vesicles. The TRAPP complexes function in endoplasmic reticulum-to-Golgi and Golgi trafficking. Growing trs85Δ cells show a defect in the organization of the preautophagosomal structure. Although proaminopeptidase I is normally recruited to the preautophagosomal structure, the recruitment of green fluorescent protein-Atg8 depends on Trs85. Autophagy proceeds in the absence of Trs85, albeit at a reduced rate. Our electron microscopic analysis demonstrated that the reduced autophagic rate of trs85Δ cells does not result from a reduced size of the autophagosomes. Growing and starved cells lacking Trs85 did not show defects in vacuolar biogenesis; mature vacuolar proteinase B and carboxypeptidase Y were present. Also vacuolar acidification was normal in these cells. It is known that mutations impairing the integrity of the ER or Golgi block both autophagy and the Cvt pathway. But the phenotypes of trs85Δ cells show striking differences to those seen in mutants with defects in the early secretory pathway. This suggests that Trs85 might play a direct role in the Cvt pathway and autophagy. Starvation-induced autophagy is an unselective, degradative pathway that delivers cytosolic material to the lysosome (vacuole) (1Klionsky D.J. J. Cell Sci. 2005; 118: 7-18Crossref PubMed Scopus (754) Google Scholar, 2Noda T. Suzuki K. Ohsumi Y. Trends Cell Biol. 2002; 12: 231-235Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 3Thumm M. Mol. Cell. 2002; 10: 1257-1258Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar). It is well conserved between eukaryotes such as fungi, plants, and mammals. During the last decade work initially using the model eukaryote Saccharomyces cerevisiae led to the identification of a set of more than 20 ATG genes essential for the autophagic process (4Klionsky D.J. Cregg J.M. Dunn W.A. Emr S.D. Sakai Y. Sandoval I.V. Sibirny A. Subramani S. Thumm M. Veenhuis M. Ohsumi Y. Dev. Cell. 2003; 5: 539-545Abstract Full Text Full Text PDF PubMed Scopus (995) Google Scholar, 5Tsukada M. Ohsumi Y. FEBS Lett. 1993; 333: 169-174Crossref PubMed Scopus (1357) Google Scholar, 6Thumm M. Egner R. Koch B. Schlumpberger M. Straub M. Veenhuis M. Wolf D.H. FEBS Lett. 1994; 349: 275-280Crossref PubMed Scopus (476) Google Scholar, 7Harding T.M. Hefner-Gravink A. Thumm M. Klionsky D.J. J. Biol. Chem. 1996; 271: 17621-17624Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar). Studies on the mammalian counterparts of the yeast ATG genes uncovered the importance of autophagy in the development of severe diseases such as cancer, cardiomyopathy, Huntington and Parkinson disease (8Shintani T. Klionsky D.J. Science. 2004; 306: 990-995Crossref PubMed Scopus (2109) Google Scholar). Autophagy also plays an important role in the removal of intracellular pathogens (9Levine B. Cell. 2005; 120: 159-162Abstract Full Text Full Text PDF PubMed Scopus (678) Google Scholar), and increasing evidence points to a relationship between autophagy and aging (10Del Roso A. Vittorini S. Cavallini G. Donati A. Gori Z. Masini M. Pollera M. Bergamini E. Exp. Gerontol. 2003; 38: 519-527Crossref PubMed Scopus (153) Google Scholar, 11Melendez A. Talloczy Z. Seaman M. Eskelinen E.L. Hall D.H. Levine B. Science. 