The 7472insC Mitochondrial DNA Mutation Impairs the Synthesis and Extent of Aminoacylation of tRNASer(UCN) but Not Its Structure or Rate of Turnover
2002; Elsevier BV; Volume: 277; Issue: 25 Linguagem: Inglês
10.1074/jbc.m200338200
ISSN1083-351X
AutoresMarina Toompuu, Takehiro Yasukawa, Tsutomu Suzuki, Terhi Hakkinen, Johannes N. Spelbrink, Kimitsuna Watanabe, Howard T. Jacobs,
Tópico(s)RNA and protein synthesis mechanisms
ResumoThe 7472insC mitochondrial DNA mutation in the tRNASer(UCN) gene is associated with sensorineural deafness combined, in some patients, with a wider neurological syndrome. In cultured cybrid cells it causes a 70% decrease in tRNASer(UCN) abundance and mild respiratory impairment, previously suggested to be due to decreased tRNA stability. When mitochondrial transcription was blocked by ethidium bromide treatment, the half-life of the mutant tRNA was not significantly different from that of wild-type tRNASer(UCN). Over-expression of mitochondrial translational elongation factor EF-Tu also had no effect on the mutant phenotype. However, during recovery from prolonged ethidium bromide treatment, the synthesis of the mutant tRNASer(UCN) was specifically impaired, without polarity effects on downstream tRNAs of the light strand transcription unit. We infer that the mutation acts posttranscriptionally to decrease tRNASer(UCN) abundance by affecting its synthesis rather than its stability. The extent of aminoacylation of the mutant tRNA was also decreased by ∼25%. In contrast, the mutation had no detectable effect on tRNASer(UCN) base modification or structure other than the insertion of an extra guanosine templated by the mutation, which was structurally protected from nuclease digestion like the surrounding nucleotides. These findings indicate a common molecular process underlying sensorineural deafness caused by mitochondrial tRNASer(UCN) mutations. The 7472insC mitochondrial DNA mutation in the tRNASer(UCN) gene is associated with sensorineural deafness combined, in some patients, with a wider neurological syndrome. In cultured cybrid cells it causes a 70% decrease in tRNASer(UCN) abundance and mild respiratory impairment, previously suggested to be due to decreased tRNA stability. When mitochondrial transcription was blocked by ethidium bromide treatment, the half-life of the mutant tRNA was not significantly different from that of wild-type tRNASer(UCN). Over-expression of mitochondrial translational elongation factor EF-Tu also had no effect on the mutant phenotype. However, during recovery from prolonged ethidium bromide treatment, the synthesis of the mutant tRNASer(UCN) was specifically impaired, without polarity effects on downstream tRNAs of the light strand transcription unit. We infer that the mutation acts posttranscriptionally to decrease tRNASer(UCN) abundance by affecting its synthesis rather than its stability. The extent of aminoacylation of the mutant tRNA was also decreased by ∼25%. In contrast, the mutation had no detectable effect on tRNASer(UCN) base modification or structure other than the insertion of an extra guanosine templated by the mutation, which was structurally protected from nuclease digestion like the surrounding nucleotides. These findings indicate a common molecular process underlying sensorineural deafness caused by mitochondrial tRNASer(UCN) mutations. mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes myoclonic epilepsy with ragged-red fibers ethidium bromide nucleotide pair reverse transcription light strand transcription unit More than 50 pathological mutations in mitochondrial tRNA genes have now been reported and validated (Ref. 1Di Mauro S. Andreu A.L. Brain Pathol. 