Portal de Periódicos da CAPES

Transforming Growth Factor-β Inhibits Pulmonary Surfactant Protein B Gene Transcription through SMAD3 Interactions with NKX2.1 and HNF-3 Transcription Factors

2002; Elsevier BV; Volume: 277; Issue: 41 Linguagem: Inglês

10.1074/jbc.m203188200

1083-351X

Changgong Li, Nian‐Ling Zhu, Rosemarie C. Tan, Philip L. Ballard, Rik Derynck, Parviz Minoo,

Cancer Cells and Metastasis

Transforming growth factor-β (TGF-β) represses surfactant protein B (Sp-B) gene transcription through a mechanism that remains unknown. A homeodomain and a forkhead transcription factor, NKX2.1 and HNF-3, respectively, are known activators of Sp-B transcription. Because SMADs are the effectors of TGF-β−induced gene activation, we examined the possibility that gene repression by TGF-β may also occur through interactions of SMADs with NKX2.1 and HNF-3. We found that lung epithelial carcinoma H441 cells contain SMAD2/3 and -4, which localize to the nucleus in response to TGF-β treatment. The activity of a transfected Sp-B promoter/reporter construct was reduced in a dose-dependent manner by TGF-β. Cotransfection with a mutant, constitutively activated form of the Tgf-β type I receptor repressed Sp-B promoter activity in the absence of TGF-β ligand. Dominant negative mutants of Smads blocked the repressor activity of TGF-β. SMAD3, but not SMAD2, mediated the repressor activity of TGF-β on the Sp-B promoter. Mutations within a 70-base pair domain that includes binding sites for NKX2.1, hepatocyte nuclear factor 3 (HNF-3), or cAMP response element-binding protein (CREB) eliminated SMAD3-dependent repression of Sp-B transcription. Electrophoretic mobility shift analysis showed no evidence for direct binding of SMAD3 to theSp-B promoter, and a DNA binding mutant of SMAD3 also repressed Sp-B, suggesting that direct DNA binding of SMAD3 may not be required. Using a mammalian two hybrid assay, we found physical and functional interactions between SMAD3 and both NKX2.1 and HNF-3. Also, a glutathione S-transferase-fused SMAD3 directly binds to in vitro synthesized NKX2.1 or HNF-3, demonstrating protein-protein interactions between SMAD3 and the two transcriptional factors. The DNA binding of NKX2.1 to Sp-Bpromoter was reduced in response to TGF-β treatment, although expression of Nkx2.1 was not affected. We conclude that SMAD3 interactions with the positive regulators NKX2.1 and HNF-3 underlie the molecular basis for TGF-β-induced repression ofSp-B gene transcription. Transforming growth factor-β (TGF-β) represses surfactant protein B (Sp-B) gene transcription through a mechanism that remains unknown. A homeodomain and a forkhead transcription factor, NKX2.1 and HNF-3, respectively, are known activators of Sp-B transcription. Because SMADs are the effectors of TGF-β−induced gene activation, we examined the possibility that gene repression by TGF-β may also occur through interactions of SMADs with NKX2.1 and HNF-3. We found that lung epithelial carcinoma H441 cells contain SMAD2/3 and -4, which localize to the nucleus in response to TGF-β treatment. The activity of a transfected Sp-B promoter/reporter construct was reduced in a dose-dependent manner by TGF-β. Cotransfection with a mutant, constitutively activated form of the Tgf-β type I receptor repressed Sp-B promoter activity in the absence of TGF-β ligand. Dominant negative mutants of Smads blocked the repressor activity of TGF-β. SMAD3, but not SMAD2, mediated the repressor activity of TGF-β on the Sp-B promoter. Mutations within a 70-base pair domain that includes binding sites for NKX2.1, hepatocyte nuclear factor 3 (HNF-3), or cAMP response element-binding protein (CREB) eliminated SMAD3-dependent repression of Sp-B transcription. Electrophoretic mobility shift analysis showed