2003; 301: 1387-1391Crossref PubMed Scopus (1002) Google Scholar). Autophagy starts at the preautophagosomal structure (PAS), 2The abbreviations used are: PAS, preautophagosomal structure; SNARE, soluble N-ethylmaleimide factor attachment protein receptor; Mes, 2-(N-morpholino)ethanesulfonic acid; Mops, 3-(N-morpholino)propanesulfonic acid; ER, endoplasmic reticulum; PMSF, phenylmethylsulfonyl fluoride; Pipes, 1,4-piperazinediethanesulfonic acid; GFP, green fluorescent protein.2The abbreviations used are: PAS, preautophagosomal structure; SNARE, soluble N-ethylmaleimide factor attachment protein receptor; Mes, 2-(N-morpholino)ethanesulfonic acid; Mops, 3-(N-morpholino)propanesulfonic acid; ER, endoplasmic reticulum; PMSF, phenylmethylsulfonyl fluoride; Pipes, 1,4-piperazinediethanesulfonic acid; GFP, green fluorescent protein. a perivacuolar organelle where numerous Atg proteins colocalize (12Suzuki K. Kirisako T. Kamada Y. Mizushima N. Noda T. Ohsumi Y. EMBO J. 2001; 20: 5971-5981Crossref PubMed Scopus (781) Google Scholar, 13Kim J. Huang W.P. Stromhaug P.E. Klionsky D.J. J. Biol. Chem. 2001; 277: 763-773Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). Out of the PAS double membrane-layered transport vesicles, the autophagosomes are formed (14Shintani T. Huang W.P. Stromhaug P.E. Klionsky D.J. Dev. Cell. 2002; 3: 825-837Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar, 15Suzuki K. Kamada Y. Ohsumi Y. Dev. Cell. 2002; 3: 815-824Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). The outer membrane of the autophagosome then fuses with the vacuolar membrane, and the inner part of the vesicle is released as a still membrane-limited autophagic body into the vacuole. Within the vacuole the autophagic bodies are lysed dependent on the putative lipase Atg15 (16Epple U.D. Eskelinen E.L. Thumm M. J. Biol. Chem. 2003; 278: 7810-7821Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar), and the cytosolic material is degraded by the various vacuolar hydrolases. The use of transport vesicles limited by two membrane layers distinguishes autophagy from other transport pathways. Consistently, the molecular mechanisms used for the biogenesis of these vesicles are also unconventional. For example, the homotypic membrane fusion event during the sealing of autophagosomes does not involve the action of the yeast NSF Sec18; also, none of the yeast t-SNAREs has been localized to the PAS (17Reggiori F. Wang C.W. Nair U. Shintani T. Abeliovich H. Klionsky D.J. Mol. Biol. Cell. 2004; 15: 2189-2204Crossref PubMed Scopus (113) Google Scholar, 18Ishihara N. Hamasaki M. Yokota S. Suzuki K. Kamada Y. Kihara A. Yoshimori T. Noda T. Ohsumi Y. Mol. Biol. Cell. 2001; 12: 3690-3702Crossref PubMed Scopus (289) Google Scholar). In S. cerevisiae the Cvt (cytoplasm to vacuole targeting) pathway was discovered as a variant of the starvation-induced unselective autophagy. In contrast to the degradative autophagic pathway, the constitutive Cvt pathway acts under nutrient-rich conditions as a biosynthetic route selectively delivering specific cargo proteins such as proaminopeptidase I to the vacuole. The Cvt pathway and autophagy share most of their molecular components, albeit the function of some Atg proteins is restricted to one of the pathways. The most striking difference between autophagy and the Cvt pathway is the size of their transport intermediates. Cvt vesicles are smaller than autophagosomes and do not enclose cytosolic material. Pexophagy, the selective autophagic degradation of dispensable peroxisomes, is another variant of autophagy. It takes place when yeast cells are shifted from a medium inducing the proliferation of peroxisomes to a medium containing glucose (19Hutchins M.U. Veenhuis M. Klionsky D.J. J. Cell Sci. 1999; 112: 