2000; 10: 431-441Crossref PubMed Scopus (82) Google Scholar, see also www.gen.emory.edu/mitomap.html), and the molecular effects of many have been at least partially elucidated via the creation of ρ0cybrids (fusions to cells lacking endogenous mitochondrial DNA, see Ref. 2King M.P. Attardi G. Science. 1988; 246: 500-503Crossref Scopus (1442) Google Scholar) or other cell culture models. Heteroplasmic mutations, such as A3243G or other tRNALeu(UUR) mutations found in cases of MELAS1 (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) and other syndromes or A8344G and T8356C found in cases of MERFF (myoclonic epilepsy with ragged-red fibers), tend to have severe quantitative and/or qualitative effects on mitochondrial protein synthesis and respiratory function (3Dunbar D.R. Moonie P.A. Zeviani M. Holt I.J. Hum. Mol. Genet. 1996; 5: 123-129Crossref PubMed Scopus (95) Google Scholar, 4Enriquez J.A. Chomyn A. Attardi G. Nat. Genet. 1995; 10: 47-55Crossref PubMed Scopus (257) Google Scholar, 5Masucci J.P. Davidson M. Koga Y. Schon E.A. King M.P. Mol. Cell. Biol. 1995; 15: 2872-2881Crossref PubMed Scopus (100) Google Scholar, 6El Meziane A. Lehtinen S.K. Hance N. Nijtmans L.G.J. Dunbar D. Holt I.J. Jacobs H.T. Nat. Genet. 1998; 18: 350-353Crossref PubMed Scopus (92) Google Scholar). They are associated with abnormal base modification (7Helm M. Florentz C. Chomyn A. Attardi G. Nucleic Acids Res. 1999; 27: 756-763Crossref PubMed Scopus (89) Google Scholar, 8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar, 9Yasukawa T. Suzuki T. Ishii N. Ueda T. Ohta S. Watanabe K. FEBS Lett. 2000; 467: 175-178Crossref PubMed Scopus (113) Google Scholar), decreased aminoacylation (4Enriquez J.A. Chomyn A. Attardi G. Nat. Genet. 1995; 10: 47-55Crossref PubMed Scopus (257) Google Scholar, 8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar, 10El Meziane A. Lehtinen S.K. Holt I.J. Jacobs H.T. Hum. Mol. Genet. 1998; 7: 2141-2147Crossref PubMed Scopus (33) Google Scholar, 11Chomyn A. Enriquez J.A. Micol V. Fernandez-Silva P. Attardi G. J. Biol. Chem. 2000; 275: 19198-19209Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 12Börner G.V. Zeviani M. Tiranti V. Carrara F. Hoffmann S. Gerbitz K.D. Lochmuller H. Pongratz D. Klopstock T. Melberg A. Holme E. Pääbo S. Hum. Mol. Genet. 2000; 9: 467-475Crossref PubMed Scopus (79) Google Scholar), and reduced steady-state levels of the corresponding tRNAs (5Masucci J.P. Davidson M. Koga Y. Schon E.A. King M.P. Mol. Cell. Biol. 1995; 15: 2872-2881Crossref PubMed Scopus (100) Google Scholar, 6El Meziane A. Lehtinen S.K. Hance N. Nijtmans L.G.J. Dunbar D. Holt I.J. Jacobs H.T. Nat. Genet. 1998; 18: 350-353Crossref PubMed Scopus (92) Google Scholar, 8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar, 11Chomyn A. Enriquez J.A. Micol V. Fernandez-Silva P. Attardi G. J. Biol. Chem. 2000; 275: 19198-19209Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). Mutations in tRNALeu(UUR) are associated frequently with defective RNA processing (6El Meziane A. Lehtinen S.K. Hance N. Nijtmans L.G.J. Dunbar D. Holt I.J. Jacobs H.T. Nat. Genet. 1998; 18: 350-353Crossref PubMed Scopus (92) Google Scholar, 13Kaufmann P. Koga Y. Shanske S. Hirano M., Di Mauro S. King M.P. Schon E.A. Ann. Neurol. 