no evidence for direct binding of SMAD3 to theSp-B promoter, and a DNA binding mutant of SMAD3 also repressed Sp-B, suggesting that direct DNA binding of SMAD3 may not be required. Using a mammalian two hybrid assay, we found physical and functional interactions between SMAD3 and both NKX2.1 and HNF-3. Also, a glutathione S-transferase-fused SMAD3 directly binds to in vitro synthesized NKX2.1 or HNF-3, demonstrating protein-protein interactions between SMAD3 and the two transcriptional factors. The DNA binding of NKX2.1 to Sp-Bpromoter was reduced in response to TGF-β treatment, although expression of Nkx2.1 was not affected. We conclude that SMAD3 interactions with the positive regulators NKX2.1 and HNF-3 underlie the molecular basis for TGF-β-induced repression ofSp-B gene transcription. transforming growth factor hepatocyte nuclear factor thymidine kinase cAMP response element-binding protein CREB-binding protein chloramphenicol transferase electrophoretic mobility shift assay glutathione S-transferase plasminogen activator inhibitor TGF-β1 is a multifunctional signaling protein that exhibits a wide range of biological activities including regulation of cellular proliferation and differentiation. TGF-β exerts its function by interacting with a heteromeric complex of transmembrane serine/threonine kinase receptors, the type I and type II receptors. Subsequent to TGF-β ligand-induced phosphorylation of the type I by the type II receptors, a family of transcriptional factors known as SMADs act as intracellular effectors of TGF-β signaling (1Heldin C.H. Miyazono K. ten Kijke P. Nature. 1997; 390: 465-471Crossref PubMed Scopus (3358) Google Scholar, 2Massague J. Annu. Rev. Biochem. 1998; 67: 753-791Crossref PubMed Scopus (3999) Google Scholar). Homologues of SMADs are found in diverse eukaryotic organisms including Drosophila melanogaster andCaenorhabditis elegans. SMAD2 and/or SMAD3 are phosphorylated in their carboxyl-terminal domain by the activated type I receptors upon stimulation by either activin or TGF-β (1Heldin C.H. Miyazono K. ten Kijke P. Nature. 1997; 390: 465-471Crossref PubMed Scopus (3358) Google Scholar, 2Massague J. Annu. Rev. Biochem. 1998; 67: 753-791Crossref PubMed Scopus (3999) Google Scholar). Phosphorylation of SMAD2 and SMAD3 is accompanied by their association with a third member of this family, SMAD4, and translocation of the heteromeric complex to the nucleus where they affect transcription of target genes through interaction with promoter-specific transcriptional factors or by direct DNA binding (3Alliston T. Choy L. Ducy P. Karsenty G. Derynck R. EMBO J. 2001; 20: 2254-2272Crossref PubMed Scopus (447) Google Scholar, 4Derynck R. Zhang Y. Feng X.H. Cell. 1988; 95: 737-740Abstract Full Text Full Text PDF Scopus (955) Google Scholar, 5Itoh S. Itoh F. Goumans M.J. ten Dijke P. Eur. J. Biochem. 2000; 267: 6954-6967Crossref PubMed Scopus (458) Google Scholar, 6Massague J. Wotton D. EMBO J. 2000; 19: 1745-1754Crossref PubMed Google Scholar, 7Miyazono K. J. Cell Sci. 2000; 113: 1101-1109Crossref PubMed Google Scholar, 8Wrana J.L. Cell. 2000; 100: 189-192Abstract Full Text Full Text PDF PubMed Scopus (363) Google Scholar). The mechanisms by which SMADs affect transcription can be direct or indirect. For example, in response to activin, SMAD2/4 complex can activate transcription from the Mix.2 andgoosecoid promoters by interaction with winged helix transcriptional factors FAST-1 or FAST-2 (9Germain S. Howell M. Esslemont G.M. Hill C.S. Genes Dev. 2000; 14: 435-451PubMed Google Scholar). In contrast, the TGF-β-responsive collagenase I promoter is the direct target of SMAD3 that interacts physically and functionally with its promoter elements (10Qing J. Zhang Y. Derynck R. J. Biol. Chem. 2000; 275: 