4079-4087Crossref PubMed Google Scholar). Biogenesis of Cvt vesicles and autophagosomes requires the sorting of large amounts of membranes to the PAS. The origin of these membranes remains elusive, but recent work demonstrated that a functional ER and Golgi is essential for both the biogenesis of Cvt vesicles and autophagosomes (17Reggiori F. Wang C.W. Nair U. Shintani T. Abeliovich H. Klionsky D.J. Mol. Biol. Cell. 2004; 15: 2189-2204Crossref PubMed Scopus (113) Google Scholar), (18Ishihara N. Hamasaki M. Yokota S. Suzuki K. Kamada Y. Kihara A. Yoshimori T. Noda T. Ohsumi Y. Mol. Biol. Cell. 2001; 12: 3690-3702Crossref PubMed Scopus (289) Google Scholar). Accordingly, mutations affecting the early secretory pathway block both autophagy and the Cvt pathway. Here, we identify Trs85 as an essential component for the biogenesis of Cvt vesicles. Trs85 is a subunit of the TRAPP complexes, which act in ER-to Golgi and Golgi trafficking (20Sacher M. Barrowman J. Wang W. Horecka J. Zhang Y. Pypaert M. Ferro-Novick S. Mol. Cell. 2001; 7: 433-442Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). One might, therefore, expect that defects at the ER or Golgi in trs85Δ cells might be responsible for the autophagic defects. Our experiments, however, point to differences in the phenotypes between trs85Δ cells and cells with defects in the early secretory pathway. First of all, in contrast to components of the early secretory pathway, Trs85 is not needed for the viability of yeast cells. Furthermore, our experiments did not show defects in vacuolar biogenesis in trs85Δ cells. Early secretory mutants are blocked in autophagy, and they fail to recruit proaminopeptidase I to their PAS (17Reggiori F. Wang C.W. Nair U. Shintani T. Abeliovich H. Klionsky D.J. Mol. Biol. Cell. 2004; 15: 2189-2204Crossref PubMed Scopus (113) Google Scholar). Here we show that autophagy proceeds in trs85Δ cells with half of the wild-type rate. Furthermore, trs85Δ cells can recruit proaminopeptidase I to their PAS but fail to recruit green fluorescent protein (GFP)-Atg8 in rich media. This differences support the idea that Trs85 might play a specific role during the Cvt pathway and autophagy. Strains, Media, Antibodies, and Reagents—Standard media were used (21Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Current Protocols in Molecular Biology. Greene Publishing Associates, New York, NY1987Google Scholar). Starvation medium was either SD(-N) (1.7% yeast nitrogen base without amino acids and ammonium sulfate, 2% glucose) or 1% potassium acetate as indicated. Antibodies were anti-3-phosphoglycerate kinase, anti-carboxypeptidase Y, anti-green fluorescent protein (Molecular Probes, Leiden, The Netherlands); horseradish peroxidase (HRPO)-conjugated goat anti-rabbit (Medac, Hamburg, Germany) and HRPO-conjugated goat anti-mouse (Dianova, Hamburg, Germany); anti-proaminopeptidase I (22Barth H. Meiling-Wesse K. Epple U.D. Thumm M. FEBS Lett. 2002; 512: 173-179Crossref PubMed Scopus (31) Google Scholar) and anti-Atg8 (23Meiling-Wesse K. Barth H. Voss C. Eskelinen E.L. Epple U.D. Thumm M. J. Biol. Chem. 2004; 279: 37741-37750Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). Fox3 antibodies were supplied by R. Erdmann, Bochum, Germany. Chemicals—PMSF was from Sigma, oligonucleotides were from MWG-Biotech, Ebersberg, Germany and Operon, Germany; other analytical grade chemicals were from Sigma or Merck. For immunoblots the ECL detection kit (Amersham Biosciences) was used. Strains used are listed