Identification of Specific Functional Subdomains within the Linker Histone H10 C-terminal Domain
2004; Elsevier BV; Volume: 279; Issue: 10 Linguagem: Inglês
10.1074/jbc.m311348200
ISSN1083-351X
Autores Tópico(s)DNA and Nucleic Acid Chemistry
ResumoLinker histone binding to nucleosomal arrays in vitro causes linker DNA to form an apposed stem motif, stabilizes extensively folded secondary chromatin structures, and promotes self-association of individual nucleosomal arrays into oligomeric tertiary chromatin structures. To determine the involvement of the linker histone C-terminal domain (CTD) in each of these functions, and to test the hypothesis that the functions of this highly basic domain are mediated by neutralization of linker DNA negative charge, four truncation mutants were created that incrementally removed stretches of 24 amino acids beginning at the extreme C terminus of the mouse H10 linker histone. Native and truncated H10 proteins were assembled onto biochemically defined nucleosomal arrays and characterized in the absence and presence of salts to probe primary, secondary, and tertiary chromatin structure. Results indicate that the ability of H10 to alter linker DNA conformation and stabilize condensed chromatin structures is localized to specific C-terminal subdomains, rather than being equally distributed throughout the entire CTD. We propose that the functions of the linker histone CTD in chromatin are linked to the characteristic intrinsic disorder of this domain. Linker histone binding to nucleosomal arrays in vitro causes linker DNA to form an apposed stem motif, stabilizes extensively folded secondary chromatin structures, and promotes self-association of individual nucleosomal arrays into oligomeric tertiary chromatin structures. To determine the involvement of the linker histone C-terminal domain (CTD) in each of these functions, and to test the hypothesis that the functions of this highly basic domain are mediated by neutralization of linker DNA negative charge, four truncation mutants were created that incrementally removed stretches of 24 amino acids beginning at the extreme C terminus of the mouse H10 linker histone. Native and truncated H10 proteins were assembled onto biochemically defined nucleosomal arrays and characterized in the absence and presence of salts to probe primary, secondary, and tertiary chromatin structure. Results indicate that the ability of H10 to alter linker DNA conformation and stabilize condensed chromatin structures is localized to specific C-terminal subdomains, rather than being equally distributed throughout the entire CTD. We propose that the functions of the linker histone CTD in chromatin are linked to the characteristic intrinsic disorder of this domain. Linker histones comprise a family of small nucleosome-binding proteins that have a short N terminus, a central winged helix-like globular domain, and a long, highly basic C-terminal domain (CTD) 1The abbreviation used is: CTD, C-terminal domain. (1Hartman P.G. Chapman G.E. Moss T. Bradbury E.M. Eur. J. Biochem. 1977; 77: 45-51Crossref PubMed Scopus (231) Google Scholar, 2Wolffe A. Chromatin: Structure and Function.3rd Ed. Academic Press, San Diego, CA1998Google Scholar, 3Van Holde K.E. Chromatin. Springer-Verlag, New York1988Google Scholar). Binding of linker histones to nucleosomal arrays in vitro influences chromatin fiber structure at multiple levels. It has been widely observed that linker histones protect an additional 20 bp of DNA from micrococcal nuclease digestion (2Wolffe A. Chromatin: Structure and Function.3rd Ed. Academic Press, San Diego, CA1998Google Scholar, 3Van Holde K.E. Chromatin. Springer-Verlag, New York1988Google Scholar, 4Simpson R.T. Biochemistry. 