Regulated Nucleocytoplasmic Transport of Protein Kinase D in Response to G Protein-coupled Receptor Activation
2001; Elsevier BV; Volume: 276; Issue: 52 Linguagem: Inglês
10.1074/jbc.m109395200
ISSN1083-351X
AutoresOsvaldo Rey, James Sinnett‐Smith, Елена Жукова, Enrique Rozengurt,
Tópico(s)Cell death mechanisms and regulation
ResumoProtein kinase D (PKD)/protein kinase Cμ is a serine/threonine protein kinase activated by growth factors, antigen-receptor engagement, and G protein-coupled receptor (GPCR) agonists via a phosphorylation-dependent mechanism that requires protein kinase C (PKC) activity. In order to investigate the dynamic mechanisms associated with GPCR signaling, the intracellular distribution of PKD was analyzed in live cells by imaging fluorescent protein-tagged PKD and in fixed cells by immunocytochemistry. We found that PKD shuttled between the cytoplasm and the nucleus in both fibroblasts and epithelial cells. Cell stimulation with mitogenic GPCR agonists that activate PKD induced a transient nuclear accumulation of PKD that was prevented by inhibiting PKC activity. The nuclear import of PKD requires its cys2 domain in conjunction with a nuclear import receptor, while its nuclear export requires its pleckstrin homology domain and a competent Crm1-dependent nuclear export pathway. This study thus characterizes the regulated nuclear transport of a signaling molecule in response to mitogenic GPCR agonists and positions PKD as a serine kinase whose kinase activity and intracellular localization is coordinated by PKC. Protein kinase D (PKD)/protein kinase Cμ is a serine/threonine protein kinase activated by growth factors, antigen-receptor engagement, and G protein-coupled receptor (GPCR) agonists via a phosphorylation-dependent mechanism that requires protein kinase C (PKC) activity. In order to investigate the dynamic mechanisms associated with GPCR signaling, the intracellular distribution of PKD was analyzed in live cells by imaging fluorescent protein-tagged PKD and in fixed cells by immunocytochemistry. We found that PKD shuttled between the cytoplasm and the nucleus in both fibroblasts and epithelial cells. Cell stimulation with mitogenic GPCR agonists that activate PKD induced a transient nuclear accumulation of PKD that was prevented by inhibiting PKC activity. The nuclear import of PKD requires its cys2 domain in conjunction with a nuclear import receptor, while its nuclear export requires its pleckstrin homology domain and a competent Crm1-dependent nuclear export pathway. This study thus characterizes the regulated nuclear transport of a signaling molecule in response to mitogenic GPCR agonists and positions PKD as a serine kinase whose kinase activity and intracellular localization is coordinated by PKC. protein kinase D cysteine-rich domain diacylglycerol G protein-coupled receptor green fluorescent protein laser-scanning confocal microscope leptomycin B nuclear localization signal(s) nuclear export signal pleckstrin homology protein kinase C red fluorescent protein Madin-Darby canine kidney Protein kinase D (PKD)1/protein kinase Cμ is a serine/threonine protein kinase with structural, enzymological, and regulatory properties different from other protein kinase C (PKC) family members (1Valverde A.M. Sinnett-Smith J. Van Lint J. Rozengurt E. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8572-8576Crossref PubMed Scopus (361) Google Scholar, 2Johannes F.J. Prestle J. Eis S. Oberhagemann P. Pfizenmaier K. J. Biol. Chem. 1994; 269: 6140-6148Abstract Full Text PDF PubMed Google Scholar). The salient features of PKD structure include the presence of a catalytic domain distantly related to Ca2+-regulated kinases, a pleckstrin homology (PH) domain that regulates PKD activity, and a highly hydrophobic stretch of amino acids in its N-terminal region (1Valverde A.M. Sinnett-Smith J. Van Lint J. Rozengurt E. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8572-8576Crossref PubMed Scopus (361) Google Scholar, 2Johannes F.J. Prestle J. Eis S. Oberhagemann P. Pfizenmaier K. J. Biol. Chem. 1994; 269: 6140-6148Abstract Full Text PDF PubMed Google Scholar, 3Waldron R.T. Iglesias T. Rozengurt E. J. Biol. Chem. 1999; 274: 9224-9230Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 4Iglesias T. Rozengurt E. J. Biol. Chem. 1998; 273: 410-416Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). The N-terminal region of PKD contains, in addition to the PH domain, a cysteine-rich domain (CRD) that confers high affinity binding to phorbol esters (5Rozengurt E. Sinnett-Smith J. Zugaza J.L. Biochem. Soc. Trans. 1997; 25: 565-571Crossref PubMed Scopus (60) Google Scholar, 6Iglesias T. Rozengurt E. FEBS Lett. 1999; 454: 53-56Crossref PubMed Scopus (45) Google Scholar, 7Iglesias T. Matthews S. Rozengurt E. FEBS Lett. 1998; 437: 19-23Crossref PubMed Scopus (60) Google Scholar). The recent identification of additional cDNA clones, similar in overall structure, primary amino acid sequence, and enzymological properties to PKD (8Sturany S. Van Lint J. Muller F. Wilda M. Hameister H. Hocker M. Brey A. Gern U. Vandenheede J. Gress T. Adler G. Seufferlein T. J. Biol. Chem. 2001; 276: 3310-3318Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 9Hayashi A. Seki N. Hattori A. Kozuma S. Saito T. Biochim. Biophys. Acta. 1999; 1450: 99-106Crossref PubMed Scopus (174) Google Scholar), supports the notion that PKD isoenzymes constitute a separate family of serine protein kinases. PKD can be activated in intact cells by pharmacological agents including biologically active phorbol esters and cell-permeant diacylglycerol (DAG) as well as by physiological stimuli including G protein-coupled receptors (GPCR) agonists, growth factors, and antigen-receptor engagement (10Zugaza J.L. Sinnett-Smith J. Van Lint J. Rozengurt E. EMBO J. 1996; 15: 6220-6230Crossref PubMed Scopus (221) Google Scholar, 11Zugaza J.L. Waldron R.T. Sinnett-Smith J. Rozengurt E. J. Biol. Chem. 1997; 272: 23952-23960Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 12Abedi H. Rozengurt E. Zachary I. FEBS Lett. 1998; 427: 209-212Crossref PubMed Scopus (52) Google Scholar, 13Paolucci L. Rozengurt E. Cancer Res. 1999; 59: 572-577PubMed Google Scholar, 14Matthews S. Iglesias T. Cantrell D. Rozengurt E. FEBS Lett. 1999; 457: 515-521Crossref PubMed Scopus (70) Google Scholar, 15Van Lint J.V. Sinnett-Smith J. Rozengurt E. J. Biol. Chem. 1995; 270: 1455-1461Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 16Van Lint J. Ni Y. Valius M. Merlevede W. Vandenheede J.R. J. Biol. Chem. 1998; 273: 7038-7043Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 17Matthews S.A. Pettit G.R. Rozengurt E. J. Biol. Chem. 1997; 272: 20245-20250Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 18Sidorenko S.P. Law C.L. Klaus S.J. Chandran K.A. Takata M. Kurosaki T. Clark E.A. Immunity. 1996; 5: 353-363Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). In all cases, PKD activation has been shown to be mediated by a PKC-dependent signal transduction pathway that involves the phosphorylation of Ser744 and Ser748 within the activation loop of the catalytic domain of PKD (19Iglesias T. Waldron R.T. Rozengurt E. J. Biol. Chem. 1998; 273: 27662-27667Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 20Waldron R. Rey O. Iglesis T. Tugal T. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32606-32615Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). These findings revealed a link between PKC and PKD in a novel signal transduction pathway activated by multiple growth-promoting factors (5Rozengurt E. Sinnett-Smith J. Zugaza J.L. Biochem. Soc. Trans. 1997; 25: 565-571Crossref PubMed Scopus (60) Google Scholar, 21Waldron R.T. Iglesias T. Rozengurt E. Electrophoresis. 1999; 20: 382-390Crossref PubMed Scopus (58) Google Scholar). PKD has been localized in the cytosol and in several intracellular compartments including Golgi, plasma membrane, and mitochondria (14Matthews S. Iglesias T. Cantrell D. Rozengurt E. FEBS Lett. 1999; 457: 515-521Crossref PubMed Scopus (70) Google Scholar,22Storz P. Hausser A. Link G. Dedio J. Ghebrehiwet B. Pfizenmaier K. Johannes F.J. J. Biol. Chem. 2000; 275: 24601-24607Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 23Prestle J. Pfizenmaier K. Brenner J. Johannes F.J. J. Cell Biol. 1996; 134: 1401-1410Crossref PubMed Scopus (100) Google Scholar, 24Matthews S.A. Iglesias T. Rozengurt E. Cantrell D. EMBO J. 2000; 19: 2935-2945Crossref PubMed Scopus (114) Google Scholar, 25Rey O. Rozengurt E. Biochem. Biophys. Res. Commun. 2001; 287: 21-26Crossref PubMed Scopus (28) Google Scholar). In addition, we recently found that bombesin, a mitogenic GPCR agonist, induced a rapid and reversible plasma membrane translocation of PKD by a mechanism that requires its catalytic domain and PKC activity (26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). PKD has been implicated in the regulation of a variety of cellular functions including Golgi organization and function (27Liljedahl M. Maeda Y. Colanzi A. Ayala I. Van Lint J. Malhotra V. Cell. 2001; 104: 409-420Abstract Full Text Full Text PDF PubMed Scopus (311) Google Scholar,28Jamora C. Yamanouye N. Van Lint J. Laudenslager J. Vandenheede J.R. Faulkner D.J. Malhotra V. Cell. 1999; 98: 59-68Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar), epidermal growth factor receptor and c-Jun signaling (29Hurd C. Rozengurt E. Biochem. Biophys. Res. Commun. 2001; 282: 404-408Crossref PubMed Scopus (32) Google Scholar, 30Bagowski C.P. Stein-Gerlach M. Choidas A. Ullrich A. EMBO J. 1999; 18: 5567-5576Crossref PubMed Scopus (78) Google Scholar), NF-κB-mediated gene expression (31Johannes F.J. Horn J. Link G. Haas E. Siemienski K. Wajant H. Pfizenmaier K. Eur. J. Biochem. 1998; 257: 47-54Crossref PubMed Scopus (64) Google Scholar), cell migration (32Bowden E.T. Barth M. Thomas D. Glazer R.I. Mueller S.C. Oncogene. 1999; 18: 4440-4449Crossref PubMed Scopus (308) Google Scholar), and DNA synthesis and cell proliferation (33Zhukova E. Sinnett-Smith J. Rozengurt E. J. Biol. Chem. 2001; 276: 40298-40305Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). The role of PKD redistribution in the regulation of these cellular and molecular responses remains poorly understood. In this study, we examined the distribution of PKD using immunocytochemistry and visualization of fluorescence-tagged PKD in dividing and G0-arrested (quiescent) Swiss 3T3 cells. We found that PKD shuttles between the cytoplasm and the nucleus in proliferating cells. Mitogenic GPCR agonist stimulation of quiescent Swiss 3T3 cells induced a transient nuclear accumulation of PKD that could be blocked by inhibiting PKC activity. These findings identified the nuclei as a compartment targeted by PKD and provides evidence for a novel mechanism where the activation and intracellular distribution of PKD is coordinated by PKC. Vectors encoding chimeric fusion proteins between green (GFP) or red (RFP) fluorescent protein and wild type PKD or the mutants PKDΔPH, PKDΔCRD, PKDP287G, CRD, PKDΔCys1, and PKDΔCys2 were previously described (15Van Lint J.V. Sinnett-Smith J. Rozengurt E. J. Biol. Chem. 1995; 270: 1455-1461Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 24Matthews S.A. Iglesias T. Rozengurt E. Cantrell D. EMBO J. 2000; 19: 2935-2945Crossref PubMed Scopus (114) Google Scholar, 25Rey O. Rozengurt E. Biochem. Biophys. Res. Commun. 