in TABLE ONE.TABLE ONEStrains usedWCG4aMat α ura3 his3-11,15 leu2-3,112Ref. 6Thumm M. Egner R. Koch B. Schlumpberger M. Straub M. Veenhuis M. Wolf D.H. FEBS Lett. 1994; 349: 275-280Crossref PubMed Scopus (476) Google ScholarSEY6211Mat a leu2-3,112 ura 3-52 his3-D200 trp 1Δ901 ade 2-101 suc2Δ9Ref. 7Harding T.M. Hefner-Gravink A. Thumm M. Klionsky D.J. J. Biol. Chem. 1996; 271: 17621-17624Abstract Full Text Full Text PDF PubMed Scopus (216) Google ScholarYKMW1WCG4a trs85::KANThis studyYKMW10WCG4a ypt7::HIS3Ref. 47Meiling-Wesse K. Barth H. Thumm M. FEBS Lett. 2002; 526: 71-76Crossref PubMed Scopus (48) Google ScholarYKMW16WCG4a atg3::ADE2 ypt7::HIS3Ref. 23Meiling-Wesse K. Barth H. Voss C. Eskelinen E.L. Epple U.D. Thumm M. J. Biol. Chem. 2004; 279: 37741-37750Abstract Full Text Full Text PDF PubMed Scopus (39) Google ScholarYKMW18WCG4a trs85::KAN ypt7::HIS3This studyYKMW21WCG4a trs85::KAN pho8::LEU2This studyYKMW28SEY6211 trs85::KANThis studyYKMW36WCG4a ape1::KANThis studyAHY1468SEY6211 atg1Ref. 7Harding T.M. Hefner-Gravink A. Thumm M. Klionsky D.J. J. Biol. Chem. 1996; 271: 17621-17624Abstract Full Text Full Text PDF PubMed Scopus (216) Google ScholarTHY193SEY6211 atg7Ref. 27Harding T.M. Morano K.A. Scott S.V. Klionsky D.J. J. Cell Biol. 1995; 131: 591-602Crossref PubMed Scopus (389) Google ScholarTHY313SEY6211 atg8Ref. 27Harding T.M. Morano K.A. Scott S.V. Klionsky D.J. J. Cell Biol. 1995; 131: 591-602Crossref PubMed Scopus (389) Google ScholarBY4743/Y20000MAT a/MAT α his3-Δ1/his3-Δ1 leu2-Δ0/leu2-Δ0 met15-Δ0/MET15 LYS2/lys2-Δ0 ura3-Δ0/ura3-Δ0Euroscarf Collection, Frankfurt, GermanyY34042BY4743 trs85::KAN/gsg1::KANEuroscarf CollectionY33357BY4743 atg12::KAN/atg12::KANEuroscarf CollectionY32371BY4743 trs33::KAN/trs33::KANEuroscarf CollectionY34796BY4743 trs65::KAN/trs65::KANEuroscarf CollectionY32098BY4743 pep4::KAN/pep4::KANEuroscarf CollectionY23883BY4743 vma1::KAN/vma1::KANNEuroscarf CollectionY36953BY4743 ape1ΔEuroscarf CollectionYHB1WCG4a atg18::KANRef. 48Barth H. Meiling-Wesse K. Epple U.D. Thumm M. FEBS Lett. 2001; 508: 23-28Crossref PubMed Scopus (90) Google ScholarYMS6WCG4a atg3::ADE2Ref. 49Schlumpberger M. Schaeffeler E. Straub M. Bredschneider M. Wolf D.H. Thumm M. J. Bacteriol. 1997; 179: 1068-1076Crossref PubMed Scopus (79) Google ScholarYMS30WCG4a atg1::KANRef. 50Straub M. Bredschneider M. Thumm M. J. Bacteriol. 1997; 179: 3875-3883Crossref PubMed Google ScholarYMTAWCG4a pep4::HIS3Ref. 6Thumm M. Egner R. Koch B. Schlumpberger M. Straub M. Veenhuis M. Wolf D.H. FEBS Lett. 1994; 349: 275-280Crossref PubMed Scopus (476) Google ScholarYUE66WCG4a pho8::LEU2Ref. 51Meiling-Wesse K. Barth H. Voss C. Barmark G. Muren E. Ronne H. Thumm M. FEBS Lett. 2002; 530: 174-180Crossref PubMed Scopus (23) Google ScholarYUE63WCG4a atg15::KAN pho8::LEU2Ref. 51Meiling-Wesse K. Barth H. Voss C. Barmark G. Muren E. Ronne H. Thumm M. FEBS Lett. 2002; 530: 174-180Crossref PubMed Scopus (23) Google ScholarYUE47WCG4a atg19::KANRef. 51Meiling-Wesse K. Barth H. Voss C. Barmark G. Muren E. Ronne H. Thumm M. FEBS Lett. 2002; 530: 174-180Crossref PubMed Scopus (23) Google ScholarBet3-GFPMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Bet3::GFP(S65T)::His3MXInvitrogen (43Huh W.K. Falvo J.V. Gerke L.C. Carroll A.S. Howson R.W. Weissman J.S. O'Shea E.K. Nature. 2003; 425: 686-691Crossref PubMed Scopus (3234) Google Scholar)Trs120-GFPMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Trs120::GFP(S65T)::His3MXInvitrogen (43Huh W.K. Falvo J.V. Gerke L.C. Carroll A.S. Howson R.W. Weissman J.S. O'Shea E.K. Nature. 