1978; 17: 5524-5531Crossref PubMed Scopus (452) Google Scholar). Upon direct examination, nuclease protection appears to result from linker histone-linker DNA interactions involved in the formation of an apposed linker DNA stem motif (5Bednar J. Horowitz R.A. Grigoryev S.A. Carruthers L.M. Hansen J.C. Koster A.J. Woodcock C.L. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14173-14178Crossref PubMed Scopus (464) Google Scholar), rather than from wrapping additional DNA around the nucleosome as was initially believed (2Wolffe A. Chromatin: Structure and Function.3rd Ed. Academic Press, San Diego, CA1998Google Scholar, 3Van Holde K.E. Chromatin. Springer-Verlag, New York1988Google Scholar). Linker histones also have important functions in chromatin condensation. They stabilize locally folded secondary chromatin structures, e.g. "30-nm diameter fiber" (2Wolffe A. Chromatin: Structure and Function.3rd Ed. Academic Press, San Diego, CA1998Google Scholar, 3Van Holde K.E. Chromatin. Springer-Verlag, New York1988Google Scholar, 6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar), and facilitate the self-association of fibers into oligomeric tertiary chromatin structures thought to be relevant to global chromosomal fiber organization (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 8Fletcher T.M. Hansen J.C. Crit. Rev. Eukaryotic Gene Exp. 1996; 6: 149-188Crossref PubMed Scopus (130) Google Scholar). The linker histone globular domain plays a major role in protecting additional DNA from nuclease digestion (2Wolffe A. Chromatin: Structure and Function.3rd Ed. Academic Press, San Diego, CA1998Google Scholar, 3Van Holde K.E. Chromatin. Springer-Verlag, New York1988Google Scholar). In contrast, the ability to stabilize extensively folded secondary chromatin structures lies exclusively in the linker histone CTD (9Thomas J.O. Curr. Opin. Cell Biol. 1999; 11: 312-317Crossref PubMed Scopus (182) Google Scholar, 10Allan J. Hartman P.G. Crane-Robinson C. Aviles F.X. Nature. 1980; 288: 675-679Crossref PubMed Scopus (536) Google Scholar, 11Allan J. Mitchell T. Harborne N. Bohm L. Crane-Robinson C. J. Mol. Biol. 1986; 187: 591-601Crossref PubMed Scopus (269) Google Scholar). The linker histone domains that facilitate fiber self-association have yet to be defined. The biochemical properties of the linker histone CTD are enigmatic. In most isoforms, this domain consists of ∼100 amino acid residues. There is no CTD sequence conservation among the linker histone isoforms (2Wolffe A. Chromatin: Structure and Function.3rd Ed. Academic Press, San Diego, CA1998Google Scholar, 3Van Holde K.E. Chromatin. Springer-Verlag, New York1988Google Scholar). However, ∼40% of each somatic linker histone CTD consists of lysine residues that are very evenly distributed throughout the domain (12Subirana J.A. Biopolymers. 1990; 29: 1351-1357Crossref PubMed Scopus (46) Google Scholar). The fact that peptides derived from the linker histone CTD have no detectable secondary structure in solution (3Van Holde K.E. Chromatin. Springer-Verlag, New York1988Google Scholar), together with the extensively basic character of this domain, has led to the proposal that the CTD functions in chromatin as an unstructured cationic stretch of amino acids that binds to linker DNA and neutralizes negative charges (11Allan J. Mitchell T. Harborne N. Bohm L. Crane-Robinson C. J. Mol. Biol. 1986; 187: 591-601Crossref PubMed Scopus (269) Google Scholar, 12Subirana J.A. Biopolymers. 1990; 29: 1351-1357Crossref PubMed Scopus (46) Google Scholar). There are, however, several hints that the structural features of the linker histone CTD may be more complex. In addition to the large percentage of basic amino acid residues, alanine, serine, threonine, and proline residues also are frequently found in the CTD of mouse H10, chicken H5, and all human somatic linker histones. By contrast, the CTDs of all linker histone isoforms are almost completely deficient in the acidic, aromatic, and highly hydrophobic amino acids. Protein domains having this distinctive amino acid composition are thought to possess "intrinsic disorder" (13Dunker A.K. Lawson J.D. Brown C.J. Williams R.M. Romero P. Oh J.S. Oldfield C.J. Campen A.M. Ratliff C.M. Hipps K.W. Ausio J. Nissen M.S. Reeves R. Kang C. Kissinger C.R. Bailey R.W. Griswold M.D. Chiu W. Garner E.C. Obradovic Z. J. Mol. Graph. Model. 