A Novel Epithelial Keratin, hK6irs1, is Expressed Differentially in All Layers of the Inner Root Sheath, Including Specialized Huxley Cells (Flügelzellen) of the Human Hair Follicle
2002; Elsevier BV; Volume: 118; Issue: 5 Linguagem: Inglês
10.1046/j.1523-1747.2002.01711.x
ISSN1523-1747
AutoresLutz Langbein, Silke Praetzel, Michael A. Rogers, Noriaki Aoki, Hermelita Winter, Jürgen Schweizer,
Tópico(s)Dermatological and Skeletal Disorders
ResumoIn this study we have characterized a novel human type II keratin, hK6irs1, which is specifically expressed in the inner root sheath of the hair follicle. This keratin represents the ortholog of the recently described mouse inner root sheath keratin mK6irs. The two keratins were highly related and migrated at the same height as keratin 6 in two-dimensional gel electrophoresis. Both RNA in situ hybridization and indirect immunofluorescence studies of human hair follicles demonstrated hK6irs1 expression in the Henle and Huxley layers as well as in the cuticle of the inner root sheath. In all three layers, the expression of hK6irs1 mRNA and protein began simultaneously in adjacent cells of the lowermost bulb above the germinative cell pool. Higher up in the follicle, the detection limits for both hK6irs1 mRNA and protein precisely coincided with the asynchronous onset of abrupt terminal differentiation of the Henle layer, inner root sheath cuticle, and Huxley layer. Mainly above the level of terminal Henle cell differentiation, both indirect immunofluorescence and immunoelectron microscopy revealed the occurrence of distinct Huxley cells that developed pseudopodal hK6irs1-positive extensions passing through the fully keratinized Henle layer. These outwardly protruding foot processes abutted upon cells of the companion layer, with which they were connected by numerous desmosomes. These specialized Huxley cells have previously been termed "Flügelzellen", which means "winged cells", with reference to their characteristic foot processes. We provide evidence that, together with Henle cells, Flügelzellen ensure the maintenance of a continuous desmosomal anchorage of the companion layer along the entire inner root sheath. This tightly connected companion layer/inner root sheath unit provides an optimal molding and guidance of the growing hair shaft. In this study we have characterized a novel human type II keratin, hK6irs1, which is specifically expressed in the inner root sheath of the hair follicle. This keratin represents the ortholog of the recently described mouse inner root sheath keratin mK6irs. The two keratins were highly related and migrated at the same height as keratin 6 in two-dimensional gel electrophoresis. Both RNA in situ hybridization and indirect immunofluorescence studies of human hair follicles demonstrated hK6irs1 expression in the Henle and Huxley layers as well as in the cuticle of the inner root sheath. In all three layers, the expression of hK6irs1 mRNA and protein began simultaneously in adjacent cells of the lowermost bulb above the germinative cell pool. Higher up in the follicle, the detection limits for both hK6irs1 mRNA and protein precisely coincided with the asynchronous onset of abrupt terminal differentiation of the Henle layer, inner root sheath cuticle, and Huxley layer. Mainly above the level of terminal Henle cell differentiation, both indirect immunofluorescence and immunoelectron microscopy revealed the occurrence of distinct Huxley cells that developed pseudopodal hK6irs1-positive extensions passing through the fully keratinized Henle layer. These outwardly protruding foot processes abutted upon cells of the companion layer, with which they were connected by numerous desmosomes. These specialized Huxley cells have previously been termed "Flügelzellen", which means "winged cells", with reference to their characteristic foot processes. We provide evidence that, together with Henle cells, Flügelzellen ensure the maintenance of a continuous desmosomal anchorage of the companion layer along the entire inner root sheath. This tightly connected companion layer/inner root sheath unit provides an optimal molding and guidance of the growing hair shaft. The hair follicle