2001; 287: 21-26Crossref PubMed Scopus (28) Google Scholar, 26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). The pPKD-ΔPH-RFP vector was generated by subcloning anEcoRI/SpeI fragment isolated from pGFP-PKD-ΔPH into pPKD-RFP (26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar) previously digested withEcoRI/SpeI. The pGFP-PKDΔ1–4β and pGFP-PKDΔα vectors were constructed by subcloning theEcoRI cDNA fragment isolated from pcDNA3-PKDΔ1–4β and pcDNA3-PKDΔα (4Iglesias T. Rozengurt E. J. Biol. Chem. 1998; 273: 410-416Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar) into the expression vector pEF-plink2-GFPC3 (14Matthews S. Iglesias T. Cantrell D. Rozengurt E. FEBS Lett. 1999; 457: 515-521Crossref PubMed Scopus (70) Google Scholar) previously digested with EcoRI. The pGFP-PKD-L478A/L480A was generated by PCR site-directed mutagenesis employing an EcoRI fragment isolated from pcDNA3-PKD (15Van Lint J.V. Sinnett-Smith J. Rozengurt E. J. Biol. Chem. 1995; 270: 1455-1461Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar) as template, the set of primers AGGTTTTGCTGGTTCCGCACATGCTATTTCTGATAAAGG and GCGTCAAGGCCTTAAATGTG, and Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA). The PCR product was digested withStuI/HpaI, purified, and subcloned into pGPKD (26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar) previously digested with StuI/HpaI. AnEcoRI fragment containing the complete cDNA PKD sequence was isolated from the resulting vector pGPKD-L478A/L480A and subcloned into the expression vector pEF-plink2-GFPC3 (14Matthews S. Iglesias T. Cantrell D. Rozengurt E. FEBS Lett. 1999; 457: 515-521Crossref PubMed Scopus (70) Google Scholar) previously digested with EcoRI to generate pGFP-PKD-L478A/L480A. All of the constructs generated were confirmed by DNA sequence analysis, and the products of expression were analyzed by Western blot using antibodies against RFP, GFP, or PKD/PKCμ. A schematic representation of all of the employed constructs is shown in Fig. 1. Earlier we demonstrated that the fusion of GFP tag to the N terminus of PKD did not produce any detectable effect on its basal catalytic activity, phorbol ester binding, or bombesin-mediated PKD activation (14Matthews S. Iglesias T. Cantrell D. Rozengurt E. FEBS Lett. 1999; 457: 515-521Crossref PubMed Scopus (70) Google Scholar, 20Waldron R. Rey O. Iglesis T. Tugal T. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32606-32615Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 24Matthews S.A. Iglesias T. Rozengurt E. Cantrell D. EMBO J. 2000; 19: 2935-2945Crossref PubMed Scopus (114) Google Scholar, 26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). In addition, the inherent fluorescence of GFP allowed us to visualize the localization of GFP-PKD in live cells (14Matthews S. Iglesias T. Cantrell D. Rozengurt E. FEBS Lett. 1999; 457: 515-521Crossref PubMed Scopus (70) Google Scholar). Stock cultures of Swiss 3T3 and Madin-Darby canine kidney cells (MDCK) were maintained at 37 °C in Dulbecco's modified Eagle's medium, supplemented with 10% fetal bovine serum in a humidified atmosphere containing 10% CO2and 90% air. For live cell analysis, cells were plated onto 15-mm number 1 round glass