2001; 19: 26-59Crossref PubMed Scopus (1909) Google Scholar, 14Dunker A.K. Brown C.J. Lawson J.D. Iakoucheva L.M. Obradovic Z. Biochemistry. 2002; 41: 6573-6582Crossref PubMed Scopus (1515) Google Scholar, 15Dunker A.K. Brown C.J. Obradovic Z. Adv. Protein Chem. 2002; 62: 25-49Crossref PubMed Scopus (346) Google Scholar, 16Wright P.E. Dyson H.J. J. Mol. Biol. 1999; 293: 321-331Crossref PubMed Scopus (2388) Google Scholar), which is characterized by molten globule-like structure in the native state. Intrinsically disordered regions frequently assume classical secondary structure when interacting with other macromolecules (13Dunker A.K. Lawson J.D. Brown C.J. Williams R.M. Romero P. Oh J.S. Oldfield C.J. Campen A.M. Ratliff C.M. Hipps K.W. Ausio J. Nissen M.S. Reeves R. Kang C. Kissinger C.R. Bailey R.W. Griswold M.D. Chiu W. Garner E.C. Obradovic Z. J. Mol. Graph. Model. 2001; 19: 26-59Crossref PubMed Scopus (1909) Google Scholar, 14Dunker A.K. Brown C.J. Lawson J.D. Iakoucheva L.M. Obradovic Z. Biochemistry. 2002; 41: 6573-6582Crossref PubMed Scopus (1515) Google Scholar, 15Dunker A.K. Brown C.J. Obradovic Z. Adv. Protein Chem. 2002; 62: 25-49Crossref PubMed Scopus (346) Google Scholar, 16Wright P.E. Dyson H.J. J. Mol. Biol. 1999; 293: 321-331Crossref PubMed Scopus (2388) Google Scholar). Consistent with this notion, the CTD peptides adopt a detectable α-helical structure when interacting with DNA (17Vila R. Ponte I. Collado M. Arrondo J.L. Jimenez M.A. Rico M. Suau P. J. Biol. Chem. 2001; 276: 46429-46435Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 18Vila R. Ponte I. Collado M. Arrondo J.L. Suau P. J. Biol. Chem. 2001; 276: 30898-30903Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar), and also in high salt solutions and organic solvents (17Vila R. Ponte I. Collado M. Arrondo J.L. Jimenez M.A. Rico M. Suau P. J. Biol. Chem. 2001; 276: 46429-46435Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 19Vila R. Ponte I. Jimenez M.A. Rico M. Suau P. Protein Sci. 2000; 9: 627-636Crossref PubMed Scopus (41) Google Scholar, 20Hill C.S. Martin S.R. Thomas J.O. EMBO J. 1989; 8: 2591-2599Crossref PubMed Scopus (54) Google Scholar, 21Clark D.J. Hill C.S. Martin S.R. Thomas J.O. EMBO J. 1988; 7: 69-75Crossref PubMed Scopus (140) Google Scholar). The CTD of all somatic linker histones also contain one or more S/TPKK DNA binding sequences (17Vila R. Ponte I. Collado M. Arrondo J.L. Jimenez M.A. Rico M. Suau P. J. Biol. Chem. 2001; 276: 46429-46435Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 19Vila R. Ponte I. Jimenez M.A. Rico M. Suau P. Protein Sci. 2000; 9: 627-636Crossref PubMed Scopus (41) Google Scholar, 22Suzuki M. EMBO J. 1989; 8: 797-804Crossref PubMed Scopus (213) Google Scholar, 23Suzuki M. Gerstein M. Johnson T. Protein Eng. 1993; 6: 565-574Crossref PubMed Scopus (34) Google Scholar), which form β-turn motifs that bind to the DNA minor groove (22Suzuki M. EMBO J. 1989; 8: 797-804Crossref PubMed Scopus (213) Google Scholar, 24Churchill M.E. Suzuki M. EMBO J. 1989; 8: 4189-4195Crossref PubMed Scopus (172) Google Scholar) and mediate condensation of naked DNA in vitro (25Bharath M.M. Ramesh S. Chandra N.R. Rao M.R. Biochemistry. 2002; 41: 7617-7627Crossref PubMed Scopus (44) Google Scholar, 26Khadake J.R. Rao M.R. Biochemistry. 