is composed of several concentric and morphologically distinct compartments: the outer root sheath (ORS), which is contiguous with the interfollicular epidermis, the inner root sheath (IRS), which surrounds the hardening hair fiber, and the central hair-forming unit proper. These major compartments can be further subdivided. One example for this subdivision is the "innermost layer of the ORS", termed the companion layer, whose cells clearly possess properties different from those of the adjacent ORS cells (Orwin, 1971Orwin D.F.G. Cell differentiation in the lower outer root sheath of the Romney wool follicle: a companion cell layer.Aust J Biol Sci. 1971; 24: 989-999PubMed Google Scholar;Ito, 1986Ito M. The innermost cell layer of the outer root sheath in anagen hair follicle: light and electron microscopic study.Arch Dermatol Res. 1986; 279: 112-119Crossref PubMed Scopus (75) Google Scholar,Ito, 1988Ito M. Electron microscopic study on cell differentiation in anagen hair follicles in mice.J Invest Dermatol. 1988; 90: 65-72Abstract Full Text PDF PubMed Google Scholar;Rothnagel and Roop, 1995Rothnagel J.A. Roop D.R. Hair follicle companion layer: reacquainting an old friend.J Invest Dermatol. 1995; 104: 42S-43SCrossref PubMed Google Scholar). The IRS can be further subdivided into three subcompartments: the Henle layer, which abuts upon the companion layer, the central Huxley layer, and the cuticle as the innermost layer of the IRS (Montagna and Parakkal, 1974Montagna W. Parakkal P.F. The pilary apparatus.in: Montagna W. Parakkal P.F. The Structure and Function of Skin. Academic Press, New York, London1974: 172-251Crossref Google Scholar;Swift and Asquito, 1977Swift J.A. The histology of keratin fibers.in: Asquito R.S. Chemistry of Natural Protein Fibers. Plenum Press, New York1977: 81-146Crossref Google Scholar;Ito, 1990Ito M. The morphology and cell biology of the hair apparatus: recent advances.Acta Med Biologica. 1990; 38: 51-67Google Scholar). The hair-forming compartment dominates the center of the follicle and can be divided into the proliferative cell compartment, termed the matrix, the differentiating portions of the hair fiber, termed the cortex, and the hair cuticle, which encases both the matrix and the cortex. Occasionally, the hair-forming unit exhibits a further structure, the medulla, which is imbedded in the center of the cortex (Montagna and Parakkal, 1974Montagna W. Parakkal P.F. The pilary apparatus.in: Montagna W. Parakkal P.F. The Structure and Function of Skin. Academic Press, New York, London1974: 172-251Crossref Google Scholar;Ito, 1990Ito M. The morphology and cell biology of the hair apparatus: recent advances.Acta Med Biologica. 1990; 38: 51-67Google Scholar). The morphologic diversity of the hair follicle is partly mirrored in the keratin protein pattern obtained by gel electrophoresis of keratin extracts of plucked intact hair follicles. One-dimensional or, in particular, two-dimensional hair follicle keratin patterns are mainly composed of the epithelial keratins K5, K6, K14, K16, and K17 and, albeit weaker, the type I and type II hair keratins (Heid et al., 1986Heid H.W. Werner E. Franke W.W. The complement of native α-keratin polypeptides of hair-forming cells: a subset of eight polypeptides that differ from epithelial cytokeratins.Differentiation. 1986; 32: 101-109Crossref PubMed Scopus (145) Google Scholar,Heid et al., 1988aHeid H.W. Moll I. Franke W.W. Patterns of expression of trichocytic and epithelial cytokeratins in mammalian tissues. I. Human and bovine hair follicles.Differentiation. 1988; 37: 137-157Crossref PubMed Scopus (212) Google Scholar, Heid et al., 1988bHeid H.W. Moll I. Franke W.W. Patterns of expression of trichocytic and epithelial cytokeratins in mammalian tissues. II. Concomitant and mutually exclusive synthesis of trichocytic and epithelial cytokeratins in diverse human and bovine tissues (hair follicle, nail bed and matrix, lingual papilla, thymic reticulum).Differentiation. 