2003; 425: 686-691Crossref PubMed Scopus (3234) Google Scholar)Trs85-GFPMATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Trs85::GFP(S65T)::His3MXInvitrogen (43Huh W.K. Falvo J.V. Gerke L.C. Carroll A.S. Howson R.W. Weissman J.S. O'Shea E.K. Nature. 2003; 425: 686-691Crossref PubMed Scopus (3234) Google Scholar) Open table in a new tab GSG1/TRS85 Chromosomal Deletion—A PCR fragment with the kanamycin resistance gene flanked with TRS85 sequences was generated from a-GSG1, 5′-CTTTATTCAGTCGGCTTTACAGATACTGAGGTAACTTATAcagctgaagcttcgtacgc-3′, and as-GSG1, 5′-TACGTATAATTTATACTCAAAACATGAATTTTCCATAAAGgcataggccactagtggatctg-3′, and the plasmid pUG6 carrying the kanamycin resistance marker (24Güldener U. Heck S. Fielder T. Beinhauer J. Hegemann J.H. Nucleic Acids Res. 1996; 24: 2519-2524Crossref PubMed Scopus (1335) Google Scholar). Chromosomal replacement of TRS85 with this fragment in WCG4a yielded YKMW1 and in SEY6211 the strain YKMW28. Deletions were confirmed with Southern blot analysis (not shown). YPT7 Chromosomal Deletion—YPT7 deletion strains were constructed using the plasmid pBSKS+ ypt7::HIS3 (D. Gallwitz, Goettingen), which was digested with XhoI and PacI and transformed into YKMW1 yielding YKMW18 (gsg1Δ::KAN ypt7Δ::HIS3). The chromosomal replacement of the YPT7 gene was confirmed by Southern blotting (not shown). PHO8 Chromosomal Deletion—The PHO8 gene in the following strains was replaced with the LEU2 gene using the deletion plasmid pGF10 (pho8Δ::LEU2) (25Nothwehr S.F. Conibear E. Stevens T.H. J. Cell Biol. 1995; 129: 35-46Crossref PubMed Scopus (147) Google Scholar). In YKMW1 (trs85Δ) the deletion yielded YKMW21 (trs85Δ::KAN pho8Δ::LEU2). Plasmids—Plasmid pJH1 (pRS313-API-RFP) was generated by homologue recombination in yeast. A PCR fragment containing mRFP was amplified using primers API-RFP up (GGAGATCAGTCTACGATGAATTCGGCGAGTTGTCCCGGGTAgcctcctccgaggacgtcatc), RFP-Vector down (TCGACGGTATCGATAAGCTTGATATCGAATTCTAGAGTCGCttaggcgccggtggagtggcg), and pmRFP-KanMX (26Campbell R.E. Tour O. Palmer A.E. Steinbach P.A. Baird G.S. Zacharias D.A. Tsien R.Y. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 7877-7882Crossref PubMed Scopus (1959) Google Scholar) as template. pKMW13 was cut with AgeI/NotI, and the resulting 6.8-kilobase fragment was cotransformed with the mRFP-containing PCR fragment in the yeast strain Y36953 (Euroscarf). The recombinant plasmid was rescued from transformants able to grow on SC medium lacking histidine, and the correct recombination was confirmed. For pKMW13 (Ape1-YFP), the eYFP fluorescent protein was excised from pEYFP (BD Clontech) with XmaI and EcoRI and inserted into the pRS313 vector at the same sites. This vector (pKMW1) was cut with KspI and XmaI and combined with the PCR fragment containing APE1 with its native promoter and the added KspI and XmaI incision sites, yielding the plasmid pKMW13. The PCR fragment was constructed with the primer KSPI-APEI (AGGGCCGCGGCTACTTTAGGGTATAGGTTG) and XMAI-APEI (AGGGCCCGGGACAACTCGCCGAATTCATCG) and the plasmid pRN1 (27Harding T.M. Morano K.A. Scott S.V. Klionsky D.J. J. Cell Biol. 1995; 131: 591-602Crossref PubMed Scopus (389) Google Scholar). The following plasmids were described elsewhere: pGFP-Atg8 (12Suzuki K. Kirisako T. Kamada Y. Mizushima N. Noda T. Ohsumi Y. EMBO J. 2001; 20: 5971-5981Crossref PubMed Scopus (781) Google Scholar), pMet25::GFP-Atg9 (28Lang T. Reiche S. Straub M. Bredschneider M. Thumm M. J. Bacteriol. 