1997; 36: 1041-1051Crossref PubMed Scopus (47) Google Scholar, 27Khadake J.R. Rao M.R. FEBS Lett. 1997; 400: 193-196Crossref PubMed Scopus (10) Google Scholar). In the present study we use biochemically defined model systems to probe the mechanistic basis of linker histone CTD function in chromatin. We initially compared the biochemical properties of native chicken erythrocyte H5 and recombinant mouse H10. Subsequently, the structural and functional effects of incremental deletions of the mouse H10 CTD were determined. Our results indicate that distinct subdomains within the CTD are responsible for mediating linker histone effects on linker DNA conformation, and stabilization of condensed chromatin fiber structures. A revised mechanism for CTD function in chromatin is proposed. Construction of Mouse Histone H10 C-terminal Deletion Mutants— The Escherichia coli strains XL1-Blue and BL21(DE3) pLysS transformed with the plasmid pET-H10-11d were gifts from Dr. Susan Wellman. pET-H10-11d consists of the wild type mouse H10 cDNA cloned into expression vector pET-11d (28Wellman S.E. Song Y. Su D. Mamoon N.M. Biotechnol. Appl. Biochem. 1997; 26: 117-123PubMed Google Scholar). DNA sequences encoding C-terminal deletion mutants H10CΔ24, H10CΔ48, H10CΔ72, and H10CΔ97 (see Fig. 2A) were synthesized by PCR using the following oligonucleotide primers: TACCATGGCTACCGAGAACTCC and TTGGATCCTCAGGCCTTGACTGG for H10CΔ24; TACCATGGCTACCGAGAACTCC and GGGGATCCCTAGGCCTTCTTGA for H10CΔ48; TACCATGGCTACCGAGAACTCC and GGGGATCCTCACTTCTTTGGAGT for H10CΔ72; and TACCATGGCTACCGAGAACTCC and TTGGATCCTCACTTGGCCAGCC for H10CΔ97. PCR products were subcloned into pET-11d using standard procedures (29Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual.2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) to yield expression vectors pET-H10CΔ24–11d, pET-H10CΔ48–11d, pET-H10CΔ72–11d, and pET-H10CΔ97–11d, and propagated in E. coli strain XL1-Blue. The identities of the constructs were confirmed by restriction mapping and sequencing of purified plasmid DNAs. Histone Purification—Core histone octamers and native chicken erythrocyte linker histone H5 were purified as described previously (30Garcia-Ramirez M. Leuba S.H. Ausio J. Protein Expression Purif. 1990; 1: 40-44Crossref PubMed Scopus (33) Google Scholar, 31Hansen J.C. Ausio J. Stanik V.H. van Holde K.E. Biochemistry. 1989; 28: 9129-9136Crossref PubMed Scopus (201) Google Scholar). To obtain full-length and mutant H10 proteins, pET-H10-11d, pET-H10CΔ24–11d, pET-H10CΔ48–11d, pET-H10CΔ72–11d, and pET-H10CΔ97–11d were transformed into E. coli BL21(DE3) pLysS-competent cells. The transformed cells were grown at 37 °C, harvested, and washed as described (28Wellman S.E. Song Y. Su D. Mamoon N.M. Biotechnol. Appl. Biochem. 1997; 26: 117-123PubMed Google Scholar). The cells were sonicated, and the H10 proteins were purified as described (32Carter G.J. van Holde K. Anal. Biochem. 1998; 263: 79-84Crossref PubMed Scopus (1) Google Scholar, 33Cerf C. Lippens G. Muyldermans S. Segers A. Ramakrishnan V. Wodak S.J. Hallenga K. Wyns L. Biochemistry. 1993; 32: 11345-11351Crossref PubMed Scopus (50) Google Scholar) with minor modifications. Cell pellets were sonicated in 3 volumes of lysis buffer (25 mm Tris·HCl, 2.5 mm EDTA, 1.0 m NaCl, 0.5 mm phenylmethylsulfonyl fluoride, 1 μm pepstatin A). The pH of the lysis buffers were 8.3, 8.3, 8.0, 8.0, and 7.8 for H10, H10CΔ24, H10CΔ48, H10CΔ72, and H10CΔ97, respectively. Sonicated cells were incubated on ice for 30 min, and then pelleted. The NaCl concentration of the supernatants was decreased to 0.3 m by dilution, the supernatants were mixed with pre-hydrated CM-Sephadex C-25 (C-25) (Sigma), and the mixtures gently rocked for 3 h at 4 °C to allow the binding of the H10 proteins to the C-25. The mixtures were centrifuged to pellet the C-25, the resin was washed in 10 mm Tris·HCl, 1mm EDTA, 0.1 mm phenylmethylsulfonyl fluoride, 300 mm NaCl at the same pH as that of the lysis buffer, and the pelleted resin was loaded onto a C-25 column (2.5 × 25 cm) pre-equilibrated with the appropriate buffer. The proteins were eluted