1996; 40: 172-180Crossref PubMed Scopus (58) Google Scholar, 14Bindoff L.A. Howell N. Poulton J. McCullough D.A. Morten K.J. Lightowlers R.N. Turnbull D.M. Weber K. J. Biol. Chem. 1993; 268: 19559-19564Abstract Full Text PDF PubMed Google Scholar, 15Rossmanith W. Karwan R.M. FEBS Lett. 1998; 433: 269-274Crossref PubMed Scopus (65) Google Scholar) and also shortened half-life (8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar) of the affected tRNA. By contrast, mutations affecting tRNASer(UCN), which are frequently homoplasmic or implicated pathologically only at high levels of heteroplasmy, have rather modest effects on mitochondrial function and are generally associated with mild or tissue-restricted pathological states, principally sensorineural deafness. The 7472insC mutation is one such mutation. Clinically, most subjects have an apparently non-syndromic hearing impairment (16Verhoeven K. Ensink R.J. Tiranti V. Huygen P.L. Johnson D.F. Schatteman I. Van Laer L. Verstreken M. Van de Heyning P. Fischel-Ghodsian N. Zeviani M. Cremers C.W.R.J. Willems P.J. Van Camp G. Eur. J. Hum. Genet. 1999; 7: 45-51Crossref PubMed Scopus (74) Google Scholar), with a minority suffering a more widespread neurological disease including ataxia and myoclonic seizures (16Verhoeven K. Ensink R.J. Tiranti V. Huygen P.L. Johnson D.F. Schatteman I. Van Laer L. Verstreken M. Van de Heyning P. Fischel-Ghodsian N. Zeviani M. Cremers C.W.R.J. Willems P.J. Van Camp G. Eur. J. Hum. Genet. 1999; 7: 45-51Crossref PubMed Scopus (74) Google Scholar, 17Tiranti V. Chariot P. Carella F. Toscano A. Soliveri P. Girlanda P. Carrara F. Fratta G.M. Reid F.M. Mariotti C. Zeviani M. Hum. Mol. Genet. 1995; 4: 1421-1427Crossref PubMed Scopus (180) Google Scholar, 18Jaksch M. Klopstock T. Kurlemann G. Dorner M. Hofmann S. Kleinle S. Hegemann S. Weissert M. Muller-Hocker J. Pongratz D. Gerbitz K.D. Ann. Neurol. 1998; 44: 635-640Crossref PubMed Scopus (94) Google Scholar), sometimes with a measurable deficit of cytochrome c oxidase (18Jaksch M. Klopstock T. Kurlemann G. Dorner M. Hofmann S. Kleinle S. Hegemann S. Weissert M. Muller-Hocker J. Pongratz D. Gerbitz K.D. Ann. Neurol. 1998; 44: 635-640Crossref PubMed Scopus (94) Google Scholar). In 143B osteosarcoma-derived cybrid cells, homoplasmy for the 7472insC mutation produces only a very modest biochemical phenotype, comprising a small decrease in complex I activity (17Tiranti V. Chariot P. Carella F. Toscano A. Soliveri P. Girlanda P. Carrara F. Fratta G.M. Reid F.M. Mariotti C. Zeviani M. Hum. Mol. Genet. 1995; 4: 1421-1427Crossref PubMed Scopus (180) Google Scholar) and a growth deficit in galactose medium when the mutation is present in combination with a diminished copy number of mtDNA (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). Effects on mitochondrial protein synthesis are minimal, with only a slight quantitative decrease in mitochondrial translation products detectable by pulse labeling (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar), an effect mildly exacerbated by doxycycline treatment (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). The only clear molecular effect of the mutation that can be seen in cybrid cells is a decrease of ∼70% in the steady-state level of tRNASer(UCN) (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar), an effect shared with the A7445G deafness-associated mutation (20Reid F.M. Rovio A. Holt I.J. Jacobs H.T. Hum. Mol. Genet. 