coverslips inside 33-mm dishes at 7 × 104 cells/dish and transfected 18–20 h later. Cells were transfected with 1 μg of DNA/33-mm dish using LipofectAMINE PLUS (Life Technologies, Inc.) according to the manufacturer's suggested conditions. For immunocytochemistry, the cells were plated in 33-mm dishes at 7 × 104 cells/dish or in Lab-Tek chamber slides (Nalge Nunc International, Naperville, IL) (3.5 × 104 cells/well) and transfected as indicated above with 1 μg of DNA/dish or 0.5 μg of DNA/well, respectively. Transfected cells were incubated for 18–20 h before agonist analysis. Cotransfection experiments were done using 1 μg of pGFP-CRD DNA and 100 ng of PKD-RFP DNA per 33-mm dish. The Swiss 3T3-PKD.GFP cell line was established by infecting Swiss 3T3 cells with a retrovirus encoding PKD and GFP as two separated proteins but under the control of the same promoter (33Zhukova E. Sinnett-Smith J. Rozengurt E. J. Biol. Chem. 2001; 276: 40298-40305Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Cells were collected and sorted by fluorescence-activated cell sorting to select the GFP-positive ones. The GFP-positive cells were propagated, and multiple aliquots were frozen. A fresh batch of cells was restarted every 2 months. Cells were maintained at 37 °C in Dulbecco's modified Eagle's medium, supplemented with 10% fetal bovine serum in a humidified atmosphere containing 10% CO2 and 90% air. Imaging of live cells expressing fluorescence-tagged proteins and immunocytochemistry of fixed cells using a rabbit polyclonal anti-PKD/PKCμ (C20), which recognizes an epitope mapping at the C terminus of PKD, were performed as previously described (25Rey O. Rozengurt E. Biochem. Biophys. Res. Commun. 2001; 287: 21-26Crossref PubMed Scopus (28) Google Scholar, 26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). For the experiments employing immunocytochemistry or imaging of live cells expressing GFP- or RFP-tagged proteins, 50 cells were analyzed per experiment, and each experiment was performed at least in triplicate. The cells displayed in the appropriate figures were representative of 90% of the population of transfected cells. Quantitative analysis of the cytoplasmic and nuclear fluorescence intensity was performed on images of the midsection of fixed and immunostained cells that were obtained with a Leica TCS-SP upright laser-scanning confocal microscope (LSCM) (26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Quantification was performed on a Macintosh PowerBook G4 computer using the public domain NIH Image program (developed at the National Institutes of Health and available on the Internet at rsb.info.nih.gov/nih-image/). Nuclear fluorescence intensity (N) was calculated as a percentage of the total cellular fluorescence intensity (C): (N/(N + C)). Each data point represents the mean intensity fluorescence obtained from 20 randomly chosen cells unless otherwise indicated. Error is expressed as S.D. The anti-PKD/PKCμ (clone C20) antibody, its corresponding blocking peptide sc-639P, and anti-GFP antibody were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Ro 81–3220 was obtained from Calbiochem. Bombesin, vasopressin, GF 109203X, and 4′,6-diamidino-2-phenylindole were obtained from Sigma. Texas Red-conjugated goat-anti rabbit immunoglobulins were obtained from Molecular Probes, Inc. (Eugene, OR). The plasmid pEGFP-Actin and the anti-RFP antibody were obtained from CLONTECH Laboratories, Inc. (Palo Alto, CA). Leptomycin B was a generous gift from Dr. Minoru Yoshida (Department of Biotechnology, University of Tokyo). All of the other reagents were the highest grade commercially available. We previously found that the deletion of the PH domain of PKD induced the nuclear accumulation of this GFP-tagged protein in lymphocytes, fibroblasts, and epithelial cells (24Matthews S.A. Iglesias T. Rozengurt E. Cantrell D. EMBO J. 2000; 19: 2935-2945Crossref PubMed Scopus (114) Google Scholar, 26Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). In order to substantiate this observation, Swiss 3T3 fibroblasts, a model system extensively used to elucidate signaling by endogenously expressed GPCRs (34Rozengurt E. Science. 