38802-38812Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). One important functional aspect of TGF-β activity is its role as a growth inhibitor (11Olson E.N. Dev. Biol. 1992; 154: 261-272Crossref PubMed Scopus (377) Google Scholar, 12Centrella M. Horowitz M.C. Wozney J.M. McCarthy T.L. Endocr. Rev. 1994; 15: 27-39PubMed Google Scholar, 13Zhou L. Dey C.R. Wert S.E. Whitsett J.A. Dev. Biol. 1996; 175: 227-238Crossref PubMed Scopus (202) Google Scholar). Activation of genes is a part of the growth inhibitory functions of TGF-β. For example TGF-β-induced growth arrest of HaCaT and Mv1Lu epithelial cells is mediated by SMAD3-dependent induction of cyclin-dependent kinase (CDK) inhibitor p15Ink4B, which inhibits the activities of cyclin-dependent CDK4 and CDK6. TGF-β is also known to inhibit differentiation of both mesenchymal and epithelial cells. The mechanisms underlying this mode of action of TGF-β is little understood. Recently, TGF-β inhibition of osteoblast differentiation and repression of the CBFA1 gene was shown to be mediated by SMAD3 (3Alliston T. Choy L. Ducy P. Karsenty G. Derynck R. EMBO J. 2001; 20: 2254-2272Crossref PubMed Scopus (447) Google Scholar). Here SMAD3 interacts physically with CBFA1 at the CBFA1 binding OSE2 promoter sequence without direct interactions with DNA. Also, Liu et al. (38Liu D. Black B.L. Derynck R. Genes Dev. 2001; 15: 2950-2966Crossref PubMed Scopus (299) Google Scholar) found that TGF-β-induced inhibition of muscle cell differentiation occurs through functional repression of myogenic transcription factors by SMAD3. In this mode of SMAD3-mediated gene repression, SMAD3 interacts physically with MyoD both in vitro and in vivo, and this interaction may underlie the ability of SMAD3 to inhibit the transactivation of E-box containing muscle enhancers by MyoD. Growth inhibitory effects of TGF-β have also been demonstrated in the lung. Ectopic overexpression of TGF-β1 in transgenic mice perturbs lung vascular development and inhibits pulmonary epithelial cell differentiation (13Zhou L. Dey C.R. Wert S.E. Whitsett J.A. Dev. Biol. 1996; 175: 227-238Crossref PubMed Scopus (202) Google Scholar). Treatment of human lung explants with TGF-β1 inhibits epithelial cell maturation and expression of lung-specific pulmonary surfactant protein genes, Sp-A, SP-B, and Sp-C (14Beers M.F. Solarin K.O. Guttentag S.H. Rosenbloom J. Kormilli A. Gonzales L.W. Ballard P.L. Am. J. Physiol. 1998; 275: L950-L960PubMed Google Scholar). In addition, targeted disruption ofTgf-β2 or Tgf-β3results in developmental defects and perinatal lethality.Tgf-β2(−/−) lungs are highly dysmorphic, whereas absence of Tgf-β3 causes delayed lung maturation in newborn mice (15Kaartinen V. Voncken J.W. Shuler C. Warburton D., Bu, D. Heisterkamp N. Groffen J. Nat. Genet. 1995; 11: 415-421Crossref PubMed Scopus (887) Google Scholar, 16Sanford L.P. Ormsby I. Gittenberger-de Groot A.C. Sariola H. Friedman R. Boivin G.P. Cardell E.L. Doetschman T. Development. 1997; 124: 2659-2670Crossref PubMed Google Scholar). Furthermore, in human neonates, TGF-β has been implicated in pathogenesis of chronic lung disease bronchopulmonary dysplasia, in which it is thought to interrupt normal late lung development by inhibition of alveologenesis (17Lecart C. Cayabyab R. Buckley S. Morrison J. Kwong K.Y Warburton D. Ramanathan R. Jones C.A. Minoo P. Biol. Neonate. 