1988; 37: 215-230Crossref PubMed Scopus (156) Google Scholar;Lynch et al., 1986Lynch M.H. O'Guin W.M. Hardy C. Mak L. Sun T.T. Acidic and basic hair/nail ("hard") keratins: their localization in upper cortical and cuticle cells of the human hair follicle and their relationship to "soft" keratins.J Cell Biol. 1986; 103: 2593-2606Crossref PubMed Scopus (289) Google Scholar;Stark et al., 1987Stark H.J. Breitkreuz D. Limat A. Bowden P.E. Fusenig N.E. Keratins of the human hair follicle: "hyperproliferative" keratins consistently expressed in outer root sheath cells in vivo and in vitro.Differentiation. 1987; 35: 236-248Crossref PubMed Scopus (112) Google Scholar;Coulombe et al., 1989Coulombe P.A. Kopan R. Fuchs E. Expression of keratin K14 in the epidermis and hair follicle: insights into complex programs of differentiation.J Cell Biol. 1989; 109: 2295-2312Crossref PubMed Scopus (148) Google Scholar;Kopan and Fuchs, 1989Kopan R. Fuchs E. A new look into an old problem: keratins as tools to investigate determination, morphogenesis, and differentiation.Genes Dev. 1989; 3: 1-15Crossref PubMed Scopus (117) Google Scholar;Winter et al., 1998Winter H. Langbein L. Praetzel S. et al.A novel human type II cytokeratin, K6hf, specifically expressed in the companion layer of the hair follicle.J Invest Dermatol. 1998; 111: 955-962https://doi.org/10.1046/j.1523-1747.1998.00456.xCrossref PubMed Scopus (119) Google Scholar;Langbein et al., 1999Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle.J Biol Chem. 1999; 274: 19874-19884Crossref PubMed Scopus (203) Google Scholar,Langbein et al., 2001Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. II. Expression of the six type II members in the hair follicle and the combined catalog of human type I and type II keratins.J Biol Chem. 2001; 276: 35123-35132Crossref PubMed Scopus (226) Google Scholar). Whereas the members of the hair keratin family are specifically expressed in the hair-forming compartment (Langbein et al., 1999Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle.J Biol Chem. 1999; 274: 19874-19884Crossref PubMed Scopus (203) Google Scholar,Langbein et al., 2001Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. II. Expression of the six type II members in the hair follicle and the combined catalog of human type I and type II keratins.J Biol Chem. 2001; 276: 35123-35132Crossref PubMed Scopus (226) Google Scholar), numerous investigations have shown that keratins K5 and K14 as well as K6, K16, and K17 can be attributed to the ORS (Heid et al., 1986Heid H.W. Werner E. Franke W.W. The complement of native α-keratin polypeptides of hair-forming cells: a subset of eight polypeptides that differ from epithelial cytokeratins.Differentiation. 1986; 32: 101-109Crossref PubMed Scopus (145) Google Scholar,Heid et al., 1988aHeid H.W. Moll I. Franke W.W. Patterns of expression of trichocytic and epithelial cytokeratins in mammalian tissues. I. Human and bovine hair follicles.Differentiation. 1988; 37: 137-157Crossref PubMed Scopus (212) Google Scholar;Lynch et al., 1986Lynch M.H. O'Guin W.M. Hardy C. Mak L. Sun T.T. Acidic and basic hair/nail ("hard") keratins: their localization in upper cortical and cuticle cells of the human hair follicle and their relationship to "soft" keratins.J Cell Biol. 1986; 103: 2593-2606Crossref PubMed Scopus (289) Google Scholar;Stark et al., 1987Stark H.J. Breitkreuz D. Limat A. Bowden P.E. Fusenig N.E. Keratins of the human hair follicle: "hyperproliferative" keratins consistently expressed in outer root sheath cells in vivo and in vitro.Differentiation. 1987; 35: 236-248Crossref PubMed Scopus (112) Google Scholar;Kopan and Fuchs, 1989Kopan R. Fuchs E. A new look into an old problem: keratins as tools to investigate determination, morphogenesis, and differentiation.Genes Dev. 1989; 3: 1-15Crossref PubMed Scopus (117) Google Scholar;Panteleyev et al., 1997Panteleyev A.A. Paus R. Wanner R. et al.Keratin 17 gene expression during the murine hair cycle.J Invest Dermatol. 1997; 108: 324-329Crossref PubMed Scopus (58) Google Scholar;Winter et al., 1998Winter H. Langbein L. Praetzel S. et al.A novel human type II cytokeratin, K6hf, specifically expressed in the companion layer of the hair follicle.J Invest Dermatol. 