Improved Pharmacokinetics of Recombinant Bispecific Antibody Molecules by Fusion to Human Serum Albumin
2007; Elsevier BV; Volume: 282; Issue: 17 Linguagem: Inglês
10.1074/jbc.m700820200
ISSN1083-351X
AutoresDafne Müller, Anette Karle, Bettina Meißburger, Ines Höfig, Roland Stork, Roland E. Kontermann,
Tópico(s)Protein Interaction Studies and Fluorescence Analysis
ResumoRecombinant bispecific antibodies such as tandem scFv molecules (taFv), diabodies (Db), or single chain diabodies (scDb) have shown to be able to retarget T lymphocytes to tumor cells, leading to their destruction. However, therapeutic efficacy is hampered by a short serum half-life of these small molecules having molecule masses of 50–60 kDa. Thus, improvement of the pharmacokinetic properties of small bispecific antibody formats is required to enhance efficacy in vivo. In this study, we generated several recombinant bispecific antibody-albumin fusion proteins and analyzed these molecules for biological activity and pharmacokinetic properties. Three recombinant antibody formats were produced by fusing two different scFv molecules, bispecific scDb or taFv molecules, respectively, to human serum albumin (HSA). These constructs (scFv2-HSA, scDb-HSA, taFv-HSA), directed against the tumor antigen carcinoembryonic antigen (CEA) and the T cell receptor complex molecule CD3, retained full binding capacity to both antigens compared with unfused scFv, scDb, and taFv molecules. Tumor antigen-specific retargeting and activation of T cells as monitored by interleukin-2 release was observed for scDb, scDb-HSA, taFv-HSA, and to a lesser extent for scFv2-HSA. T cell activation could be further enhanced by a target cell-specific costimulatory signal provided by a B7-DbCEA fusion protein. Furthermore, we could demonstrate that fusion to serum albumin strongly increases circulation time of recombinant bispecific antibodies. In addition, our comparative study indicates that single chain diabody-albumin fusion proteins seem to be the most promising format for further studying cytotoxic activities in vitro and in vivo. Recombinant bispecific antibodies such as tandem scFv molecules (taFv), diabodies (Db), or single chain diabodies (scDb) have shown to be able to retarget T lymphocytes to tumor cells, leading to their destruction. However, therapeutic efficacy is hampered by a short serum half-life of these small molecules having molecule masses of 50–60 kDa. Thus, improvement of the pharmacokinetic properties of small bispecific antibody formats is required to enhance efficacy in vivo. In this study, we generated several recombinant bispecific antibody-albumin fusion proteins and analyzed these molecules for biological activity and pharmacokinetic properties. Three recombinant antibody formats were produced by fusing two different scFv molecules, bispecific scDb or taFv molecules, respectively, to human serum albumin (HSA). These constructs (scFv2-HSA, scDb-HSA, taFv-HSA), directed against the tumor antigen carcinoembryonic antigen (CEA) and the T cell receptor complex molecule CD3, retained full binding capacity to both antigens compared with unfused scFv, scDb, and taFv molecules. Tumor antigen-specific retargeting and activation of T cells as monitored by interleukin-2 release was observed for scDb, scDb-HSA, taFv-HSA, and to a lesser extent for scFv2-HSA. T cell activation could be further enhanced by a target cell-specific costimulatory signal provided by a B7-DbCEA fusion protein. Furthermore, we could demonstrate that fusion to serum albumin strongly increases circulation time of recombinant bispecific antibodies. In addition, our comparative study indicates that single chain diabody-albumin fusion proteins seem to be the most promising format for further studying cytotoxic activities in vitro and in vivo. Bispecific antibodies are designed to target two different antigens simultaneously (1Müller D. Kontermann R.E. Kontermann R.E. Dübel S. Handbook of Therapeutic Antibodies. Vol. 2. Wiley-VCH, Weinheim2007: 345-378Crossref Scopus (3) Google Scholar). In the context of a tumor therapy they can be applied to selectively recruit potent effector cells of the immune system such as cytotoxic T lymphocytes to tumor cells (2Peipp M. Valerius T. Biochem. Soc. Trans. 