2000; 77: 217-223Crossref PubMed Scopus (100) Google Scholar). The precise mechanisms by which TGF-β interferes with lung morphogenesis and cell differentiation remain entirely unknown. Surfactant protein B is a necessary component for the function of pulmonary surfactant. In humans, mutations in the Sp-B gene that disrupt SP-B synthesis or processing are lethal (18Cole F.S. Hamvas A. Nogee L.M. Pediatr. Res. 2000; 50: 157-162Crossref Scopus (71) Google Scholar). Even partial SP-B deficiency causes respiratory distress and morbidity (19Dunbar III, A.E. Wert S.E. Ikegami M. Whitsett J.A. Hamvas A. White F.V. Piedboeuf B. Jobin C. Guttentag S. Nogee L.M. Pediatr. Res. 2000; 48: 275-282Crossref PubMed Scopus (98) Google Scholar). TheSp-B gene has been shown to be regulated by key transcription factors, NKX2.1 and HNF-3 (20Bohinski R.J., Di Lauro R. Whitsett J.A. Mol. Cell. Biol. 1994; 14: 5671-5681Crossref PubMed Scopus (486) Google Scholar, 21Margana R.K. Boggaram V. J. Biol. Chem. 1997; 272: 3083-3090Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). NKX2.1 is a homeodomain transcriptional regulator of both structural organization of the lung and differentiation of highly specialized epithelial cell types such as alveolar type II cells (22Minoo P., Su, G. Drum H. Bringas P. Kimura S. Dev. Biol. 1999; 209: 60-71Crossref PubMed Scopus (367) Google Scholar). A member of the forkhead family of transcription factors, HNF-3, is critical to early embryonic development but also regulates lung-specific gene expression in cell culture studies (20Bohinski R.J., Di Lauro R. Whitsett J.A. Mol. Cell. Biol. 1994; 14: 5671-5681Crossref PubMed Scopus (486) Google Scholar, 21Margana R.K. Boggaram V. J. Biol. Chem. 1997; 272: 3083-3090Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 23Chang A. Ramsay P. Zhao B. Park M. Magdaleno S. Reardon M.J. Welty S. DeMayo F.J. Ann. N. Y. Acad. Sci. 2000; 923: 181-192Crossref PubMed Scopus (20) Google Scholar). Functional binding sites for both NKX2.1 and HNF-3 are clustered within a 40-bp element ∼120 nucleotides from the site of transcriptional initiation on the human Sp-Bgene. Within the latter element and juxtaposed to the HNF-3 binding site is localized a consensus binding site for the cAMP response element-binding protein, CREB (24Berhane Boggaram V. Gene. 2001; 268: 141-151Crossref PubMed Scopus (27) Google Scholar). The ubiquitous transcription factors SP1 and the CREB-binding protein, CBP, have been implicated inSp-B gene transcription (21Margana R.K. Boggaram V. J. Biol. Chem. 1997; 272: 3083-3090Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 24Berhane Boggaram V. Gene. 2001; 268: 141-151Crossref PubMed Scopus (27) Google Scholar, 25Naltner A. Ghaffari M. Whitsett J.A. Yan C. J. Biol. Chem. 2000; 275: 56-62Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). In human pulmonary adenocarcinoma H441 cells, TGF-β has a profound repressor effect onSp-B gene expression at the transcriptional level. The repressor effect of TGF-β was localized to the region of theSp-B promoter (−112/−72) containing the binding sites for NKX2.1 and HNF-3. The precise mechanism by which TGF-β repressesSp-B gene transcription remains unknown, although Kumaret al. (26Kumar A.S. Gonzales L.W. Ballard P.L. Biochim. Biophys. Acta. 2000; 1492: 45-55Crossref PubMed Scopus (29) Google Scholar) suggest that it could partly be explained by TGF-β-induced cytoplasmic trapping of NKX2.1 and HNF-3. In the current study, we have examined the mechanisms by which TGF-β represses the transcription of human Sp-B gene in H441 cells. The results provide evidence that SMAD3 repressesSp-B gene transcription by interacting with NKX2.1 and HNF-3, the positive transcriptional factors that bind to theSp-B proximal promoter. The human pulmonary epithelial cell lines NCI H441 and A549 (ATCC) and human cervical carcinoma cell line HeLa (ATCC) were maintained in RPMI medium 1640, F-12K nutrient mixture, and Dulbecco's modified Eagle's medium (Invitrogen), respectively, containing 10% fetal bovine serum and 1% penicillin-streptomycin. The mouse MLE15 cells were grown in culture according to the procedure described previously (27Wikenheiser K.A. Vorbroker D.K. Rice W.R. Clark J.C. Bachurski C.J. Oie H.K. Whitsett J.A. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11029-11033Crossref PubMed Scopus (294) Google Scholar). All plasmids used in transfection studies were purified on Qiagen columns (Qiagen). Transient transfection of H441 cells, A549 cells, and HeLa cells was performed with SuperFect or FuGENE 6 as described by the manufacturer (Qiagen and Roche Molecular Biochemicals). In brief, cells in 35-mm dishes at 60–80% confluence were transfected with 2.25 μg ofpSV-β-gal (Promega), 2.25 μg of test constructs, 2.25 μg of transactivator plasmids, and 15 μl of transfectant. Cells were cultured for 6 h and then changed into regular medium with 10% serum. Cells were cultured for an additional 42 h in the presence or absence of human recombinant TGF-β1 (R&D Systems) and collected as described (Promega). Supernatants of the cell extracts were used for the assay of β-galactosidase and either chloramphenicol acetyltransferase or luciferase as described (Ref. 28Venkatesh V.C. Planer B.C. Schwartz M. Vanderbilt J.N. White R.T. Ballard P.L. Am. J. Physiol. 1995; 268: L674-L682PubMed Google Scholar; Promega). A 1.4-kilobase fragment of the human Sp-B promoter region (−1040/+431) (29Pilot-Matias T.J. Kister S.E. Fox J.L. Kropp K. Glasser S.W. Whitsett J.A. DNA (N. Y.). 1989; 8: 75-86Crossref PubMed Scopus (113) Google Scholar) was cloned into pGL2 basic (Promega) and named SpB(−1040/+431). The fragment –140/+431 was PCR amplified and cloned into SacI/HindIII sites of pGL2 basic and namedSpB(−140/+431). The 170-bp (−120/+50) fragment of the thymidine kinase ( TK) promoter was PCR-amplified and cloned into the BglII/HindIII of pGL2 basic and named pCL74. An oligonucleotide covering the region −140/−70 of the Sp-B promoter was synthesized and cloned upstream of the TK promoter of pCL74. This construct is designatedSpB(−140/−70)TK. A fragment of theSp-B gene from −641 to +431 was isolated by exonuclease digestion and ligated upstream of chloramphenicol acetyltransferase as previously described and designatedSpB(−641/+431)CAT (28Venkatesh V.C. Planer B.C. Schwartz M. Vanderbilt J.N. White R.T. Ballard P.L. Am. J. Physiol. 1995; 268: L674-L682PubMed Google Scholar). TheSmad dominant negative [pSMAD2(3S → A) and pCD-D4-N4(137–552)3′FLAG)] and wild type expression constructs, the constitutively active TGF-β type I receptor (TRI(act)) construct, and the PAIexpression constructs were as described (30de Caestecker M.P. Parks W.T. Frank C.J. Castagnino P. Bottaro D.P. Roberts A.B. Lechleider R.J. Genes Dev. 1998; 12: 1587-1592Crossref PubMed Scopus (254) Google Scholar, 31Feng X.H. Zhang Y., Wu, R.Y. Derynck R. Genes Dev. 1998; 12: 2153-2163Crossref PubMed Scopus (451) Google Scholar). Constructs with mutations of NKX2.1, HNF-3, or CREB binding sites were made by synthesized oligos covering −140/−70 of the Sp-B promoter with corresponding mutations (Fig. 5) cloned into the pCL74. The Nkx2.1 expression construct was previously described (32Hamdan H. Liu H., Li, C Jones C Lee M. deLemos R. Minoo P. Biochim. Biophys. Acta. 1998; 1396: 336-348Crossref PubMed Scopus (58) Google Scholar). The Hnf-3α expression construct was kindly provided by Dr. Robert H. Costa (University of Illinois, Chicago). TheCREB expression construct was kindly provided by Dr. Richard H. Goodman (Oregon Health and Science University). The pVP16 plasmid for making VP16 fusion protein was purchased from Clontech Laboratories, Inc. Synthetic oligonucleotides were annealed, diluted as described (20Bohinski R.J., Di Lauro R. Whitsett J.A. Mol. Cell. Biol. 1994; 14: 5671-5681Crossref PubMed Scopus (486) Google Scholar), and used directly in electrophoretic mobility shift assay (EMSA) as a cold competitor. For