1998; 111: 955-962https://doi.org/10.1046/j.1523-1747.1998.00456.xCrossref PubMed Scopus (119) Google Scholar). Recently, a novel epithelial keratin, K6hf, which is not detectable in Coomassie stained gels of follicular keratin extracts, has been identified in the companion layer in addition to K6, K16, and K17, thus indicating that this layer is also biochemically different from the ORS and constitutes a further, independent histologic compartment of the hair follicle (Winter et al., 1998Winter H. Langbein L. Praetzel S. et al.A novel human type II cytokeratin, K6hf, specifically expressed in the companion layer of the hair follicle.J Invest Dermatol. 1998; 111: 955-962https://doi.org/10.1046/j.1523-1747.1998.00456.xCrossref PubMed Scopus (119) Google Scholar;Mahony et al., 1999Mahony D. Karunaratne S. Rothnagel J.A. The companion layer and outer root sheath of the anagen hair follicle.Exp Dermatol. 1999; 8: 329-331PubMed Google Scholar). Also earlier mostly immunohistochemical investigations have provided evidence for further expression of epithelial keratins K1, K4, K5, K6, K10, K13, K16, and K18 in the IRS (Lynch et al., 1986Lynch M.H. O'Guin W.M. Hardy C. Mak L. Sun T.T. Acidic and basic hair/nail ("hard") keratins: their localization in upper cortical and cuticle cells of the human hair follicle and their relationship to "soft" keratins.J Cell Biol. 1986; 103: 2593-2606Crossref PubMed Scopus (289) Google Scholar;Heid et al., 1988aHeid H.W. Moll I. Franke W.W. Patterns of expression of trichocytic and epithelial cytokeratins in mammalian tissues. I. Human and bovine hair follicles.Differentiation. 1988; 37: 137-157Crossref PubMed Scopus (212) Google Scholar;Kopan and Fuchs, 1989Kopan R. Fuchs E. A new look into an old problem: keratins as tools to investigate determination, morphogenesis, and differentiation.Genes Dev. 1989; 3: 1-15Crossref PubMed Scopus (117) Google Scholar;Stark et al., 1990Stark H.J. Breitkreutz D. Limat A. Ryle C.M. Roop D.R. Leigh I. Fusenig N.E. Keratins 1 and 10 or homologues as regular constituents of inner root sheath and cuticle cells in the human hair follicle.Eur J Cell Biol. 1990; 52: 359-372PubMed Google Scholar;Wilson et al., 1994Wilson C.L. Dean D. Lane B. Dawber R.P.R. Leigh I.M. Keratinocyte differentiation in psoriac scalp: morphology and expression of epithelial keratins.Br J Dermatol. 1994; 131: 191-200Crossref PubMed Scopus (52) Google Scholar;Krüger et al., 1996Krüger K. Blume-Peytavi U. Orfanos C.E. Morphological and histochemical characterization of the human vellus hair follicle.in: Van Desk D. Randall V.A. Hair Research for the Next Millennium. Elsevier, Amsterdam, New York, Tokyo1996Google Scholar;Schirren et al., 1997Schirren C.G. Burgdorf W.H.C. Sander C.A. Plewig G. Fetal and adult hair follicle. An immunohistochemical study of anticytokeratin antibodies in formalin-fixed and paraffin-embedded tissue.Am J Dermatopath. 1997; 19: 334-340Crossref Scopus (39) Google Scholar). Only recently, however, two groups have provided data for the existence of IRS-specific keratins.Bawden et al., 2001Bawden C.S. McLaughlan C. Nesci A. Rogers G. A unique type I keratin intermediate filament gene family is abundantly expressed in the inner root sheaths of sheep and human hair follicles.J Invest Dermatol. 2001; 116: 157-166Crossref PubMed Scopus (31) Google Scholar reported on the characterization of three new type I sheep keratins, oIRSa1, oIRSa2, and oIRSa3.1, as well as two human orthologs, hIRSa1 and hIRSa3.1, whose mRNAs were all expressed in the IRS of wool and hair follicles, respectively. In addition,Aoki et al., 2001Aoki N. Sawada S. Rogers M.A. et al.A novel type II cytokeratin, mK6irs, is expressed in the Huxley and Henle layers of the mouse inner root sheath.J Invest Dermatol. 2001; 116: 359-365Crossref PubMed Scopus (40) Google Scholar described a novel type II keratin, mK6irs, which proved to be expressed in the Henle and Huxley layers of the IRS of mouse hair follicles. In this report, we describe the identification and characterization of hK6irs1, 1Our laboratory has preliminary evidence for three further type II IRS keratins. Therefore, the human mK6irs ortholog was designated hK6irs1.1Our laboratory has preliminary evidence for three further type II IRS keratins. Therefore, the human mK6irs ortholog was designated hK6irs1. i.e., the human ortholog of mK6irs, and provide more detailed insights into its complex and differential expression pattern in the various subcompartments of the IRS. A DNA database homology search for the human ortholog of the mouse K6irs1 gene was performed using the mK6irs cDNA sequence for comparison (Aoki et al., 2001Aoki N. Sawada S. Rogers M.A. et al.A novel type II cytokeratin, mK6irs, is expressed in the Huxley and Henle layers of the mouse inner root sheath.J Invest Dermatol. 