1997; 6: 443-449Crossref PubMed Scopus (44) Google Scholar, 21Guan M.X. Enriquez J.A. Fischel-Ghodsian N. Puranam R.S. Lin C.P. Maw M.A. Attardi G. Mol. Cell. Biol. 1998; 18: 5868-5879Crossref PubMed Scopus (174) Google Scholar). Unlike the case of the latter, which has been studied only in lymphoblastoid cells, 7472insC produces no systematic change to the level of the upstream (ND6) mRNA, leading to the suggestion that its effects are most likely on the half-life of tRNASer(UCN) rather than on its processing (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). Electrophoretic analysis of [14C]serine-labeled tRNA also suggested only a minimal effect on aminoacylation. To investigate in further detail the molecular effects of the 7472insC mutation, we applied a variety of assays. These compared 143B osteosarcoma-derived cybrid cell lines homoplasmic for the mutation with those containing only wild-type mtDNA derived from the same patient. Mitochondrial tRNA half-lives and synthesis rates were measured via the use of ethidium bromide (EtBr) to block new transcription of mtDNA (8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Effects on aminoacylation were studied using oxidation-circularization of tRNA (12Börner G.V. Zeviani M. Tiranti V. Carrara F. Hoffmann S. Gerbitz K.D. Lochmuller H. Pongratz D. Klopstock T. Melberg A. Holme E. Pääbo S. Hum. Mol. Genet. 2000; 9: 467-475Crossref PubMed Scopus (79) Google Scholar) combined with minisequencing to determine the ratio of mutant to wild-type tRNA in the final product mixture. Effects on base modification were studied by primary sequence determination of tRNASer(UCN) (22Donis-Keller H. Nucleic Acids Res. 1980; 8: 3133-3142Crossref PubMed Scopus (258) Google Scholar, 23Kuchino Y. Hanyu N. Nishimura S. Methods Enzymol. 1987; 155: 379-396Crossref PubMed Scopus (74) Google Scholar) and on secondary/tertiary structure by partial RNase digestion under non-denaturing conditions. Possible effects on tRNA stability were also investigated by overexpression of mitochondrial EF-Tu. These assays revealed a pronounced decrease in the rate of synthesis but not the half-life of the mutant tRNA, combined with a small but clear decrease in the extent of aminoacylation. Because of the absence of polarity effects on the synthesis of downstream tRNAs of the light strand transcription unit, the mutation is inferred to act posttranscriptionally. Only very subtle effects on structure or stability were found. Considered alongside previous findings on the A7445G mutation (20Reid F.M. Rovio A. Holt I.J. Jacobs H.T. Hum. Mol. Genet. 1997; 6: 443-449Crossref PubMed Scopus (44) Google Scholar, 21Guan M.X. Enriquez J.A. Fischel-Ghodsian N. Puranam R.S. Lin C.P. Maw M.A. Attardi G. Mol. Cell. Biol. 1998; 18: 5868-5879Crossref PubMed Scopus (174) Google Scholar, 24Levinger L. Jacobs O. James M. Nucleic Acids Res. 2001; 29: 4334-4340Crossref PubMed Scopus (51) Google Scholar), a consistent picture emerges of mtDNA mutations that impair tRNASer(UCN) maturation producing sensorineural deafness as their primary clinical phenotype. 143B osteosarcoma cell cybrids homoplasmic for the np7472insC mutation or for wild-type mtDNA from the same individual were as described previously (17Tiranti V. Chariot P. Carella F. Toscano A. Soliveri P. Girlanda P. Carrara F. Fratta G.M. Reid F.M. Mariotti C. Zeviani M. Hum. Mol. Genet. 1995; 4: 1421-1427Crossref PubMed Scopus (180) Google Scholar, 19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). Specific cell lines used in the experiments are indicated in figure legends. Except where indicated, line 43 was used as the source of control tRNA and line 47 was used as the source of mutant tRNA. Cells were routinely cultured in media supplemented with uridine and pyruvate as described previously (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar) and passaged weekly. Custom-designed oligonucleotides were purchased from DNA Technology (Aarhus, Denmark) or Genset (Paris, France) and are as follows (all shown as 5′-3′). For Northern and dot-hybridization: Ser11-AAGGAAGGAATCGAACCCCCCAAAGCTG (np 7451–7478 of human mtDNA, Ref. 25Anderson S. Bankier A.T. Barrell B.G. de Bruijn M.H. Coulson A.R. Drouin J. Eperon I.C. Nierlich D.P. Roe B.A. Sanger F. Schreier P.H. Smith A.J. Staden R. Young I.G. Nature. 