use as probe in EMSA reactions, the annealed oligonucleotides were purified by gel electrophoresis on 3% low melting agarose (Promega), excised, and then eluted using QIAEXII (Qiagen). Two picomoles of the purified annealed oligonucleotides were end-labeled with T4 polynucleotide kinase and [γ-32P]ATP as described (Amersham Biosciences). The labeled probes were purified from unincorporated ]γ-32P]ATP using G-25 Sephadex column (Roche Molecular Biochemicals). The DNA sequences of the oligos were GGGTGTCTAGACGGCC for SMAD3 oligo (33Denissova N.G. Pouponnot C. Long J., He, D. Liu F. Proc..Nat. Acad. Sci. U. S. A. 2000; 97: 6397-6402Crossref PubMed Scopus (96) Google Scholar), GCACCTGGAGGGCTCTTCAGAGC for NKX2.1 oligo, and ACCTGGAGGGCTCTTCAGAGCAAAGACAAACACTGAGGTCGCTGCCAC for NHC oligo. EMSA was performed as described previously (33Denissova N.G. Pouponnot C. Long J., He, D. Liu F. Proc..Nat. Acad. Sci. U. S. A. 2000; 97: 6397-6402Crossref PubMed Scopus (96) Google Scholar) with specific modifications. In brief, nuclear extracts were prepared using a mini-extraction procedure (20Bohinski R.J., Di Lauro R. Whitsett J.A. Mol. Cell. Biol. 1994; 14: 5671-5681Crossref PubMed Scopus (486) Google Scholar). Five micrograms of the nuclear extract were incubated with 32P-end-labeled oligonucleotide probe with or without cold competitor in 20 mm Hepes (pH 7.9), 0.1 μg/μl poly(dI-dC), 6 mm MgCl2, 30 mm KCl, 1 mm EDTA, 1 mm EGTA, 2 mm dithiothreitol, 12.5% glycerol, in a total volume of 20 μl at 4 °C for 15 min. The antibodies were then added, and the samples were incubated at 4 °C for an additional 20 min. Bound and free probes were separated by gel electrophoresis on a 4.5% nondenaturing polyacrylamide gel. The NKX2.1 and the FLAG antibodies were purchased from Lab Vision Corp. and Sigma, respectively. GST interaction assays were performed as described (3Alliston T. Choy L. Ducy P. Karsenty G. Derynck R. EMBO J. 2001; 20: 2254-2272Crossref PubMed Scopus (447) Google Scholar). In brief, GST or GST-SMAD3 fusion proteins were expressed in Escherichia coli and purified by adsorption to glutathione-Sepharose (Amersham Biosciences).35S-Labeled NKX2.1 or 35S-labeled HNF-3α was prepared by in vitro translation in the presence of [35S]methionine using the TNT kit (Promega). After preincubation with glutathione-Sepharose, the translation mixture containing 35S-labeled NKX2.1 or 35S-labeled HNF-3α was incubated with GST, or GST-SMAD3 was adsorbed to the Sepharose beads at 4 °C for 1 h in the binding solution (3Alliston T. Choy L. Ducy P. Karsenty G. Derynck R. EMBO J. 2001; 20: 2254-2272Crossref PubMed Scopus (447) Google Scholar). The beads were then washed repeatedly, and the associated proteins were analyzed by SDS-PAGE. The gels were then dried and exposed to the x-ray films. Expression constructs forGAL4-Smad3 were co-transfected with VP16-Nkx2.1or VP16-Hnf3α expression constructs and the target plasmid, GAL4-luciferase reporter construct, pFR-Luc(Stratagene), into A549 cells as specified in the legend for Fig. 8. Transactivation of the heterologous GAL4 promoter in response to protein-protein interactions between GAL4-SMAD3 and VP16 fusion proteins was quantified by measuring luciferase activity. H441 cells were cultured on coverslips with 50 nm dexamethasone (to induceSp-B) in the presence and absence of TGF-β1 (10 ng/ml) for 24 h. Cells were fixed with 1% paraformaldehyde in phosphate-buffered saline, exposed to sodium borohydride to reduce autofluorescence, and treated with Triton-X-100 + bovine serum albumin plus goat serum to permeabilize and block nonspecific binding as described (34Gonzales L.W. Angampalli S. Guttentag S.H. Beers M.F. Solarin K.O. Feinstein S.I. Matlapudi A. Ballard P.L. Pediatr. Pathol. Mol. Med. 2001; 20: 