Sources of NADPH and Expression of Mammalian NADP+-specific Isocitrate Dehydrogenases in Saccharomyces cerevisiae
1998; Elsevier BV; Volume: 273; Issue: 47 Linguagem: Inglês
10.1074/jbc.273.47.31486
ISSN1083-351X
AutoresKaryl I. Minard, Gary T. Jennings, Thomas M. Loftus, Dejun Xuan, Lee McAlister-Henn,
Tópico(s)Enzyme Structure and Function
ResumoTo compare roles of specific enzymes in supply of NADPH for cellular biosynthesis, collections of yeast mutants were constructed by gene disruptions and matings. These mutants include haploid strains containing all possible combinations of deletions in yeast genes encoding three differentially compartmentalized isozymes of NADP+-specific isocitrate dehydrogenase and in the gene encoding glucose-6-phosphate dehydrogenase (Zwf1p). Growth phenotype analyses of the mutants indicate that either cytosolic NADP+-specific isocitrate dehydrogenase (Idp2p) or the hexose monophosphate shunt is essential for growth with fatty acids as carbon sources and for sporulation of diploid strains, a condition associated with high levels of fatty acid synthesis. No new biosynthetic roles were identified for mitochondrial (Idp1p) or peroxisomal (Idp3p) NADP+-specific isocitrate dehydrogenase isozymes. These and other results suggest that several major presumed sources of biosynthetic reducing equivalents are non-essential in yeast cells grown under many cultivation conditions. To develop an in vivo system for analysis of metabolic function, mammalian mitochondrial and cytosolic isozymes of NADP+-specific isocitrate dehydrogenase were expressed in yeast using promoters from the cognate yeast genes. The mammalian mitochondrial isozyme was found to be imported efficiently into yeast mitochondria when fused to the Idp1p targeting sequence and to substitute functionally for Idp1p for production of α-ketoglutarate. The mammalian cytosolic isozyme was found to partition between cytosolic and organellar compartments and to replace functionally Idp2p for production of α-ketoglutarate or for growth on fatty acids in a mutant lacking Zwf1p. The mammalian cytosolic isozyme also functionally substitutes for Idp3p allowing growth on petroselinic acid as a carbon source, suggesting partial localization to peroxisomes and provision of NADPH for β-oxidation of that fatty acid. To compare roles of specific enzymes in supply of NADPH for cellular biosynthesis, collections of yeast mutants were constructed by gene disruptions and matings. These mutants include haploid strains containing all possible combinations of deletions in yeast genes encoding three differentially compartmentalized isozymes of NADP+-specific isocitrate dehydrogenase and in the gene encoding glucose-6-phosphate dehydrogenase (Zwf1p). Growth phenotype analyses of the mutants indicate that either cytosolic NADP+-specific isocitrate dehydrogenase (Idp2p) or the hexose monophosphate shunt is essential for growth with fatty acids as carbon sources and for sporulation of diploid strains, a condition associated with high levels of fatty acid synthesis. No new biosynthetic roles were identified for mitochondrial (Idp1p) or peroxisomal (Idp3p) NADP+-specific isocitrate dehydrogenase isozymes. These and other results suggest that several major presumed sources of biosynthetic reducing equivalents are non-essential in yeast cells grown under many cultivation conditions. To develop an in vivo system for analysis of metabolic function, mammalian mitochondrial and cytosolic isozymes of NADP+-specific isocitrate dehydrogenase were expressed in yeast using promoters from the cognate yeast genes. The mammalian mitochondrial isozyme was found to be imported efficiently into yeast mitochondria when fused to the