1981; 290: 457-465Crossref PubMed Scopus (7558) Google Scholar); Leu21 (Ref.6El Meziane A. Lehtinen S.K. Hance N. Nijtmans L.G.J. Dunbar D. Holt I.J. Jacobs H.T. Nat. Genet. 1998; 18: 350-353Crossref PubMed Scopus (92) Google Scholar)-GTTTTATGCGATTACCGGGC (np 3263–3244), Gln-GAATCGAACCCATCCCTGAG (np 4341–4360), Tyr-ATTTACAGTCCAATGCTTCACTC (np 5857–5879), Asn-CACAAACACTTAGTTAACAGC (np 5679–5699), Lys-AAAGGTTAATGCTAAGTTAGC (np 8304–8324), and 5S1 (Ref. 8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar)- GGGTGGTATGGCCGTAGAC (np 294–276 of GenBankTM entry X71797); for purification of tRNASer(UCN): Ser-Bio, with 3′ biotinylation-AGCCAACCCCATGGCCTCCATGACTTTTTC (np 7485–7514 of human mtDNA); for RT-PCR of circularized tRNASer(UCN): cser1-TGGCCTCCATGACTTTTTC (np 7496–7514); and cser2-ATGGGGTTGGCTTGAAAC (np 7496–7479); for minisequencing: cser3-CTTGAAACCAGCTTTGGGGGG (np 7486–7467), and cser4-AAGGAAGGAATCGAACCCCCC (np 7451–7471). For RT-PCR cloning of the human mitochondrial EF-Tu cDNA (from the TUFM gene),BamHI/TufA51- CGCGGATCCACCACAATGGCGGCCGCCACCCTGCT andHindIII/TufA33-stop-GGGAAGCTTTCAACCCCATTTGATATTCTTC; for analysis of the presence of the TUFM transgene in transfected cell clones by PCR and its expression by RT-PCR: BGH-TAGAAGGCACAGTCGAGGC and TufA-52: GTTCTCCCTGACTTGGAACATGGCCTGT; for analysis of the presence and expression of empty vector in transfected cell clones: BGH (as above) and T7-TAATACGACTCACTATAGGG. Total RNA was prepared from cells using the Trizol method as previously described (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). For sequencing, about 500 or 1000 A 260units (depending on the purpose) of total RNA were extracted from 100–200 9-cm plates of semiconfluent cells (∼109 cells) by Trizol extraction (Invitrogen). Total RNA was incubated at 37 °C for 2 h in 20 mm Tris-HCl, pH 9.0, to deacylate tRNAs. After this treatment, the pH was adjusted to 7.5, and RNA was fractionated on 1 × 45-cm DEAE-Sepharose fast flow columns (Amersham Biosciences) as described previously (8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Fractions enriched for tRNASer(UCN) were monitored by dot hybridization with oligonucleotide Ser-11. Oligonucleotide labeling, hybridization, and wash conditions were as used previously (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). tRNASer(UCN) was finally purified by selective hybridization using a solid phase 3′-biotinylated oligonucleotide probe (Ser-Bio) followed by gel electrophoresis as described previously (26Wakita K. Watanabe Y. Yokogawa T. Kumazawa Y. Nakamura S. Ueda T. Watanabe K. Nishikawa K. Nucleic Acids Res. 1994; 22: 347-353Crossref PubMed Scopus (75) Google Scholar). The final yield of tRNASer(UCN) for sequencing was estimated at ∼0.5–1 μg. RT-PCR used 0.0125A 260 units of random hexamers and Invitrogen M-MLV-RTase. Except where indicated, PCR and RT-PCR reactions used 55 °C for the annealing step. Northern blotting to oligonucleotide probes used the same conditions as described previously (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). Acidic gel electrophoresis to distinguish aminoacylated and non-aminoacylated tRNAs, as well as alkaline deacylation, were as described previously (10El Meziane A. Lehtinen S.K. Holt I.J. Jacobs H.T. Hum. Mol. Genet. 