387-412Crossref PubMed Scopus (47) Google Scholar). Cells were exposed to anti-SMAD2/3 (rabbit anti-human polyclonal, E-20) or anti-SMAD4 antibody (goat anti-human polyclonal, H-552, 1:100, Santa Cruz Biotechnology, Santa Cruz, CA) and goat anti-rabbit or donkey anti-goat secondary IgG (1:300), respectively, conjugated to Cy3. Fluorescence was examined with an Olympus 1X70 microscope and Metamorph imaging system. Total RNA was isolated using Trizol (GIBCO) from H441 cells treated with or without 10 μg/μl TGF-β1 (R&D Systems) for 24 h. Twenty micrograms of the total RNA was electrophoresed in 1% RNA formaldehyde agarose gel and Northern-blotted. Blots were hybridized with probes specific forNkx2.1 or 18 S rRNA and then autoradiographed. The probe forNkx2.1 was a cDNA reported previously by Hamdan et al. (32Hamdan H. Liu H., Li, C Jones C Lee M. deLemos R. Minoo P. Biochim. Biophys. Acta. 1998; 1396: 336-348Crossref PubMed Scopus (58) Google Scholar). MLE15 cells were treated with 10 μg/μl TGF-β1 (R&D Systems) for 24 h. Nuclear extracts were prepared as described for EMSA. 25 μg of nuclear extract was separated on 10% SDS-PAGE and transferred to Immobilon-P membrane (Millipore). The membrane was then blocked with 5% milk in Tris-buffered saline and incubated in 1:200-diluted primary anti-TTF-1 antibody (Lab Vision Corp.) overnight. The secondary antibody, goat-anti-mouse IgG-HRP (Pierce), was applied at a 1:1000 dilution for 30 min. The membrane was reacted with chemiluminescence reagent ECL (Amersham Biosciences) and exposed to photographic film. Previously, it was shown that TGF-β treatment of H441 cells inhibits transcription ofSp-B gene with responsiveness localized to the proximal promoter region (26Kumar A.S. Gonzales L.W. Ballard P.L. Biochim. Biophys. Acta. 2000; 1492: 45-55Crossref PubMed Scopus (29) Google Scholar). The precise mechanism of intracellular signaling involved in repression of Sp-B transcription remains unknown. To determine whether the TGF-β-induced repression of theSp-B promoter/enhancer is mediated through activation of the TGF-β receptor and signal transduction pathway, we performed co-transfection studies in H441 cells. H441 is a highly characterized lung epithelial carcinoma cell line that has been widely used in the analysis of pulmonary surfactant protein gene regulation due to constitutive expression of positive transcriptional regulators such as NKX2.1 and HNF-3α, which are required for activation of their transcription. H441 cells were first transfected with a construct,SpB(−1040/+431), that contains 1.4 kilobases of the 5′ upstream region of the Sp-B promoter/enhancer sequences linked to luciferase (29Pilot-Matias T.J. Kister S.E. Fox J.L. Kropp K. Glasser S.W. Whitsett J.A. DNA (N. Y.). 1989; 8: 75-86Crossref PubMed Scopus (113) Google Scholar). This fragment has been previously identified to direct measurable levels of transcription in H441 cells, as evidenced by reporter gene activity (28Venkatesh V.C. Planer B.C. Schwartz M. Vanderbilt J.N. White R.T. Ballard P.L. Am. J. Physiol. 1995; 268: L674-L682PubMed Google Scholar). The transfected H441 cells were then treated with different concentrations (0–45 ng/ml) of recombinant human TGF-β1. As shown in Fig.1 A the Sp-Bpromoter activity was repressed in the presence of TGF-β ligand. The maximum repression by TGF-β (30 ng/ml) caused ∼66% decrease of theSp-B promoter activity. To determine whether the TGF-β repression of Sp-B promoter is mediated through TGF-β receptor, we co-transfected a constitutively active mutant TGF-β type I receptor, TRI(act), which carries a mutation of threonine 202 to an aspartic acid (35Choy L. Derynck R. J. Biol. Chem. 1998; 273: 31455-31462Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) along withSpB(−1040/+431). As