Idp1p targeting sequence and to substitute functionally for Idp1p for production of α-ketoglutarate. The mammalian cytosolic isozyme was found to partition between cytosolic and organellar compartments and to replace functionally Idp2p for production of α-ketoglutarate or for growth on fatty acids in a mutant lacking Zwf1p. The mammalian cytosolic isozyme also functionally substitutes for Idp3p allowing growth on petroselinic acid as a carbon source, suggesting partial localization to peroxisomes and provision of NADPH for β-oxidation of that fatty acid. kilobase pair(s) base pair(s) polymerase chain reaction. Reducing equivalents in the form of NADPH are required by many enzymes in central biosynthetic pathways, whereas the enzymatic sources of biosynthetic reducing equivalents are believed to be limited in number. The oxidative branch of the hexose monophosphate shunt or pentose phosphate pathway is generally accepted to be the major cellular source of NADPH. However, disruption of the ZWF1gene encoding glucose-6-phosphate dehydrogenase, the first and rate-limiting enzyme in the oxidative branch, was not found to produce significant defects in biosynthetic capacity in haploid strains of Saccharomyces cerevisiae. Instead, this disruption produces discrete phenotypes including a requirement for organic sulfur,e.g. methionine or cysteine (1Thomas D. Cherest H. Surdin-Kerjan Y. EMBO J. 1991; 10: 547-553Crossref PubMed Scopus (115) Google Scholar), and an enhanced sensitivity to oxidizing agents including hydrogen peroxide and diamide (2Nogae I. Johnston M. Gene (Amst.). 1990; 96: 161-169Crossref PubMed Scopus (155) Google Scholar). Since a yeast disruption mutant lacking cytosolic superoxide dismutase (Sod1p) is also a methionine auxotroph, these phenotypes have been interpreted as an impairment of redox status during aerobic stress (3Slekar K.H. Kosman D.J. Culotta V.C. J. Biol. Chem. 1996; 271: 28831-28836Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). In addition, an earlier study of a zwf1 homozygous diploid mutant indicated that this enzyme is not essential for the significant increase in fatty acid biosynthesis that occurs during sporulation (4Dickinson J.R. Hewlins M.J.E. J. Gen. Microbiol. 1988; 134: 333-337PubMed Google Scholar). Thus the contribution of Zwf1p to the supply of NADPH for biosynthetic pathways is unclear. A second major source of biosynthetic reducing equivalents is proposed to be NADP+-specific isocitrate dehydrogenase (5Plaut G.W.E. Gabriel J.L. Lennon D.F. Stratman F.W. Zahlten R.N. Biochemistry of Metabolic Proceses. Elsevier Science Publishing Co., New York1983: 285-301Google Scholar, 6Galvez S. Gadal P. Plant Sci. 1995; 105: 1-14Crossref Scopus (79) Google Scholar). In yeast, there are three highly homologous (>70% residue identity) but differentially compartmentalized isozymes as follows: mitochondrial Idp1p (7Haselbeck R.J. McAlister-Henn L. J. Biol. Chem. 1991; 266: 2339-2345Abstract Full Text PDF PubMed Google Scholar), cytosolic Idp2p (8Loftus T.M. Hall L.V. Anderson S.L. McAlister-Henn L. Biochemistry. 1994; 33: 9661-9667Crossref PubMed Scopus (51) Google Scholar), and peroxisomal Idp3p (9Henke B. Girzalsky W. Berteaux-Lecellier V. Erdmann R. J. Biol. Chem. 1998; 273: 3702-3711Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 10van Roermund C.W.T. Hettema E.H. Kal A.J. van den Berg M. Tabak H.F. Wanders R.J.A. EMBO J. 1998; 17: 677-687Crossref PubMed Scopus (122) Google Scholar). These isozymes are structurally and functionally distinct from the mitochondrial NAD+-specific isocitrate dehydrogenase that functions in the tricarboxylic acid cycle (11Cupp J.R. McAlister-Henn L. J. Biol. Chem. 1991; 266: 22199-22205Abstract Full Text PDF PubMed Google Scholar). Gene disruption analyses have shown that loss of either or both of the major NADP+-specific isozymes, Idp1p and Idp2p, produces no observable growth phenotype (12Zhao W-N. McAlister-Henn L. Biochemistry. 