from the C-25 column with a 0.3–1.0 m NaCl gradient in 10 mm Tris·HCl, 1 mm EDTA, 0.1 mm phenylmethylsulfonyl fluoride at the same pH as the lysis buffer. At the completion of these steps, H10, H10CΔ48, and H10CΔ97 required no further purification. However, we routinely observed that the fractions containing H10CΔ24 and H10CΔ72 were contaminated with degradation products. Consequently, the C-25 fractions containing either H10CΔ24 or H10CΔ72 were combined, adjusted by dilution to 10 mm Tris·HCl, 1 mm EDTA, 0.1 mm phenylmethylsulfonyl fluoride, ∼300 mm NaCl at the same pH as that of the lysis buffer, and loaded onto a 5-ml HiTrap SP HP column (Amersham Biosciences). The mutant H10 proteins were then eluted with the same gradients used for the C-25 column. The purity of all H10 proteins was determined by SDS-PAGE and matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The concentrations of the purified proteins were determined using a BCA protein assay kit (Pierce). Assembly of Chromatin Model Systems—The 208-12 DNA template containing 12 tandem 208-bp repeats of Lytechinus variegatus 5 S rDNA (34Georgel P. Demeler B. Terpening C. Paule M.R. van Holde K.E. J. Biol. Chem. 1993; 268: 1947-1954Abstract Full Text PDF PubMed Google Scholar, 35Simpson R.T. Thoma F. Brubaker J.M. Cell. 1985; 42: 799-808Abstract Full Text PDF PubMed Scopus (387) Google Scholar) was purified as described (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar). Preparations of 208-12 nucleosomal arrays consisting of ∼50% saturated arrays (12 nucleosomes/template) and ∼50% subsaturated arrays (10–11 nucleosomes/template) were assembled by salt dialysis as described (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar). Binding of H5 and H10 to 208-12 nucleosomal arrays was achieved by incubating linker histone with nucleosomal arrays (150 μg/ml) in 10 mm Tris, 0.25 mm EDTA, 50 mm NaCl, pH 7.8, for 3 h on ice at various molar ratios (r) of linker histone to 208-bp DNA repeat, followed by dialysis of the samples against 10 mm Tris, 0.25 mm EDTA, 2.5 mm NaCl, pH 7.8 (TEN), overnight at 4 °C (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Analytical Ultracentrifugation—Sedimentation velocity experiments were performed using either a Beckman XL-A or XL-I ultracentrifuge as described (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 36Schwarz P.M. Hansen J.C. J. Biol. Chem. 1994; 269: 16284-16289Abstract Full Text PDF PubMed Google Scholar). Boundaries were analyzed by the method of van Holde and Weischet (37Van Holde K.E. Weischet W.O. Biopolymers. 1978; 17: 1387-1403Crossref Scopus (320) Google Scholar) using Ultrascan (version 5.0) software. Data were plotted as boundary fraction versus s20,w to yield the integral distribution of sedimentation coefficients, G(s). Average sedimentation coefficients were obtained at boundary fractions equal to 0.5 of the G(s) plot. For folding experiments, arrays were mixed with an equal volume of 2× MgCl2 stock solutions prior to sedimentation to obtain the desired final MgCl2 concentration. The final absorbance at 260 nm of all samples was 0.6–0.8. Agarose Multigel Electrophoresis—Electrophoretic mobilities, μ, were measured in a multigel composed of 9 individual agarose running gels ranging in concentration from 0.2 to 1.0%. The casting and running buffer was 40 mm Tris acetate (pH 7.8), 0.25 mm Na2EDTA. Samples were loaded and electrophoresed at 1.33 V/cm for 6 h. The temperature was 24 ± 3 °C. The gels were stained with ethidium bromide and the gel image was digitized. For each individual band, the migration was measured from the center of the well to the center of the band using NIH Image software and subsequently converted to μ. The effective macromolecular radius (Re) and free-electrophoretic mobility (μo) were obtained from μ as described (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Self-association