1998; 7: 2141-2147Crossref PubMed Scopus (33) Google Scholar). tRNASer(UCN), purified from cybrid cells with or without the 7472insC mutation, was sequenced by a combination of partial RNase digestion (22Donis-Keller H. Nucleic Acids Res. 1980; 8: 3133-3142Crossref PubMed Scopus (258) Google Scholar) and thin-layer chromatographic analysis of 5′-postlabeled nucleotides (23Kuchino Y. Hanyu N. Nishimura S. Methods Enzymol. 1987; 155: 379-396Crossref PubMed Scopus (74) Google Scholar) with modifications as described (8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Briefly, for the partial digestion method, the tRNA was labeled at the 5′ end with [γ-32P]ATP (185 TBq/mmol, AmershamBiosciences) and T4 polynucleotide kinase (MBI Fermentas) or at the 3′ end with [32P]pCp (110 TBq/mmol, AmershamBiosciences) and T4 RNA ligase (MBI Fermentas) followed by gel-purification and partial digestion under denaturing conditions. The nucleotide-specific RNases used for partial digestion were RNase T1 (USB), specific for G, RNase U2 (Amersham Biosciences) specific for A > G, RNase CL, i.e. from chicken liver (Sigma), specific for C, RNase A (USB), which cuts at C and U, RNase PhyM (Amersham Biosciences), which cuts at A and U, plus RNase ONE (Promega) and RNase T2 (Sigma), both of which are not base-specific. The procedures for the chromatographic method were as described previously (8Yasukawa T. Suzuki T. Suzuki T. Ueda T. Ohta S. Watanabe K. J. Biol. Chem. 2000; 275: 4251-4257Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Briefly, the tRNA was incubated at 95 °C for 1.5 min in water to induce single site, random cleavage. The 3′-half-fragments were 5′-labeled with [γ-32P]ATP using T4 polynucleotide kinase and electrophoresed in denaturing polyacrylamide gels. The ladders of 5′-32P-labeled fragments were then cut out one by one and eluted from the gel. Each of the 5′-labeled fragments was then digested completely by RNase P1. The resultant 5′-labeled nucleotides from each fragment were analyzed individually by two-dimensional TLC with two different solvent systems (23Kuchino Y. Hanyu N. Nishimura S. Methods Enzymol. 1987; 155: 379-396Crossref PubMed Scopus (74) Google Scholar) on 10 × 10-cm plates. Solvent system A consisted of isobutyric acid/concentrated ammonia/H2O (66:1:33 by volume) in the first dimension and 2-propanol/HCl/H2O (70:15:15 by volume) in the second dimension. In solvent system B, the first dimension was the same as that used for system A, but 0.1 m sodium phosphate, pH 6.8/ammonium sulfate/1-propanol (100 ml:60 mg:2 ml) was used for the second dimension. For enzymatic probing of differences in secondary/tertiary structure, the 5′ end-labeled tRNA was refolded in 20–30 μl of renaturation buffer (150 mm NaCl, 10 mm MgCl2, 20 mm Tris-HCl, pH7.5) by cooling from 95 to 35 °C at 2 °C per min and then digested with specific RNases at 37 °C in the same buffer. Approximately 5000 cpm of labeled RNA was used in each reaction. Alkaline digestions (in 50 mm Na2CO3, pH 9.0) were carried out on non-renatured tRNA heated to 95 °C and immediately quenched on ice. Intactness of the RNA to be used in enzymatic digests was checked electrophoretically after renaturation. The extent of aminoacylation of tRNASer(UCN)was measured using the oxidation-circularization assay, essentially as described by Börner et al. (12Börner G.V. Zeviani M. Tiranti V. Carrara F. Hoffmann S. Gerbitz K.D. Lochmuller H. Pongratz D. Klopstock T. Melberg A. Holme E. Pääbo S. Hum. Mol. Genet. 