2002; 30: 507-511Crossref PubMed Scopus (52) Google Scholar). This is achieved by binding on the one side to a tumor-associated antigen and on the other side to a trigger molecule on the effector cell, leading to the activation of the effector cell and tumor cell destruction. To reduce potential side effects elicited by the Fc part of antibodies (3Van Spriel A.B. van Ojik H.H. van de Winkel J.G.J. Immunol. Today. 2000; 21: 391-396Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar) small recombinant bispecific antibody formats composed only of the variable regions, which define the binding unit of an antibody, have been developed (1Müller D. Kontermann R.E. Kontermann R.E. Dübel S. Handbook of Therapeutic Antibodies. Vol. 2. Wiley-VCH, Weinheim2007: 345-378Crossref Scopus (3) Google Scholar, 4Kontermann R.E. Acta Pharmacol. Sin. 2005; 26: 1-9Crossref PubMed Scopus (114) Google Scholar). These formats include bispecific diabodies (Db), 4The abbreviations used are: Db, diabody; AUC, area under the curve; CEA, carcinoembryonic antigen; HSA, human serum albumin; PBMC, peripheral blood mononuclear cell; PEG, polyethylene glycol; RSA, rat serum albumin; scFv, single chain Fv; scDb, single chain diabody; taFv, tandem scFv; IL, interleukin; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay; HPLC, high performance liquid chromatography; FPLC, fast protein liquid chromatography; FAP, fibroblast activation protein; VH, heavy chain variable domain; VL, light chain variable domain. 4The abbreviations used are: Db, diabody; AUC, area under the curve; CEA, carcinoembryonic antigen; HSA, human serum albumin; PBMC, peripheral blood mononuclear cell; PEG, polyethylene glycol; RSA, rat serum albumin; scFv, single chain Fv; scDb, single chain diabody; taFv, tandem scFv; IL, interleukin; PBS, phosphate-buffered saline; ELISA, enzyme-linked immunosorbent assay; HPLC, high performance liquid chromatography; FPLC, fast protein liquid chromatography; FAP, fibroblast activation protein; VH, heavy chain variable domain; VL, light chain variable domain. single chain diabodies (scDb), and tandem scFv (taFv) molecules, which have been applied successfully in vitro and also in vivo for the retargeting of cytotoxic T lymphocytes (via T-cell receptor molecule CD3) to tumor cells (e.g. recognizing CEA, EpCAM, or CD19) (5Blanco B. Holliger P. Vile R.G. Alvarez-Vallina L. J. Immunol. 2003; 171: 1070-1077Crossref PubMed Scopus (49) Google Scholar, 6Schlereth B. Fichtner I. Lorenczewski G. Kleindienst P. Brischwein K. da Silva A. Kufer P. Lutterbuese R. Junghahn I. Kasimir-Bauer S. Wimberger P. Kimmig R. Baeuerle P.A. Cancer Res. 2005; 65: 2882-2889Crossref PubMed Scopus (117) Google Scholar, 7Dreier T. Baeuerle P.A. Fichtner I. Grun M. Schlereth B. Lorenczewski G. Kufer P. Lutterbuse R. Riethmüller G. Gjorstrup P. Bargou R.C. J. Immunol. 2003; 170: 4397-4402Crossref PubMed Scopus (161) Google Scholar, 8Cochlovius B. Kipriyanov S.M. Stassar M.J. Christ O. Schuhmacher J. Strauss G. Moldenhauer G. Little M. J. Immunol. 