1986; 234: 161-166Crossref PubMed Scopus (852) Google Scholar), were transiently transfected with wild type and mutant PKDs fused to GFP (Fig. 1) and examined 18 h later with an LSCM. In agreement with our recent results, we found that GFP-PKD and the majority of the PKD fusion mutant proteins expressed in Swiss 3T3 cells were distributed throughout the cytosol (Fig.2). Some cells showed a more pronounced signal at the perinuclear area, consistent with the partial localization of PKD to the Golgi compartment, as we and others described previously (23Prestle J. Pfizenmaier K. Brenner J. Johannes F.J. J. Cell Biol. 1996; 134: 1401-1410Crossref PubMed Scopus (100) Google Scholar, 25Rey O. Rozengurt E. Biochem. Biophys. Res. Commun. 2001; 287: 21-26Crossref PubMed Scopus (28) Google Scholar, 27Liljedahl M. Maeda Y. Colanzi A. Ayala I. Van Lint J. Malhotra V. Cell. 2001; 104: 409-420Abstract Full Text Full Text PDF PubMed Scopus (311) Google Scholar, 28Jamora C. Yamanouye N. Van Lint J. Laudenslager J. Vandenheede J.R. Faulkner D.J. Malhotra V. Cell. 1999; 98: 59-68Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar). No fluorescence or very little fluorescence was detected in the nuclei of these cells. However, we found that cells expressing GFP-PKD-ΔPH showed a dramatic nuclear accumulation of this protein (Fig. 2). The same distribution was detected with another chimeric protein between RFP from Discosoma sp. fused to the C terminus of PKD-ΔPH in Swiss 3T3 cells (PKD-ΔPH-RFP) (data not shown). The molecular mass of GFP-PKD-ΔPH or PKD-ΔPH-RFP (∼125 kDa) far exceeds the size limit for passive nuclear diffusion (60 kDa) (35Gerace L. Cell. 1995; 82: 341-344Abstract Full Text PDF PubMed Scopus (215) Google Scholar, 36Görlich D. Mattaj I.W. Science. 1996; 271: 1513-1518Crossref PubMed Scopus (1067) Google Scholar, 37Dingwall C. Laskey R.A. Annu. Rev. Cell Biol. 1986; 2: 367-390Crossref PubMed Scopus (337) Google Scholar, 38Cyert M.S. J. Biol. Chem. 2001; 276: 20805-20808Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar), suggesting that the deletion of the PH domain of PKD could promote its nuclear localization by unmasking a normally silent nuclear localization signal (NLS). Alternatively, the deletion of the PH domain could prevent the nuclear export of PKD and cause its nuclear accumulation. If this second interpretation is correct, interference with the nuclear export machinery should also cause the nuclear accumulation of PKD. Leptomycin B (LMB) is an antifungal antibiotic (39Hamamoto T. Gunji S. Tsuji H. Beppu T. J. Antibiot. 1983; 36: 639-645Crossref PubMed Scopus (136) Google Scholar) that inhibits the formation of complexes consisting of Crm1, RanGTP, and proteins containing a leucine-rich nuclear export signal (NES), thereby blocking nuclear export (40Fornerod M. Ohno M. Yoshida M. Mattaj I.W. Cell. 1997; 90: 1051-1060Abstract Full Text Full Text PDF PubMed Scopus (1744) Google Scholar, 41Ossareh-Nazari B. Bachelerie F. Dargemont C. Science. 