Assay—The salt-dependent self-association of H5- and H10-bound nucleosomal arrays was determined using a differential centrifugation assay as described (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 36Schwarz P.M. Hansen J.C. J. Biol. Chem. 1994; 269: 16284-16289Abstract Full Text PDF PubMed Google Scholar). For each salt concentration assayed, data were plotted as the percentage of the initial sample absorbance that remained in the supernatant after centrifugation at 16,000 × g for 5 min in a microcentrifuge. The Ability of Chicken Erythrocyte H5 and Recombinant Mouse H10 to Bind to Nucleosomal Arrays, Alter Linker DNA Conformation, and Stabilize Condensed Secondary and Tertiary Chromatin Structures, Is Indistinguishable—The experiments described below extend our previous studies of linker histone structure-function relationships (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 38Horn P.J. Carruthers L.M. Logie C. Hill D.A. Solomon M.J. Wade P.A. Imbalzano A.N. Hansen J.C. Peterson C.L. Nat. Struct. Biol. 2002; 9: 263-267Crossref PubMed Scopus (131) Google Scholar) by investigating how specific deletion mutations in the linker histone CTD influence the primary, secondary, and tertiary structure of biochemically defined nucleosomal arrays. The linker histone used in our earlier experiments was H5 purified from chicken erythrocytes. However, given that recombinant chicken erythrocyte H5 is expressed very poorly in bacterial cells (39Gerchman S.E. Graziano V. Ramakrishnan V. Protein Expression Purif. 1994; 5: 242-251Crossref PubMed Scopus (64) Google Scholar), this linker histone isoform is a poor candidate for mutagenesis studies. Because the H10 isoform is considered to be the mammalian functional homologue of chicken H5 (40Pehrson J. Cole R.D. Nature. 1980; 285: 43-44Crossref PubMed Scopus (139) Google Scholar, 41Pehrson J.R. Cole R.D. Biochemistry. 1981; 20: 2298-2301Crossref PubMed Scopus (60) Google Scholar), and mouse H10 can be readily expressed and purified from E. coli (28Wellman S.E. Song Y. Su D. Mamoon N.M. Biotechnol. Appl. Biochem. 1997; 26: 117-123PubMed Google Scholar), recombinant mouse H10 was chosen for all studies involving recombinant proteins. To determine whether the in vitro properties of purified chicken H5 and recombinant mouse H10 were the same, we directly compared the binding of these linker histone isoforms to biochemically defined nucleosomal arrays, and characterized their respective abilities to stabilize condensed chromatin structures in salt (Fig. 1). Binding was assayed by determining the increase in average s20,w of 208-12 nucleosomal arrays in low salt TEN buffer as a function of the molar linker histone input ratio (rLH). Under these low salt conditions, nucleosomal arrays and chromatin fibers are unfolded, and there is no contribution to the s20,w from higher order folding. Instead, the increase in s20,w results from a combination of the mass of the bound linker histone, and a decreased array frictional coefficient (i.e. shortening of the overall length of the unfolded 12-mer array) because of linker histone-dependent formation of an apposed linker DNA stem motif (5Bednar J. Horowitz R.A. Grigoryev S.A. Carruthers L.M. Hansen J.C. Koster A.J. Woodcock C.L. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14173-14178Crossref PubMed Scopus (464) Google Scholar). Our previous studies using native chicken erythrocyte H5 showed that binding of approximately one H5 per nucleosome was achieved at rLH ≅ 1.3, and led to an increase in average s20,w in low salt from 29 to 36 S (Refs. 6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar and 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar; also see Table I). Binding of native chicken erythrocyte H5 and recombinant mouse H10 to 208-12 nucleosomal arrays is shown in Fig. 1A. Consistent with our previous studies, both