2000; 165: 888-895Crossref PubMed Scopus (76) Google Scholar). However, these small bispecific antibody molecules with molecular masses between 50 and 60 kDa are rapidly cleared from circulation with an initial half-life of less than 30 min (9Huhalov A. Chester K.A. Q. J. Nucl. Med. Mol. Imaging. 2004; 48: 279-288PubMed Google Scholar, 10Kipriyanov S.M. Moldenhauer G. Schuhmacher J. Cochlovius B. Von der Lieth C.W. Matys E.R. Little M. J. Mol. Biol. 1999; 293: 41-56Crossref PubMed Scopus (159) Google Scholar). This puts some obstacles on therapeutic applications, e.g. requirement of high doses and repeated injections or infusions (6Schlereth B. Fichtner I. Lorenczewski G. Kleindienst P. Brischwein K. da Silva A. Kufer P. Lutterbuese R. Junghahn I. Kasimir-Bauer S. Wimberger P. Kimmig R. Baeuerle P.A. Cancer Res. 2005; 65: 2882-2889Crossref PubMed Scopus (117) Google Scholar). Hence, therapeutic applications should benefit from an improvement of serum half-life. To improve pharmacokinetic properties of small molecules most attempts have been directed so far to increase the apparent molecular size of the recombinant protein. One approach comprises chemical coupling of polyethylene glycol (PEG) chains to the recombinant antibody molecules (11Chapman A.P. Adv. Drug Delivery Rev. 2002; 54: 531-545Crossref PubMed Scopus (476) Google Scholar). This way, longer circulation times could be achieved for scFv and F(ab′) fragments (12Chapman A.P. Antoniw P. Spitali M. West S. Stephens S. King D.J. Nat. Biotechnol. 1999; 17: 780-783Crossref PubMed Scopus (303) Google Scholar, 13Yang K. Basu A. Wang M. Chintala R. Hsieh M.C. Liu S. Hua J. Zhang Z. Zhou J. Li M. Phyu H. Petti G. Mendez M. Janjua H. Peng P. Longley C. Borowski V. Mehlig M. Filpula D. Protein Eng. 2003; 16: 761-770Crossref PubMed Scopus (120) Google Scholar, 14Kubetzko S. Sarkar C.A. Plückthun A. Mol. Pharmacol. 2005; 68: 1439-1454Crossref PubMed Scopus (119) Google Scholar). However, PEGylation can lead to reduced binding and activity of the proteins (14Kubetzko S. Sarkar C.A. Plückthun A. Mol. Pharmacol. 2005; 68: 1439-1454Crossref PubMed Scopus (119) Google Scholar, 15Bailon P. Palleroni A. Schaffer C.A. Spence C.L. Fung W.J. Porter J.E. Ehrlich G.K. Pan W. Xu Z.X. Modi M.W. Farid A. Berthold W. Bioconjugate Chem. 2001; 12: 195-202Crossref PubMed Scopus (594) Google Scholar). Other strategies to improve pharmacokinetic properties of bispecific recombinant antibodies employed fusion to heavy chain fragments (Fc/CH3) (16Alt M. Müller R. Kontermann R.E. FEBS Lett. 1999; 454: 90-94Crossref PubMed Scopus (68) Google Scholar, 17Marvin J.S. Zhu Z. Acta Pharmacol. Sin. 2005; 26: 649-658Crossref PubMed Scopus (80) Google Scholar) or multimerization strategies (10Kipriyanov S.M. Moldenhauer G. Schuhmacher J. Cochlovius B. Von der Lieth C.W. Matys E.R. Little M. J. Mol. Biol. 1999; 293: 41-56Crossref PubMed Scopus (159) Google Scholar, 18Völkel T. Korn T. Bach M. Müller R. Kontermann R.E. Protein Eng. 2001; 14: 815-823Crossref PubMed Google Scholar). However, in these cases molecules contain two binding sites for each antigen bearing the risk of target cell-independent activation of effector cells. New approaches to improve pharmacokinetics of small proteins are based on binding to or fusion with long-circulating serum proteins such as albumin (19Chuang V.T. Kragh-Hansen U. Otagiri M. Pharmacol. Res. 2002; 19: 569-577Crossref Scopus (267) Google Scholar, 20Smith B.J. Popplewell A. Athwal D. Chapman A.P. Heywood S. West S.M. Carrington B. Nesbitt A. Lawson A.D. Antoniw P. Eddelston A. Suitters A. Bioconjugate Chem. 2001; 12: 750-756Crossref PubMed Scopus (80) Google Scholar, 21Dennis M.S. Zhang M. Meng Y.G. Kadkhodayan M. Kirchhofer D. Combs D. Damico L.A. J. Biol. Chem. 2002; 277: 35035-35043Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar). Albumin is the most