1997; 278: 141-144Crossref PubMed Scopus (623) Google Scholar, 42Ullman K.S. Powers M.A. Forbes D.J. Cell. 1997; 90: 967-970Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 43Wolff B. Sanglier J.J. Wang Y. Chem. Biol. 1997; 4: 139-147Abstract Full Text PDF PubMed Scopus (577) Google Scholar). In order to test whether LMB had any effect on the cellular distribution of PKD, Swiss 3T3 cells transiently transfected with GFP-PKD were incubated with LMB (10 ng/ml) for 1 h, and the distribution of GFP-PKD was analyzed by imaging live cells with a LSCM. As shown in Fig. 2, GFP-PKD accumulated in the nuclei of Swiss 3T3 cells incubated with LMB. In contrast, LMB had no effect on the nuclear accumulation of GFP-PKD-ΔPH (Fig. 2). In order to determine whether the nucleocytoplasmic transport of PKD is restricted to Swiss 3T3 fibroblasts, we also analyzed the nuclear transport of GFP-PKD in MDCK epithelial cells transfected with pGFP-PKD. MDCK cells are one of the best studied epithelial cell model systems (44Celis J.E. Cell Biology: A Laboratory Handbook. Academic Press, Inc., San Diego1994: 79-95Google Scholar). As shown in Fig. 2, GFP-PKD also accumulated in the nuclei of proliferating MDCK cells incubated with LMB, indicating that the nuclear transport of PKD was not restricted to fibroblasts. GFP-PKD expression or LMB incubation up to 3 h had no effect on the morphology of Swiss 3T3 or MDCK cells (data not shown). The nuclear accumulation of PKD was not due to the fluorescent tag or protein overexpression as revealed by immunocytochemistry of nontagged PKD. Exogenous nontagged (exPKD) expressed by transient transfection and endogenous PKD (enPKD) accumulated in the nuclei of dividing Swiss 3T3 incubated with LMB (Fig. 2). The localization of endogenous PKD in the cells treated with LMB corresponded to the nuclear compartment as revealed by 4′,6-diamidino-2-phenylindole (DAPI) costaining of those cells (Fig. 2). Inclusion of the immunizing peptide encompassing the C terminus of PKD completely prevented the staining of the endogenous PKD (data not shown). To rule out any effect of the fluorescent tag on the nuclear transport of PKD, we analyzed the intracellular distribution of GFP-tagged actin in Swiss 3T3 in the presence of LMB. GFP-actin was detected in the cytoplasm of either LMB-treated or -untreated cells as a diffuse immunofluorescent signal (G-actin) or associated with microfilaments (F-actin). LMB did not induce any detectable nuclear accumulation of GFP-actin. The results in Fig. 2 demonstrate that PKD shuttles between the cytoplasm and nuclei and that the nuclear export of PKD can be prevented by blocking the Crm1-dependent nuclear export pathway with LMB. In order to identify the domain(s) of PKD responsible for its nuclear import and export, different GFP-tagged PKD mutants were expressed transiently in Swiss 3T3 cells, and the distribution of these molecules was monitored with an epifluorescence microscope in live cells incubated with or without LMB. Nuclear accumulation of any mutated PKD, in the absence of LMB, would indicate a defect in its nuclear export. Conversely, lack of nuclear accumulation of any mutated PKD in the presence of LMB would indicate a defect in its nuclear import. As showed in Fig. 2, deletion of the complete PH domain of PKD caused the nuclear accumulation of GFP-PKD-ΔPH in the absence of LMB, suggesting that this domain was involved in the nuclear export but not the import of PKD. Further support for this conclusion was obtained by analyzing the intracellular distribution of two different PH domain mutant proteins in Swiss 3T3 cells. The first one, GFP-PKDΔ1–4β, lacks the four β-sheets of the β-barrel of the PH domain encompassing amino acids 429–474, whereas the second one, GFP-PKDΔα, lacks