1996; 35: 7873-7878Crossref PubMed Scopus (41) Google Scholar), whereas loss of Idp3p reduces or eliminates growth on unsaturated fatty acids indicative of a role for this enzyme as a compartmental source of NADPH for specific steps of β-oxidation (9Henke B. Girzalsky W. Berteaux-Lecellier V. Erdmann R. J. Biol. Chem. 1998; 273: 3702-3711Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 10van Roermund C.W.T. Hettema E.H. Kal A.J. van den Berg M. Tabak H.F. Wanders R.J.A. EMBO J. 1998; 17: 677-687Crossref PubMed Scopus (122) Google Scholar). Another study has shown that either Idp1p or Idp2p is essential and sufficient for production of α-ketoglutarate to support cellular synthesis of glutamate in the absence of the mitochondrial NAD+-specific enzyme (12Zhao W-N. McAlister-Henn L. Biochemistry. 1996; 35: 7873-7878Crossref PubMed Scopus (41) Google Scholar). The latter study was conducted following construction of a collection of yeast mutants containing all possible combinations of disruptions of genes for the isozymes in question. We initiate the current analysis of major potential sources of NADPH with a similar approach to compare contributions of Zwf1p and the NADP+-specific isozymes of isocitrate dehydrogenase. Specific growth phenotypes associated with loss of each yeast isozyme of NADP+-specific isocitrate dehydrogenase are defined in this study. Mutant strains displaying these phenotypes provide tests for in vivo function of altered or heterologous forms of the isozymes. We have used these tests to evaluate expression and function of highly homologous mitochondrial and cytosolic isozymes of mammalian NADP+-specific isocitrate dehydrogenase in yeast cells. Yeast strains used in this study were the parental haploid strain S173-6B (MATa leu2-3, 112 his3-1 ura3-52 trp1-289, 13) and previously constructed mutants of this strain containing deletions and URA3insertions in the IDP1 and/or IDP2 loci (7Haselbeck R.J. McAlister-Henn L. J. Biol. Chem. 1991; 266: 2339-2345Abstract Full Text PDF PubMed Google Scholar, 8Loftus T.M. Hall L.V. Anderson S.L. McAlister-Henn L. Biochemistry. 1994; 33: 9661-9667Crossref PubMed Scopus (51) Google Scholar). An isogenic haploid strain (MATα leu2-3, 112 ura3-52 trp1-289 ade2-101) was used for matings. Matings, sporulation, and tetrad dissections were conducted as described by Rose et al. (14Rose M.D. Winston F. Hieter P. Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1990Google Scholar). Yeast strains were cultivated in rich YP medium (1% yeast extract, 2% Bacto-peptone) or in minimal YNB medium (0.17% yeast nitrogen base, 0.5% ammonium sulfate, pH 6.0) with appropriate supplements of 20 μg/ml to satisfy auxotrophic requirements for growth. Carbon sources were glucose, glycerol plus lactate, ethanol, or acetate added to 2%. Fatty acids used as carbon sources were added to 0.1% with 0.25% Tween 40. Growth rate analyses were conducted by monitoring colony growth on agar plates and by spectrophotometric measurements (A 600 nm) of doubling times in liquid medium. Chromosome and locus designations for S. cerevisiae genes analyzed in this study are as follows: IDP1 (IV, YDL066w), IDP2 (XII, YLR174w),IDP3 (XIV, YNL009w), and ZWF1 (XIV, YNL241c). DNA manipulations including ligation, amplification, purification, and sequence analysis followed methods described by Sambrook et al. (15Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Oligonucleotide-directed mutagenesis was conducted using the Transformer Site-directed Mutagenesis system ofCLONTECH. Isolation of yeast genomic DNA and RNA for Southern and Northern blot analyses followed procedures described in Rose et al. (14Rose M.D. Winston F. Hieter P. Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1990Google Scholar). DNA restriction fragments used as probes were radiolabeled using the random primer method (16Feinberg A.P. Vogelstein B. Anal. Biochem. 1984; 137: 266-267Crossref PubMed Scopus (5193) Google Scholar). The yeast ZWF1 gene was disrupted as described by Nogae and Johnston (2Nogae I. Johnston M. Gene (Amst.). 1990; 96: 161-169Crossref PubMed Scopus (155) Google Scholar) using a DNA fragment containing 0.58 kbp1 of the coding region generated by polymerase chain reaction (PCR) and a URA3 gene insertion within the coding region. Plasmids containing theZWF1 gene and the disruption construct were provided by Dr. Mark Johnston. For construction of diploid strains, the ZWF1gene was also disrupted by transformation with a DNA fragment containing the selectable kanMX4 gene flanked by 5′- and 3′-coding sequences of ZWF1. The fragment was constructed by PCR using primers homologous to ZWF1/kanMX4 sequences (5′-CTCTCCAATTGGCTGTATAGACAGAAAGAGTAAATCCAATAGCGTACGCTGCAGGTCGAC and 5′-GCATATATTCCTTCAATCCCTTTGGACCTCTTGATCCGTAGGATCGATGAATTCGAGCTCG) and plasmid pFA6a-kanMX4 (17Wach A. Yeast. 1996; 12: 259-265Crossref PubMed Scopus (703) Google Scholar) as the template. A lithium acetate procedure (18Hill J. Donald K.A. Griffiths D.E. Donald K.A. Nucleic Acids Res. 1991; 19: 5791Crossref PubMed Scopus (458) Google Scholar, 19Gietz D. St. Jean A. Woods R.A. Schiestl R.H. Eur. J. Biochem. 1992; 124: 457-463Google Scholar) was used for yeast transformations. Geneticin-resistant colonies were selected by growth on plates with rich medium and glucose containing 200 μg/ml G418. The yeast IDP3 gene was disrupted as described by Henkeet al. (9Henke B. Girzalsky W. Berteaux-Lecellier V. Erdmann R. J. Biol. Chem. 1998; 273: 3702-3711Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar) using transformation with a construct generated by PCR containing a selectable kanMX4 gene flanked by 5′- and 3′-noncoding regions of IDP3. The oligonucleotides used for PCR were provided by Dr. Ralf Erdmann. To construct plasmids for expression of mammalian mitochondrial NADP+-specific isocitrate dehydrogenase in yeast, a 100-bpEcoRI restriction fragment was removed from the coding region of the yeast IDP1 gene (7Haselbeck R.J. McAlister-Henn L. J. Biol. Chem. 1991; 266: 2339-2345Abstract Full Text PDF PubMed Google Scholar) and replaced with a 1.6-kbp EcoRI cDNA fragment containing the coding region and 3′-noncoding sequences for the pig mitochondrial enzyme (20Haselbeck R.J. Colman R.F. McAlister-Henn L. Biochemistry. 1992; 31: 6219-6223Crossref PubMed Scopus (45) Google Scholar). An oligonucleotide (5′-CCTCTCGCCTTGCTGCTGCCGACCAGAGGATC) containing codons from the IDP1 mitochondrial targeting sequence in frame with codons for the first nine residues of the mature pig protein was used for mutagenesis; this removed 300 bp and produced a fusion of IDP1 promoter and targeting sequences with the coding region for the mature pig protein. Correct fusion was verified by nucleotide sequence analysis. The gene fusion was transferred as a 2.9-kbpSphI restriction fragment to a centromere-based pRS315 plasmid (21Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar) for single copy expression and to a 2-μm YEp351 plasmid (22Hill J.E. Myers A.M. Koerner T.J. Tzagoloff A. Yeast. 