2000; 182: 2125-2133Crossref PubMed Scopus (79) Google Scholar), and pGFP-Atg19 (29Leber R. Silles E. Sandoval I.V. Mazon M.J. J. Biol. Chem. 2001; 276: 29210-29217Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Cell lysis, SDS-PAGE, and immunoblotting was done as described previously (16Epple U.D. Eskelinen E.L. Thumm M. J. Biol. Chem. 2003; 278: 7810-7821Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). Alkaline Phosphatase Assay—The pho8Δ::LEU2 deletion strains were transformed with the Pho8Δ60 expression plasmid pCC5 (30Campbell C.L. Thorsness P.E. J. Cell Sci. 1998; 111: 2455-2464Crossref PubMed Google Scholar). Enzymatic activity was measured as described (31Noda T. Matsuura A. Wada Y. Ohsumi Y. Biochem. Biophys. Res. Commun. 1995; 210: 126-132Crossref PubMed Scopus (293) Google Scholar) with the following modifications. Logarithmically grown cells were washed with water and resuspended in SD(-N) medium. One A600 unit of cells was harvested at each time point and washed once with water. The cells were then suspended in 0.2 ml of assay buffer (250 mm Tris/HCl, pH 9.0, 10 mm MgSO4, 10 μm ZnSO4) and disrupted by vortexing with glass beads. After centrifugation, 50 μl of the supernatant was added to 0.5 ml of assay buffer and 50 μl of 55 mm potassium naphthyl phosphate. After incubation for 15 min at 30 °C, 0.5 ml of 2 m glycine/NaOH, pH 11.0, was added to stop the reaction. Fluorescence intensity was measured with excitation at 345 nm and emission at 472 nm. Protein concentration was determined with the BCA method (Pierce). Measurement of Pexophagy—Following the protocol of Hutchins et al. (19Hutchins M.U. Veenhuis M. Klionsky D.J. J. Cell Sci. 1999; 112: 4079-4087Crossref PubMed Google Scholar), logarithmically growing cells were shifted to synthetic glycerol medium (0.67% yeast nitrogen base without amino acids, 50 mm Mes, 50 mm Mops, 3% glycerol, 0.1% glucose, pH 5.5) for 12 h at 30 °C. Then a 10× yeast extract/peptone solution was added to a final concentration of 1% yeast extract and 2% peptone, and the cells were incubated for 4 h. The cells were then washed and transferred to YTO (0.67% yeast nitrogen base without amino acids, 0.1% Tween 40, 0.1% oleic acid) for 19 h for peroxisome induction. To induce peroxisome degradation cells were shifted to SD(-N). Aliquots were taken at the indicated times and prepared for immunoblot analysis using antibodies against Fox3p (R. Erdmann, Bochum, Germany). Probing Vacuolar Acidification—Cells were resuspended in 1 ml of quinacrine buffer (10 mm HEPES, 2% glucose, pH 7.4). 1 μl of 1 mm quinacrine stock was added, and the mixture was incubated for 10 min at room temperature. The cells were washed twice with buffer and observed with a Zeiss Axioscope2 microscope equipped with an Axiocam digital camera. Protease Protection Assay—The protease protection experiment was done according to Scott et al. (32Scott S.V. Guan J. Hutchins M.U. Kim J. Klionsky D.J. Mol. Cell. 2001; 7: 1131-1141Abstract Full Text Full Text PDF PubMed Scopus (202) Google Scholar) with the following modifications. Forty A600 units of early stationary or starved cells were harvested, washed twice with water, and incubated for 20 min in 4 ml of buffer A (100 mm Tris/H2SO4, pH 9.4) containing 20 mm dithiothreitol. The cells were then pelleted, resuspended in 4 ml of oxalyticase buffer (1 m sorbitol, 50 mm NaH2PO4, pH 7.4) containing 50 μg/ml oxalyticase, and spheroplasted for 30 min at 30 °C. The spheroplasts were harvested and hypotonically