linker histone isoforms caused an increase in average s20,w with increasing rLH, until a narrow plateau region was achieved at rLH = 1.2–1.3. The average s20,w in this plateau region was 36.8 ± 0.7 S for chicken erythrocyte H5 and 35.9 ± 0.3 S for recombinant H10. We previously have shown that the plateau is narrow because the average s20,w increases rapidly at higher rLH values because of nonspecific linker histone binding and aggregation (Fig. 1A) (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). The data in Fig. 1A demonstrate that, within experimental error, stoichiometric binding of native chicken erythrocyte H5 and recombinant mouse H10 to 208-12 nucleosomal arrays was achieved at the same molar linker histone input ratio, and led to the same increase in sedimentation coefficient under low salt conditions.Table ILinker histone stoichiometriesrLHzaCalculated total macromolecular charge.μ0StoichiometrybStoichiometry = [zNA(μ0LH - μ0NA)/μ0NA]/zLH.× 10-4 cm2 V-1 s-1NAcParent 208-12 nucleosomal arrays.-327-1.95 ± 0.2dValues represent the mean ± Sd of two to three determinations.H5eH5 stoichiometries calculated by the same method in previous studies were 1.3 ± 0.2 (6) and 1.4 ± 0.2 (7).1.361-1.55 ± .011.1 ± 0.1dValues represent the mean ± Sd of two to three determinations.H101.353-1.63 ± .031.0 ± 0.1H10Δ241.841-1.64 ± .011.3 ± 0.1H10Δ482.030-1.67 ± .011.6 ± 0.1H10Δ722.321-1.79 ± .021.3 ± 0.2H10Δ972.314-1.81 ± .011.7 ± 0.2a Calculated total macromolecular charge.b Stoichiometry = [zNA(μ0LH - μ0NA)/μ0NA]/zLH.c Parent 208-12 nucleosomal arrays.d Values represent the mean ± Sd of two to three determinations.e H5 stoichiometries calculated by the same method in previous studies were 1.3 ± 0.2 (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar) and 1.4 ± 0.2 (7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Open table in a new tab We next examined the salt-dependent condensation of H5- and H10-bound nucleosomal arrays. In vitro condensation consists of intramolecular folding in the range of 0.1–0.5 mm MgCl2, followed by cooperative array self-association at higher MgCl2 concentrations (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Folding of the biochemically defined model systems was characterized by sedimentation velocity, and the data were analyzed by the method of van Holde and Weischet (37Van Holde K.E. Weischet W.O. Biopolymers. 1978; 17: 1387-1403Crossref Scopus (320) Google Scholar) to yield the integral distribution of sedimentation coefficients, G(s), of the entire sample (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 42Carruthers L.M. Schirf V.R. Demeler B. Hansen J.C. Methods Enzymol. 2000; 321: 66-80Crossref PubMed Google Scholar). The G(s) plots of H5 and H10 arrays in TEN ± 0.25 or 0.5 mm MgCl2 are shown in Fig. 1B. In TEN, ∼50% of both the H5- and H10-bound arrays sedimented at 36–37 S (boundary fraction ≥50%), indicating that this fraction consisted of 208-12 DNA templates stoichiometrically bound with 12 histone octamers/template and 1 linker histone per nucleosome (see Fig. 1A) (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). The remainder of the templates (boundary fraction ≤50%) contained substoichiometric amounts of histone octamers and (or) linker histones, rendering this fraction of the samples uninformative for fiber stability studies (6Carruthers L.M. Bednar J. Woodcock C.L. Hansen J.C. Biochemistry. 1998; 37: 14776-14787Crossref PubMed Scopus (210) Google Scholar, 7Carruthers L.M. Hansen J.C. J. Biol. Chem. 2000; 275: 37285-37290Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). The G(s) plots of the saturated H5- and H10-bound arrays in the presence of 0.25 and 0.5 mm MgCl2 were essentially identical (Fig. 1B). Notably, in 0.5 mm MgCl2 the saturated fraction of both the H5 and H10 arrays formed homogeneous populations of extensively cond
Referência(s)