1986; 2: 163-167Crossref PubMed Scopus (1080) Google Scholar) for multicopy expression in yeast transformants. For expression of mammalian cytosolic NADP+-specific isocitrate dehydrogenase in yeast, a 190-bpBclI/EcoRI restriction fragment was removed from the coding region of the yeast IDP2 gene (8Loftus T.M. Hall L.V. Anderson S.L. McAlister-Henn L. Biochemistry. 1994; 33: 9661-9667Crossref PubMed Scopus (51) Google Scholar) and replaced with a 1.7-kbp EcoRI cDNA fragment containing the coding region and 3′-noncoding sequences for the rat cytosolic enzyme (23Jennings G.T. Sechi S. Stevenson P.M. Tuckey R.C. Parmelee D. McAlister-Henn L. J. Biol. Chem. 1994; 269: 23128-23134Abstract Full Text PDF PubMed Google Scholar). An oligonucleotide (5′-GGTAACGTACGTATATATATAAATCGTAATGTCCAGAAAAATCCATGGCGG) was used for mutagenesis to remove 190 bp and to fuse theIDP2 promoter and initiator methionine codon to the first codon of the rat cDNA. The fusion was verified by nucleotide sequence analysis. The gene fusion was transferred as a 4-kbpBamHI restriction fragment into pRS315 and YEp351 plasmids. Cellular fractionation to obtain soluble cytosolic and organellar pellets was conducted as described by Daum et al. (24Daum G. Bohni P.C. Schatz G. J. Biol. Chem. 1982; 257: 13028-13033Abstract Full Text PDF PubMed Google Scholar). Nycodenz gradient centrifugation to separate peroxisomal and mitochondrial organelles was performed as described previously (25McAlister-Henn L. Steffan J.S. Minard K.I. Anderson S.L. J. Biol. Chem. 1995; 270: 21220-21225Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). For small scale assays of whole cell protein, harvested yeast cells were lysed with glass beads (26McAlister-Henn L. Thompson L.M. J. Bacteriol. 1987; 169: 5157-5166Crossref PubMed Google Scholar). Protein concentrations were determined with the Bradford dye binding assay (27Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (215535) Google Scholar). Enzyme assays for NADP+-specific isocitrate dehydrogenase and for glucose-6-phosphate dehydrogenase were conducted as described previously (7Haselbeck R.J. McAlister-Henn L. J. Biol. Chem. 1991; 266: 2339-2345Abstract Full Text PDF PubMed Google Scholar, 28Kuby S.A. Noltman E.A. Methods Enzymol. 1966; 9: 116-125Crossref Scopus (67) Google Scholar). Specific activities are expressed as micromoles of NADPH produced per min/mg of protein. Immunoblot analyses were conducted as described previously using an antiserum prepared against yeast Idp1p (7Haselbeck R.J. McAlister-Henn L. J. Biol. Chem. 1991; 266: 2339-2345Abstract Full Text PDF PubMed Google Scholar), which cross-reacts with yeast Idp2p and mamIdp1p, and an antiserum prepared against mamIdp2p (29Jennings G.T. Sadleir J.W. Stevenson P.M. Biochim. Biophys. Acta. 1990; 1034: 219-227Crossref PubMed Scopus (23) Google Scholar), which exhibits no cross-reactivity with yeast isozymes. Immunoreactivity was detected using radiolabeled protein A (7Haselbeck R.J. McAlister-Henn L. J. Biol. Chem. 1991; 266: 2339-2345Abstract Full Text PDF PubMed Google Scholar) or the enhanced chemiluminescent method (ECL, Amersham Pharmacia Biotech) and autoradiography. To initiate an analysis of relative contributions to biosynthetic reducing equivalents by the oxidative branch of the hexose monophosphate pathway and by NADP+-specific isocitrate dehydrogenases, we have constructed a collection of yeast mutants containing all possible combinations of disruptions of the ZWF1, IDP1, and IDP2 genes. Disruption of the IDP1 and IDP2 genes, respectively, encoding mitochondrial and cytosolic NADP+-specific isozymes, by insertion yeastURA3 genes into the corresponding coding regions was described previously (7Haselbeck R.J. McAlister-Henn L. J. Biol. Chem. 1991; 266: 2339-2345Abstract Full Text PDF PubMed Google Scholar, 8Loftus T.M. Hall L.V. Anderson S.L. McAlister-Henn L. Biochemistry. 