2000; 9: 467-475Crossref PubMed Scopus (79) Google Scholar) but with the following modifications. Total RNA was isolated by Trizol extraction from cells grown to 90% confluence and dissolved on ice in 0.1 mNaOAc, pH 5.0. In some experiments, small RNAs were isolated from 25 μg of total RNA, using chromatography on DEAE-Sepharose fast flow (Amersham Biosciences). Eluates were divided into four aliquots, precipitated, and used for two sets of oxidation-circularization reactions. RNA preparations from control and mutant cybrids were mixed in various arbitrary proportions, giving ratios of wild-type to mutant signal in the final assay of between 0.2 and 3. cDNA was synthesized from circularized tRNASer(UCN) using primer cser1 and then amplified with primers cser1 and cser2 (92 °C, 2 min; 30 cycles of 94 °C, 30 s, 55 °C, 30 s, 72 °C, 30 s; final extension at 72 °C, 5 min). RT-PCR products were isolated by 10% PAGE, eluted, and purified (PCR purification kit, Qiagen). Quantitation of the ratio of mutant to wild-type product from total and aminoacylated (oxidation-resistant) RNA was carried out by minisequencing using the ABI Prism SNaPshot ddNTP primer extension kit (PE Biosystems) under the conditions recommended by the supplier. Extension primers cser3 and cser4 (for opposite strands) were used to analyze all products. For half-life measurements, cell cultures were seeded at equal densities, giving 60–70% confluence, on 6-cm plates 14–16 h before the experiment. They were then incubated in fresh medium containing 250 ng/ml of EtBr for the times indicated in the figures. For synthesis measurements, cells were seeded at 50% confluence on 9-cm plates 14–16 h before the experiment and then incubated in medium containing 250 ng/ml of EtBr for two days after which they were passaged into fresh medium on 6-cm plates. Medium was again replaced after 5–6 h of recovery and then daily until cells were harvested at the times indicated in figures. Cells were either seeded initially at different densities so that they reached approximately the same final densities at the time of harvesting or else were passaged once more, reaching different final densities according to the time at which they were harvested. The two sets of data thus obtained were indistinguishable. Total RNA was isolated by Trizol extraction, separated on 12% PAGE/7 murea/TBE gels, and analyzed by Northern hybridization. Northern blots were quantitated by phosphorimaging as described previously (19Toompuu M. Tiranti V. Zeviani M. Jacobs H.T. Hum. Mol. Genet. 1999; 8: 2275-2283Crossref PubMed Scopus (44) Google Scholar). The mitochondrial EF-Tu cDNA was amplified from human HEK293T cell cDNA in an RT-PCR reaction using the primers BamHI/TufA51 and HindIII/TufA33 (4 min at 94 °C, then 30 cycles of 30 s at 94 °C, 1 min at 58 °C, 3 min at 72 °C, with a final extension of 15 min at 72 °C). The product was digested with BamHI and HindIII and cloned intoBamHI/HindIII-digested pcDNA3.1(-) Myc/His A (Invitrogen). Clones were sequence-verified against GenBank accession no. X84694 using BigDye terminator chemistry (Applied Biosystems, Foster City, CA) with a combination of vector-specific and mtDNA-specific primers. Sequencing products were analyzed by capillary electrophoresis on an Applied Biosystems 310 Genetic Analyzer using the manufacturer's software. The final TUFM clone (or empty vector) was transfected into 143B osteosarcoma cybrid cell lines 43 (control) and 47 (7472insC mutant), seeded on 9-cm plates and grown to 50–60% confluence. For each