lysed in PS200 (200 mm sorbitol, 20 mm PIPES, 5 mm MgCl2, pH 6.8). The lysis solution was repeatedly precleared at 500 × g and 4 °C, and the supernatant was divided into three 300-μl aliquots. The aliquots were mixed with 300 μl of PS200, PS200 with 100 μg/ml proteinase K, and PS200 with 100 μg/ml proteinase K and 0.4% Triton X-100. After 15 min on ice, the digestion was halted through trichloroacetic acid precipitation. The pellets were dissolved in 100 μl of Laemmli buffer. GFP-Atg8 Degradation—Early logarithmically grown cells expressing GFP-Atg8 from a centromeric plasmid (12Suzuki K. Kirisako T. Kamada Y. Mizushima N. Noda T. Ohsumi Y. EMBO J. 2001; 20: 5971-5981Crossref PubMed Scopus (781) Google Scholar) were harvested, washed twice with water, and resuspended in SD(-N) medium. Samples were harvested hourly for 4 h and processed for immunoblotting. Accumulation of Autophagic Bodies—Cells grown to the stationary phase were washed twice with water and then shifted to SD(-N) with and without 10 mm phenylmethylsulfonyl fluoride. Photos were taken using Nomarski optics and a Zeiss Axioscope2 microscope. Electron Microscopy—For electron microscopy the cells were fixed with permanganate and Epon embedded as described previously (16Epple U.D. Eskelinen E.L. Thumm M. J. Biol. Chem. 2003; 278: 7810-7821Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). A Zeiss EM 900 transmission electron microscope was used to take photographs at 12,000× magnification. The area of autophagosome profiles was determined by point counting from these photographs. Cell Fractionation—Eighty A600 units of late stationary cells were harvested, washed once with water, and incubated at 30 °C for 15 min in buffer A (100 mm Tris/H2SO4, pH 9.4) containing 20 mm dithiothreitol. Cells were resuspended in oxalyticase buffer containing 50 μg/ml oxalyticase, spheroplasted at 30 °C for 30 min, and then hypotonically lysed in ice-cold PS200 buffer (200 mm sorbitol 20 mm potassium-PIPES, pH 6.8, with 5 mm MgCl2) containing 1 mg/ml leupeptin, 1 mg/ml chymo-statin, 1 mg/ml antipain, 1 mg/ml pepstatin, 1 mm phenylmethylsulfonyl fluoride, and Complete® protease inhibitor mix (Roche Diagnostics). Cell debris was removed by centrifugation at 1000 × g, and the supernatant was transferred to a fresh tube three times. 300 μl of supernatant was taken for total, and the proteins were precipitated with trichloroacetic acid on ice. 700 μl was transferred to a fresh tube and centrifuged for 20 min at 4 °C and 10,000 × g. 300 μl of supernatant was kept as S13, and 400 μl of the supernatant was centrifuged for 1 h at 4°C and 100,000 × g. The pellet fraction (P13) was resuspended in Laemmli buffer with 1% β-mercaptoethanol. After high speed centrifugation, 300 μl of supernatant (S100) was precipitated with trichloroacetic acid, and the pellet (P100) was resuspended in Laemmli buffer with 1% β-mercaptoethanol. The trichloroacetic acid-precipitated proteins were centrifuged and resuspended in Laemmli buffer with 1% β-mercaptoethanol. Growing trs85Δ (gsg1Δ) Cells Are Defective in the Cvt Pathway—In the yeast deletion project each nonessential yeast gene has been chromosomally deleted, resulting in a collection of ∼5000 yeast deletion strains. To identify novel components of the autophagic machinery, we screened this strain collection for mutants sensitive to nitrogen limitation, a phenotype common to autophagy mutants. Starvation-sensitive mutants can easily be scored by incubating colonies for some days on Phloxin plates lacking a nitrogen source (5Tsukada M. Ohsumi Y. FEBS Lett. 1993; 333: 169-174Crossref PubMed Scopus (1357) Google Scholar, 33Barth H. Thumm M. Gene (Amst.). 