1994; 33: 9661-9667Crossref PubMed Scopus (51) Google Scholar). Disruption of the ZWF1 gene, encoding glucose-6-phosphate dehydrogenase, was conducted using a PCR fragment containing a URA3 insertion in the coding region as described by Nogae and Johnston (2Nogae I. Johnston M. Gene (Amst.). 1990; 96: 161-169Crossref PubMed Scopus (155) Google Scholar) (Fig. 1 A). A haploid strain containing IDP2 and ZWF1 disruptions was obtained by mating of strains containing each disruption and sporulation. This strain was subsequently mated with a haploid strain containing anIDP1 gene disruption. Following sporulation and tetrad dissection, the segregation of gene disruptions in haploid strains from this cross was analyzed to identify a collection of strains containing the desired combinations of disruptions. As illustrated in Fig. 1 B, strains lacking Idp1p and/or Idp2p were identified by Western blot analysis and NADP+-isocitrate dehydrogenase enzyme assays of whole cell protein extracts. Strains lacking Zwf1p were identified by glucose-6-phosphate dehydrogenase assays (Fig. 1 B), and the ZWF1 gene disruption was confirmed by Southern blot analysis (Fig. 1 C). The resulting yeast mutant collection is comprised of a parental segregant (lanes 1), three strains containing single gene disruptions (lanes 2–4), three strains containing all possible combinations of two gene disruptions (lanes 5–7), and a strain containing all three gene disruptions (lanes 8). Growth of strains in the IDP1/IDP2/ZWF1 mutant collection was examined using a variety of common cultivation conditions and conditions previously reported to be diagnostic of ZWF1disruption (1Thomas D. Cherest H. Surdin-Kerjan Y. EMBO J. 1991; 10: 547-553Crossref PubMed Scopus (115) Google Scholar, 2Nogae I. Johnston M. Gene (Amst.). 1990; 96: 161-169Crossref PubMed Scopus (155) Google Scholar). No significant differences in growth on agar plates or in liquid cultures were observed using rich YP medium with glucose, glycerol/lactate, acetate, or ethanol as carbon sources (data not shown). Growth of the triple ΔIDP1ΔIDP2ΔZWF1 mutant strain under these conditions indicates no absolute requirement for any of the three enzyme activities. Growth phenotypes previously attributed to disruption of ZWF1 are reproducible in this collection (Table I). Specifically, all strains containing ΔZWF1 were found to be unable to grow with glucose as the carbon source on minimal medium in the absence of methionine as described by Thomas et al. (1Thomas D. Cherest H. Surdin-Kerjan Y. EMBO J. 1991; 10: 547-553Crossref PubMed Scopus (115) Google Scholar) or on rich medium in the presence of 0.5 mmH2O2 as described by Nogae and Johnston (2Nogae I. Johnston M. Gene (Amst.). 1990; 96: 161-169Crossref PubMed Scopus (155) Google Scholar). In these initial tests of the mutant collection, the only novel growth phenotype identified, a deficiency in growth on rich medium with oleate as a carbon source, is reproducibly observed on plates and with liquid medium for strains containing both ΔIDP2 and ΔZWF1 gene disruptions (Table I). Since Idp1p and Idp3p are expressed with oleate as a carbon source (9, 10, and as described below), these results suggest that the cytosolic enzymes, Idp2p and Zwf1p, have some overlapping function required for growth under this condition. Aspects of this phenotype are developed in more detail below.Table IGrowth phenotypes of disruption mutant strainsRelevant genotypeGrowth conditionMinimal medium, 2% glucose − methionine1-aGrowth was compared using agar plates incubated at 30 °C. + indicates significant growth in 2–3 days; − indicates no growth after 4–5 days incubation. The methionine− growth phenotype for ZWF1 mutants was previously