the carboxyl-terminal α-helix encompassing amino acids 535–557. We found that both mutant proteins accumulated in the nuclei of Swiss 3T3 cells in the absence of LMB (Fig.3). Since both mutations target different regions of the PH domain and they involve different size deletions (45 and 22 amino acid residues in GFP-PKDΔ1–4β and GFP-PKDΔα, respectively) our results suggested that the integrity of this domain, rather than a particular signal, was critical for the nuclear export of PKD. We obtained further support for this conclusion by mutating a stretch of amino acids similar to a leucine-rich NES in the PH domain of PKD (amino acids 474–480). Similar mutations within the NES in other proteins abrogate the NES function (45Fischer U. Huber J. Boelens W.C. Mattaj I.W. Lührmann R. Cell. 1995; 82: 475-483Abstract Full Text PDF PubMed Scopus (988) Google Scholar, 46Wen W. Meinkoth J.L. Tsien R.Y. Taylor S.S. Cell. 1995; 82: 463-473Abstract Full Text PDF PubMed Scopus (1006) Google Scholar, 47Fukuda M. Gotoh I. Gotoh Y. Nishida E. J. Biol. Chem. 1996; 271: 20024-20028Abstract Full Text Full Text PDF PubMed Scopus (292) Google Scholar, 48Toyoshima F. Moriguchi T. Wada A. Fukuda M. Nishida E. EMBO J. 1998; 17: 2728-2735Crossref PubMed Scopus (281) Google Scholar, 49Yamaga M. Fujii M. Kamata H. Hirata H. Yagisawa H. J. Biol. Chem. 1999; 274: 28537-28541Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). The simultaneous mutation to alanine of the leucine residues 478 and 480 within the putative NES in the PH domain of PKD did not prevent the nuclear export of GFP-PKD-L478A/L480A (data not shown), confirming that the integrity of the PH domain is critical for the nuclear export of PKD. Our results also implied that the nuclear export of PKD may occur via interaction, very likely mediated by its PH domain, with an adaptor protein(s) that is exported from the nucleus by a Crm1-dependent nuclear export pathway. The N-terminal regulatory region of PKD, in addition to its PH domain, contains a phorbol ester/DAG-binding CRD (1Valverde A.M. Sinnett-Smith J. Van Lint J. Rozengurt E. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8572-8576Crossref PubMed Scopus (361) Google Scholar). We identified within the CRD of PKD a region encompassing amino acid residues 184–201 with homology to known classical bipartite NLS (50Dingwall C. Laskey R.A. Trends Biochem. Sci. 1991; 16: 478-481Abstract Full Text PDF PubMed Scopus (1713) Google Scholar) that could be involved in the nuclear import of PKD. Consequently, we analyzed the intracellular distribution of another set of GFP-tagged PKD proteins with mutations in the CRD of PKD (see Fig. 1). The GFP-PKD-ΔCRD mutant contains a deletion of the entire CRD domain (encompassing amino acid residues 145–353), while the GFP-PKD-P287G mutant contains a proline to glycine substitution within the second cysteine-rich motif of the CRD. While the CRD deletion prevented the binding of phorbol esters/DAG to PKD, the P287G mutation significantly diminished it (7Iglesias T. Matthews S. Rozengurt E. FEBS Lett. 1998; 437: 19-23Crossref PubMed Scopus (60) Google Scholar). As shown in Fig. 4, GFP-PKD-P287G was imported into the nuclei to the same extent as wild type PKD as revealed by its accumulation in the presence of LMB. Contrary to GFP-PKD-P287G, GFP-PKD-ΔCRD was excluded from the nuclei despite the presence of LMB (Fig. 4), suggesting that the nuclear import of PKD depends on its CRD but very unlikely on phorbol ester/DAG binding. The CRD of PKD contains a tandem repeat of cysteine-rich zinc finger-like motifs, termed cys1 and cys2, that are not functionally equi
Referência(s)