2001; 116: 359-365Crossref PubMed Scopus (40) Google Scholar). This led to the identification of a DNA sequence located on a partially sequenced human BAC clone AC055736, which possessed a high homology to the mK6irs sequence. A fragment from the 3′ noncoding region of the hK6irs1 gene was generated by polymerase chain reaction (PCR) [upper primer, tggctgccagctttcctcctct (nt 19525–19546); lower primer, gctagatgtgggggtggggact (nt 19708–19729)] and used for the screening of a human scalp cDNA library by methods previously described (Rogers et al., 1995Rogers M.A. Schweizer J. Krieg T. Winter H. A novel human type I hair keratin gene: Evidence for two keratin hHa3 isoforms.Mol Biol Rep. 1995; 20: 155-161Crossref Scopus (18) Google Scholar). Positive clones were identified and 20 of them were isolated and characterized. The isolated hK6irs1 cDNA clones were sequenced using a fluorescent chain termination DNA sequencing kit (Big Dye, Applied Biosystems, ABI, Weiterstadt, Germany), and analyzed on an ABI310 sequencing apparatus (ABI) using the 47 cm capillary. DNA sequence correction and assembly was performed using the STADEN software program. Genome-wide database searching was accomplished using the BLASTN program. DNA and protein homology comparisons were produced using the CLUSTAL program. All programs are contained in the Heidelberg Unix Sequence Analysis Resource (HUSAR). Both the ORS and IRS from freshly plucked beard hairs of several volunteers were mechanically removed from the hair shaft and extracted for keratins as described previously (Winter et al., 1998Winter H. Langbein L. Praetzel S. et al.A novel human type II cytokeratin, K6hf, specifically expressed in the companion layer of the hair follicle.J Invest Dermatol. 1998; 111: 955-962https://doi.org/10.1046/j.1523-1747.1998.00456.xCrossref PubMed Scopus (119) Google Scholar;Langbein et al., 1999Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle.J Biol Chem. 1999; 274: 19874-19884Crossref PubMed Scopus (203) Google Scholar). Keratin extracts were subjected to isoelectric focusing, using a mixture of pH 5–7 (0.8% wt/vol), pH 4–6 (0.8% wt/vol), and pH 3–10 (0.4% wt/vol) ampholines (Biorad, München, Germany), and subsequently resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; 10% polyacrylamide) as previously reported (Winter et al., 1998Winter H. Langbein L. Praetzel S. et al.A novel human type II cytokeratin, K6hf, specifically expressed in the companion layer of the hair follicle.J Invest Dermatol. 1998; 111: 955-962https://doi.org/10.1046/j.1523-1747.1998.00456.xCrossref PubMed Scopus (119) Google Scholar;Langbein et al., 1999Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle.J Biol Chem. 1999; 274: 19874-19884Crossref PubMed Scopus (203) Google Scholar;Aoki et al., 2001Aoki N. Sawada S. Rogers M.A. et al.A novel type II cytokeratin, mK6irs, is expressed in the Huxley and Henle layers of the mouse inner root sheath.J Invest Dermatol. 2001; 116: 359-365Crossref PubMed Scopus (40) Google Scholar). For Western blots, gels were transferred to PVDF membranes (Immobilon-P, Millipore, Eschborn, Germany) using a semidry blotting apparatus. After staining (0.1% Coomassie Blue R250, 50% methanol), destaining (50% methanol), and blocking with 5% nonfat milk powder in Tris-buffered saline, membranes were incubated with the respective primary antibodies (see Antibodies). Primary mouse monoclonal antibodies used were specific for K6 [clone KS6.KA12; Progen, Heidelberg, Germany; indirect immunofluorescence (IIF), dilution 1:100; enhanced chemiluminescence (ECL), dilution 1:2000], K14 (clone CKB1; Sigma, Deisenhofen, Germany; IIF, dilution 1:400), and hair keratin hHa2 (clone LHTric17, kindly provided