reported by Thomaset al. (1).Rich medium, 2% glucose + 0.5 mm H2O21-bGrowth was compared using agar plates and liquid medium. For cultures, + indicates 2–3-h doubling times with glucose or 5–6-h doubling times with oleate; − indicates no growth after 36-h incubations. The hydrogen peroxide− phenotype forZWF1 mutants was previously reported by Nogae and Johnston (2).Rich medium, 0.5% oleate1-bGrowth was compared using agar plates and liquid medium. For cultures, + indicates 2–3-h doubling times with glucose or 5–6-h doubling times with oleate; − indicates no growth after 36-h incubations. The hydrogen peroxide− phenotype forZWF1 mutants was previously reported by Nogae and Johnston (2).Parental+++ΔIDP1+++ΔIDP2+++ΔZWF1−−+ΔIDP1ΔIDP2+++ΔIDP1ΔZWF1−−+ΔIDP2ΔZWF1−−−ΔIDP1ΔIDP2ΔZWF1−−−1-a Growth was compared using agar plates incubated at 30 °C. + indicates significant growth in 2–3 days; − indicates no growth after 4–5 days incubation. The methionine− growth phenotype for ZWF1 mutants was previously reported by Thomaset al. (1Thomas D. Cherest H. Surdin-Kerjan Y. EMBO J. 1991; 10: 547-553Crossref PubMed Scopus (115) Google Scholar).1-b Growth was compared using agar plates and liquid medium. For cultures, + indicates 2–3-h doubling times with glucose or 5–6-h doubling times with oleate; − indicates no growth after 36-h incubations. The hydrogen peroxide− phenotype forZWF1 mutants was previously reported by Nogae and Johnston (2Nogae I. Johnston M. Gene (Amst.). 1990; 96: 161-169Crossref PubMed Scopus (155) Google Scholar). Open table in a new tab In addition to vegetative growth, it is speculated that cytosolic sources of NADPH are essential for extensive fatty acid synthesis that occurs during sporulation (30Dickinson J.R. Dawes I.W. Boyd A.S.F. Baxter R.L. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 5847-5851Crossref PubMed Scopus (52) Google Scholar). We therefore constructed a series of homozygous diploid strains with disruptions in IDP2 and/orZWF1. To simplify selection, PCR was used to generate a DNA fragment containing a selectable kanMX4 gene (17Wach A. Yeast. 1996; 12: 259-265Crossref PubMed Scopus (703) Google Scholar) with flanking regions homologous to 5′ and 3′ regions of theZWF1-coding region (Fig. 1 A). The fragment was used for transformation and ZWF1 disruption in aand α haploid parental strains and in a and α haploid strains containing disruptions of IDP2. Matings were conducted as indicated in Table II, and diploids were selected on plates with minimal medium containing glutamate and methionine to ensure growth of ΔIDP2 and ΔZWF1 homozygous diploids, respectively. Numbers of diploid colonies obtained from the parental cross, the ΔIDP2 cross, the ΔZWF1cross, and the ΔIDP2ΔZWF1 cross were approximately equivalent. However, in both crosses containing ΔZWF1haploids, growth of diploids was slow, with colonies achieving the size of parental diploid colonies after a 2–3-day lag.Table IIEffects of IDP2 and ZWF1 gene disruptions on mating and sporulationHaploid genotypesMating2-aMating of a and α haploid strains was monitored as colony growth on minimal medium agar plates lacking auxotrophic markers for each strain (adenine and histidine) but containing glutamate and methionine to supplement auxotrophies due toIDP2 or ZWF1 gene disruption. + indicates robust diploid colony growth after a 2-day incubation at 30 °C; s indicates small diploid colony growth after 4–5 days of incubation.Diploid genotypeSporulation2-bSporulation of a/α diploid strains was monitored microscopically on a daily basis following transfer of diploids to minimal medium sporulation plates containing all auxotrophic supplements including glutamate and methionine. + indicates tetrad formation