2001; 274: 151-156Crossref PubMed Scopus (29) Google Scholar). Phloxin is a red dye that stains dead cells but is unable to enter living cells. Because on these plates colonies of starvation-sensitive mutants contain more dead cells, they appear dark red. This initial screen identified more than 1300 strains, which were further analyzed in Western blots for their ability to mature proaminopeptidase I. Here we report the identification of trs85Δ (gsg1Δ) in this screen. Trs85 is an 85-kDa component of both the TRAPP I and TRAPP II complex (20Sacher M. Barrowman J. Wang W. Horecka J. Zhang Y. Pypaert M. Ferro-Novick S. Mol. Cell. 2001; 7: 433-442Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar, 34Sacher M. Barrowman J. Schieltz D. Yates III, J.R. Ferro-Novick S. Eur. J. Cell Biol. 2000; 79: 71-80Crossref PubMed Scopus (102) Google Scholar). The TRAPP complexes function in ER-to-Golgi and Golgi transport (20Sacher M. Barrowman J. Wang W. Horecka J. Zhang Y. Pypaert M. Ferro-Novick S. Mol. Cell. 2001; 7: 433-442Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). Diploid cells lacking Trs85 fail to sporulate; based on this phenotype TRS85 has also been termed GSG1 (general sporulation gene 1) (35Kaytor M.D. Livingston D.M. Yeast. 1995; 11: 1147-1155Crossref PubMed Scopus (9) Google Scholar). For further analysis we chromosomally deleted TRS85 in our laboratory wild-type strain WCG (see "Experimental procedures"). In contrast to wild-type cells non-starved trs85Δ cells fail to mature proaminopeptidase I (Fig. 1A, lanes 20 and 21). Starvation induction of autophagy rescues this maturation defect (Fig. 1A, lanes 22-26). This suggests that Trs85 is required for the selective Cvt pathway but not for autophagy. To confirm that a defect in the targeting of proaminopeptidase I to the vacuole is responsible for the maturation defect, we generated a pApe1-RFP fusion protein of proaminopeptidase I with the red fluorescent protein (26Campbell R.E. Tour O. Palmer A.E. Steinbach P.A. Baird G.S. Zacharias D.A. Tsien R.Y. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 7877-7882Crossref PubMed Scopus (1959) Google Scholar). Fluorescence microscopy confirmed vacuolar targeting of this fusion protein via the Cvt pathway in non-starved wild-type cells (Fig. 1B). In non-starved trs85Δ cells pApe1-RFP is retained in the cytosol (Fig. 1B), demonstrating a vacuolar targeting defect. As a control we included atg19Δ cells, which are defective in vacuolar targeting of proaminopeptidase I. The two TRAPP complexes consist of 10 proteins; 3 of them (Trs33, Trs65, and Trs85) are dispensable for the vitality of yeast cells (20Sacher M. Barrowman J. Wang W. Horecka J. Zhang Y. Pypaert M. Ferro-Novick S. Mol. Cell. 2001; 7: 433-442Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). As shown in Fig. 1C, cells lacking Trs33 or Trs65 do not show defects in the Cvt pathway or autophagy. Autophagy Takes Place in Starved trs85Δ cells but with a Reduced Rate—Maturation of proaminopeptidase I in starved trs85Δ cells suggests that autophagy may not be affected. To further address this question, we checked cells starved in the presence of the proteinase B inhibitor PMSF under the light microscope. PMSF is known to inhibit the intravacuolar breakdown of autophagic bodies (36Takeshige K. Baba

Referência(s)