a positive control, we also utilized a PAI promoter that is a well characterized target of TGF-β-induced gene activation (36Keeton M.R. Curriden S.A. van Zonneveld A.J. Loskutoff D.J. J. Biol. Chem. 1991; 266: 23048-23052Abstract Full Text PDF PubMed Google Scholar). As shown in Fig.1 B, the PAI promoter is activated by TRI(act) in the absence of TGF-β ligand treatment. In contrast, TRI(act) caused approximately a greater than 50% reduction in the Sp-Bpromoter/enhancer activity in H441 cells in parallel experiments. These observations indicate that TGF-β-induced repression of theSp-B promoter in H441 cells occurs in response to activation of the TGF-β receptor signal transduction pathway. In the TGF-β signal transduction pathway, activation of TGF-β type I receptor by phosphorylation is followed by phosphorylation of SMAD transcription factors. Phosphorylated SMAD2 or SMAD3, known to be specifically activated by TGF-β, subsequently forms complexes with SMAD4, which facilitates their entry into the nucleus wherein they mediate regulation of TGF-β-induced gene transcription. To determine whether repressor activity of TGF-β in H441 cells is mediated by SMADs, we first established the presence and responsiveness of SMADs in this cell line by immunostaining. As shown in Fig.2, antibodies to both SMAD2/3 and SMAD 4 produced cytoplasmic staining in H441 cells. After treatment of the cells with TGF-β, staining was localized to the nucleus. These results provide evidence for intact SMAD signaling in H441 cells comparable with that described for other cell lines. To examine the role of endogenous SMADs in TGF-β-mediated repression of the Sp-B promoter, we carried out co-transfection studies with dominant negative Smad 2 and 4 (30de Caestecker M.P. Parks W.T. Frank C.J. Castagnino P. Bottaro D.P. Roberts A.B. Lechleider R.J. Genes Dev. 1998; 12: 1587-1592Crossref PubMed Scopus (254) Google Scholar). SMAD2(3S → A) lacks the three highly conserved serines in the carboxyl terminus that are phosphorylated by activated type I receptors, and dominant negative SMAD4 is truncated in both the amino and carboxyl termini. Both constructs compete with endogenous SMADs and block translocation of the SMAD complex to the nucleus. In cells transfected with theSp-B promoter fragment −641/+431 alone (SpB(−641/+431)CAT), treatment with TGF-β reduced reporter gene activity by 65–70% (Fig.3 A, Control and+ TGF -β). In cells co-transfected with either dominant negative Smad2 or Smad4, inhibition of reporter gene expression by TGF-β was significantly less (26–39%, Fig.3 A, DN versus DN+ TGF -β). These results support a role for SMADs in TGF-β-induced repression ofSp-B promoter. Dominant negative SMAD4 blocks signaling by either SMAD2 or SMAD3, and dominant negative SMAD2 competes with both endogenous SMAD2 and SMAD3 for SMAD4. Thus, these data indicate a requirement for SMAD4 but do not identify whether SMAD2 or SMAD3 mediates TGF-β responsiveness in this system. To further investigate SMAD signaling, H441 cells were co-transfected with wild type Smad2, Smad3, and Smad4expression constructs and the Sp-B promoter/enhancer construct SpB(−1040/+431) in the absence of TGF-β ligand. As expected, transcriptional activity of the controlPAI plasmid increased severalfold by co-transfection with either Smad2 or Smad3 (data not shown). In contrast, the Sp-B promoter/enhancer activity decreased by nearly 70% in presence of overexpression of Smad3 alone or in combination with Smad4 (Fig. 3 B). Overexpression of Smad2 or Smad2 in combination with Smad4 had no measurable effect on the activity of theSp-B promoter (Fig. 3 B). A similar level of expression for Smad2 and Smad3 was confirmed by Western blot analysis (data not shown). Overexpression ofSmad4 alone, which i