within 3–4 days of incubation; − indicates no evidence of sporulation after 10–14 days.Parental × parental+Parental/parental+ΔZWF1 × ΔZWF1sΔZWF1/ΔZWF1+ΔIDP2 × ΔIDP2+ΔIDP2/ΔIDP2+ΔZWF1ΔIDP2 × ΔZWF1ΔIDP2sΔZWF1ΔIDP2/ ΔZWF1ΔIDP2−2-a Mating of a and α haploid strains was monitored as colony growth on minimal medium agar plates lacking auxotrophic markers for each strain (adenine and histidine) but containing glutamate and methionine to supplement auxotrophies due toIDP2 or ZWF1 gene disruption. + indicates robust diploid colony growth after a 2-day incubation at 30 °C; s indicates small diploid colony growth after 4–5 days of incubation.2-b Sporulation of a/α diploid strains was monitored microscopically on a daily basis following transfer of diploids to minimal medium sporulation plates containing all auxotrophic supplements including glutamate and methionine. + indicates tetrad formation within 3–4 days of incubation; − indicates no evidence of sporulation after 10–14 days. Open table in a new tab Sporulation of the homozygous diploid strains reveals an additional phenotype associated with loss of both Idp2p and Zwf1p (Table II). Sporulation of the single disruption strains (ΔIDP2/ΔIDP2 or ΔZWF1/ΔZWF1) was found to occur with an efficiency equivalent to the parental diploid (20–25% after 3 days), but no evidence of sporulation is detected for the double disruption diploid (ΔIDP2ΔZWF1/ΔIDP2ΔZWF1) after extended periods of incubation. This phenotype suggests that Idp2p and Zwf1p may have overlapping or complementary function in the process of sporulation, perhaps in provision of reducing equivalents for fatty acid synthesis. Other possible biochemical defects are discussed below. Co-disruption of IDP1 and IDP2 genes in a haploid yeast strain eliminates NADP+-specific isocitrate dehydrogenase activity in cells cultivated with a variety of carbon sources (8Loftus T.M. Hall L.V. Anderson S.L. McAlister-Henn L. Biochemistry. 1994; 33: 9661-9667Crossref PubMed Scopus (51) Google Scholar). Thus, the existence of an additional isozyme was missed until completion of the S. cerevisiae genome sequence analysis, which revealed an open reading frame (YNL009w, designated IDP3) with extensive homology to IDP1- and IDP2-coding regions (31McAlister-Henn L. Small W.C. Prog. Nucleic Acid Res. Mol. Biol. 1997; 57: 317-339Crossref PubMed Google Scholar). We and others (9Henke B. Girzalsky W. Berteaux-Lecellier V. Erdmann R. J. Biol. Chem. 1998; 273: 3702-3711Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 10van Roermund C.W.T. Hettema E.H. Kal A.J. van den Berg M. Tabak H.F. Wanders R.J.A. EMBO J. 1998; 17: 677-687Crossref PubMed Scopus (122) Google Scholar) have found that IDP3 encodes a peroxisomal isozyme and that organellar localization is dependent on a peroxisomal type I targeting signal (32Gould S.J. Keller G.A. Hosken N. Wilkinson J. Subramani S. J. Cell Biol. 1989; 108: 1657-1664Crossref PubMed Scopus (884) Google Scholar), in this case a carboxyl-terminal Cys-Lys-Leu tripeptide. Expression of IDP3appears to be limited to growth with fatty acids as a carbon source (9Henke B. Girzalsky W. Berteaux-Lecellier V. Erdmann R. J. Biol. Chem. 1998; 273: 3702-3711Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar,10van Roermund C.W.T. Hettema E.H. Kal A.J. van den Berg M. Tabak H.F. Wanders R.J.A. EMBO J. 1998; 17: 677-687Crossref PubMed Scopus (122) Google Scholar), a condition that induces peroxisomal proliferation and metabolism in yeast (33Veenhuis M. Mateblowski M. Kunau W.-H. Harder W. Yeast. 1987; 3: 7-84Crossref Scopus (233) Google Scholar). Henke et al. (9Henke B. Girzalsky W. Berteaux-Lecellier V. Erdmann R. J. Biol. Chem. 1998; 273: 3702-3711Abstract Full T
Referência(s)