transfection, 4 μg of DNA and 40 μg of LipofectAMINE (Invitrogen) were diluted in 4 ml of Opti-MEM (Invitrogen) and added to cells washed with Opti-MEM. After 5 h 8 ml of fresh medium was added, and after 24 h cells were placed under selection in 1.6 mg/ml Geneticin (Invitrogen). After 1 week of selection cells were passaged to obtain single clones, which were picked and regrown in 6-well plates. The presence and expression of a transgene was tested by PCR and RT-PCR, using the primers described above. Whole cell lysates from transfected cell clones were processed for Western blotting essentially as described previously (27Spelbrink J.N. Toivonen J.M. Hakkaart G.A.J. Kurkela J.M. Cooper H.M. Lehtinen S.K. Lecrenier N. Back J.W. Speijer D. Foury F. Jacobs H.T. J. Biol. Chem. 2000; 275: 24818-24828Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Cells from a 6-cm plate were lysed in 50 μl of PBS/1% Triton-X100/2.5 mm phenylmethylsulfonyl fluoride, vortexed, incubated on ice for 30 min, and centrifuged for 2 min at 14,000 × g max. Protein concentrations were measured by the Bradford method (28Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (214159) Google Scholar). For detection of EF-Tu mouse monoclonal mAb-68 (1:500 dilution) (Ref. 29Wells J. Henkler F. Leversha M. Koshy R. FEBS Lett. 1995; 358: 119-125Crossref PubMed Scopus (32) Google Scholar, a kind gift of Frank Henkler) and goat or horse anti-mouse horseradish peroxidase (1:10000 dilution) antibodies were used. Detection of PAK1 (p21-associated kinase) used rabbit polyclonal PAKαC-19 (Santa Cruz Biotechnology, 1:5000 dilution) and horse anti-rabbit horseradish peroxidase (1:10000 dilution) antibodies. Fluorographs were analyzed by densitometry. To evaluate the structural effects of the 7472insC mutation, the primary sequence of tRNASer(UCN) from two different control cybrid cell lines was first determined (Fig. 1) via a combination of partial RNase digestion of end-labeled tRNAs (Donis-Keller method, see Ref. 22Donis-Keller H. Nucleic Acids Res. 1980; 8: 3133-3142Crossref PubMed Scopus (258) Google Scholar) and TLC of postlabeled mononucleotides derived from a standard, stepwise degradation procedure (Kuchino method, see Ref. 23Kuchino Y. Hanyu N. Nishimura S. Methods Enzymol. 1987; 155: 379-396Crossref PubMed Scopus (74) Google Scholar). The tRNA was first purified by DEAE-Sepharose chromatography, followed by affinity hybridization to a specific biotinylated oligonucleotide immobilized on streptavidin-coated beads (26Wakita K. Watanabe Y. Yokogawa T. Kumazawa Y. Nakamura S. Ueda T. Watanabe K. Nishikawa K. Nucleic Acids Res. 1994; 22: 347-353Crossref PubMed Scopus (75) Google Scholar). Modifications of four kinds were detected at five positions of the tRNA. Two pseudouridines were found, one located in the anticodon stem (conventional position 28 based on the scheme given in Ref. 30Sprinzl M. Horn C. Brown M Ioudovitch A. Steinberg S. Nucleic Acids Res. 1998; 26: 148-153Crossref PubMed Scopus (811) Google Scholar, actual position 25 numbered from the 5′ end), the other in the T-loop at conventional position 55 (actual position 51), adjacent to a ribothymidine (conventional position 54, actual position 50), giving the conventional TΨC motif. In the anticodon loop, two additional modifications similar to those found previously in bovine mitochondrial tRNASer(UCN) (31Yokagawa T. Watanabe Y.I. Kumazawa Y. Ueda T. Hirao I Miura K.I. Watanabe K. Nucleic Acids Res. 1991; 19: 6101-6105Crossref PubMed Scopus (68) Google Scholar) were found: 3-methylcytosine at co
Referência(s)