by Dr. I. M. Leigh, Center for Cutaneous Research, Royal London Hospital, London, U.K.; IIF, dilution 1:50; see Langbein et al., 1999Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle.J Biol Chem. 1999; 274: 19874-19884Crossref PubMed Scopus (203) Google Scholar). Primary polyclonal antibodies generated in guinea pigs were specific for keratin hK6irs1 [this laboratory; IIF and immunoelectron microscopy (IEM), dilution 1:500–1:1000; ECL, dilution 1:2000] produced by injection of the synthetic carboxy terminal peptide (C)-GGEGRSRGSANDDYKDT of hK6irs1, to which a cysteine residue was added at its amino terminal end for coupling to Keyhole limpet protein (Peptide Specialty Laboratories, Heidelberg, Germany), K14 (this laboratory; produced by injection of the recombinant human K14 protein, kindly provided by H. Herrmann, German Cancer Research Center, Heidelberg, Germany; IIF dilution, 1:1000), and K6hf (this laboratory; IIF, IEM, dilution 1:2000;Winter et al., 1998Winter H. Langbein L. Praetzel S. et al.A novel human type II cytokeratin, K6hf, specifically expressed in the companion layer of the hair follicle.J Invest Dermatol. 1998; 111: 955-962https://doi.org/10.1046/j.1523-1747.1998.00456.xCrossref PubMed Scopus (119) Google Scholar). A rabbit antiserum specific for mK6irs was also used (IIF, dilution 1:2000;Aoki et al., 2001Aoki N. Sawada S. Rogers M.A. et al.A novel type II cytokeratin, mK6irs, is expressed in the Huxley and Henle layers of the mouse inner root sheath.J Invest Dermatol. 2001; 116: 359-365Crossref PubMed Scopus (40) Google Scholar). The secondary antibodies (IgG or IgG + IgM) used for IIF were goat anti-guineapig, antimouse or antirabbit, coupled to Alexa 568 (red fluorescence) or Alexa 488 (green fluorescence). These antibodies (Molecular Probes, Leiden, The Netherlands) were used at a dilution of 1:200. For IEM, anti-guineapig IgG or antimouse IgG + IgM, coupled to 1.4 nm colloidal gold particles (Nanogold, Biotrend, Cologne, Germany), were used at a dilution of 1:40. For chemiluminescence detection (ECL), horseradish-peroxidase-coupled rabbit antimouse or anti-guineapig IgG (H + L) (Dianova, Hamburg, Germany) were used at a dilution of 1:10,000. After a brief rinse in phosphate-buffered saline (PBS), cryostat sections of human scalp or plucked beard hairs were fixed in methanol (-20°C; 5 min). The sections were subsequently permeabilized with 0.1% Triton-X 100 for 5 min and blocked with 5% normal goat serum in PBST (0.001% Triton-X100, PBS). The primary antibodies were applied for 1 h, followed by three rinses in PBS (5 min each). After 30 min of incubation with antibodies and washing in PBS, sections were rinsed in ethanol, dried, and mounted in fluoromount-G (Southern Biotechnology Associates, Birmingham, AL). Visualization and documentation were performed with a photomicroscope (Axiophot II; Carl Zeiss, Jena/Oberkochen, Germany). For confocal laser scanning microscopy, a Zeiss LSM 510 UV microscope (Carl Zeiss) operating with an argon ion laser (488 nm) and a HeNe laser (543 nm) was used. For conventional electron microscopy, plucked hair follicles were briefly rinsed with PBS and fixed in 2.5% glutaraldehyde in sodium cacodylate buffer (pH 7.2) for 30 min. After three 5 min rinses in sodium cacodylate buffer, they were postfixed in 2% OsO4 for 2 h on ice, followed by washes with distilled water. The specimens were then block-stained overnight in 0.5% uranyl acetate in water, and dehydrated in an ethanol series and propylene oxide followed by embedding in epon. For pre-embedding immunoelectron microscopy, cryostat sections were fixed with 2% formaldehyde in PBS for 5 min. After treatment with 50 mM NH4Cl, fixed sections were permeabilized with PBS containing 0.1% Triton X-100 for 2 min and treated with primary antibodies for at least 2 h. After washing in PBS, the secondary antibodies were applied overnight. After washing with PBS, secondary fixation was done with 2.5% glutaraldehyde, washed with PBS, and subjected to silver enhancement (Biotrend) for approximately 10 min. Washing with PBS, treatment of sections with an aqueous solution of 0.2% OsO4, dehydration, and embedding have been described elsewhere (Rose et al., 1995Rose O. Grund C. Reinhardt S. Starzinski-Powitz A. Franke W.W. Contactus adherens, a special type of plaque-bearing adhering junction containing M-cadherin, in the granule cell layer of the cerebellar glomerulus.Proc Natl Acad Sci USA. 1995; 92: 6022-6026Crossref PubMed Scopus (78) Google Scholar). Micrographs were taken with an electron microscope EM900 (LEO, Oberkochen, Germany). ISH on cryostat sections of human scalp (taken for medical reasons and kindly provided by Dr. B. Cribier, Dermatological Hospital, Strasbourg, France) or plucked beard hairs was carried out as described previously in detail (Langbein et al., 1994Langbein L. Heid H.W. Moll I. Franke W.W. Molecular characterization of the body site-specific human epidermal cytokeratin 9: cDNA cloning, amino acid sequence, and tissue specificity of gene expression.Differentiation. 1994; 55: 57-71Crossref Scopus (102) Google Scholar;Langbein et al., 1999Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle.J Biol Chem. 1999; 274: 19874-19884Crossref PubMed Scopus (203) Google Scholar;Winter et al., 1998Winter H. Langbein L. Praetzel S. et al.A novel human type II cytokeratin, K6hf, specifically expressed in the companion layer of the hair follicle.J Invest Dermatol. 1998; 111: 955-962https://doi.org/10.1046/j.1523-1747.1998.00456.xCrossref PubMed Scopus (119) Google Scholar). For ISH, the following probes were used: a 183 bp PCR fragment of the 3′ noncoding region of the hK6irs1 gene cloned into the plasmid pCR2.1 and a 3′ fragment of the hHa2 gene cloned into Bluescript II KS (Rogers et al., 1997Rogers M.A. Langbein L. Prätzel S. Moll I. Krieg T. Winter H. Schweizer J. Sequences and differential of expression of three novel human type II hair keratins.Differentiation. 1997; 61: 187-194https://doi.org/10.1007/s002580050184Crossref PubMed Scopus (0) Google Scholar;Langbein et al., 1999Langbein L. Rogers M.A. Winter H. Praetzel S. Beckhaus U. Rackwitz H.R. Schweizer J. The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle.J Biol Chem. 1999; 274: 19874-19884Crossref PubMed Scopus (203) Google Scholar). Using these plasmids, 35S-radiolabeled hK6irs1- or hHa2-cRNA probes were generated by in vitro transcription. Both probes were used separately or, in the case of double labeling, mixed in equal amounts prior to overnight hybridization at 42°C. Sections were washed with 2 × sodium citrate/chloride buffer (SSC)/50% formamide/20 mM dithiothreitol (DTT), 1 × SSC/50% formamide/20 mM DTT, and 1 × SSC/50% formamide/0.1% SDS at 50°C for 30 min each, digested with RNaseA (10 mg per ml, 30 min at 37°C), and then washed with 0.5 × SSC/50% formamide/20 mM DTT at 50°C. Sections were dehydrated in an ethanol series and dried. To estimate the appropriate time of exposure, sections were covered with an X-ray film (X-OMAT, Kodak, Rochester) and exposed overnight. After dipping in photoemulsion (NTB-2; Kodak) and drying, sections were mostly exposed for 2–3 d, stained with hematoxylin, and embedded in fluoromount. For the recording of the ISH signals by reflection microscopy, the confocal laser scanning microscope LSM 510 was used. This microscope allows simultaneous visualization of ISH in epi-illumination for the detection of reflection signals and transmitted light in bright field for hematoxylin staining. The two signal channels were combined by an overlay in pseudocolor (transmission image in green, electronically changed into black/white using the ZEISS-LSMib software; reflection image, i.e., ISH signals, in red). The accession numbers for K6irs1 as well as the amino-terminal- and carboxy-terminal-truncated cDNAs are AJ308599, AJ308600, and AJ308601, respectively. Homology searching of the EMBO/Genebank database using the entire mK6irs cDNA for comparison led to the identification of the orthologous human gene on a BAC clone designated AC055736. This 151 kb clone has been recently sequenced to completion by the human genome consortium. The hK6irs1 gene occurred on one end of this clone (nt 10671–19882) and its nine exons covered about 9.2 kb of DNA (Figure 1). Five further, previously described keratin genes/pseudogenes K5, K6a, K6b, K6hf, ϕhHbA (Boni
Referência(s)