abundant protein in the blood plasma. It is produced in the liver as a monomeric protein of 67 kDa. Besides its role in regulating the osmotic pressure of plasma, the physiologic functions comprise the transport of metabolites like long chain fatty acids, bilirubin, steroid hormones, tryptophan, and calcium, among others. Albumin also binds with high affinity to a broad range of drugs influencing their pharmacokinetic properties (22Kragh-Hansen U. Chuang V.T. Otagiri M. Biol. Pharm. Bull. 2002; 25: 695-704Crossref PubMed Scopus (730) Google Scholar). Albumin has a simple molecular structure and is highly stable. It is abundantly present in vascular and extravascular compartments with a circulation half-life of 19 days in humans. Recent studies have shown that this long serum half-life is due to a recycling process mediated by the neonatal Fc receptor (FcRn), similar to that observed for IgG molecules (23Chaudhury C. Mehnaz S. Robinson J.M. Hayton W.L. Pearl D.K. Roopenian D.C. Anderson C.L. J. Exp. Med. 2003; 197: 315-322Crossref PubMed Scopus (455) Google Scholar, 24Chaudhury C. Brooks C.L. Carter D.C. Robinson J.M. Anderson C.L. Biochemistry. 2006; 45: 4983-4990Crossref PubMed Scopus (211) Google Scholar). Taking advantage of these properties, human serum albumin (HSA) has been employed as macromolecular carrier for drug delivery or diagnostic purpose (19Chuang V.T. Kragh-Hansen U. Otagiri M. Pharmacol. Res. 2002; 19: 569-577Crossref Scopus (267) Google Scholar). Moreover, HSA has also been successfully used to generate fusion proteins, e.g. with hormones (insulin, human growth hormone) (25Duttaroy A. Kanakaraj P. Osborn B.L. Schneider H. Pickeral O.K. Chen C. Zhang G. Kaithamana S. Singh M. Schulingkamp R. Crossan D. Bock J. Kaufman T.E. Reavey P. Carey-Barber M. Krishnan S.R. Garcia A. Murphy K. Siskind J.K. McLean M.A. Cheng S. Ruben S. Birse C.E. Blondel O. Diabetes. 2005; 54: 251-258Crossref PubMed Scopus (114) Google Scholar, 26Osborn B.L. Sekut L. Corcoran M. Poortman C. Sturm B. Chen G. Mather D. Lin H.L. Parry T.J. Eur. J. Pharmacol. 2002; 456: 149-158Crossref PubMed Scopus (117) Google Scholar) and cytokines (interferon-α, interferon-β, IL-2) (27Osborn B.L. Olsen H.S. Nardelli B. Murray J.H. Zhou J.X. Garcia A. Moody G. Zaritskaya L.S. Sung C. J. Pharmacol. Exp. Ther. 2002; 303: 540-548Crossref PubMed Scopus (195) Google Scholar, 28Sung C. Nardelli B. LaFleur D.W. Blatter E. Corcoran M. Olsen H.S. Birse C.E. Pickeral O.K. Zhang J. Shah D. Moody G. Gentz S. Beebe L. Moore P.A. J. Interferon Cytokine Res. 2003; 23: 25-36Crossref PubMed Scopus (80) Google Scholar, 29Melder R.J. Osborn B.L. Riccobene T. Kanakaraj P. Wei P. Chen G. Stolow D. Halpern W.G. Migone T.S. Wang Q. Grzegorzewski K.J. Gallant G. Cancer Immunol. Immunother. 2005; 54: 535-547Crossref PubMed Scopus (107) Google Scholar), to reduce immunogenicity and modulate the pharmacokinetic properties, thus improving therapeutic efficacy of these molecules. Improved pharmacokinetic properties have also been described for a scFv-HSA fusion protein as well as for F(ab′) and F(ab′)2 conjugated to rat serum albumin (RSA) for the targeting of human tumor necrosis factor (20Smith B.J. Popplewell A. Athwal D. Chapman A.P. Heywood S. West S.M. Carrington B. Nesbitt A. Lawson A.D. Antoniw P. Eddelston A. Suitters A. Bioconjugate Chem. 2001; 12: 750-756Crossref PubMed Scopus (80) Google Scholar). Here, we have employed the albumin fusion strategy to recombinant bispecific antibody molecules. Three forms of recombinant bispecific antibody HSA fusion proteins based on single chain diabody, tandem scFv, or two different single chain Fv fragments were generated and produced in a mammalian expression system. These novel bispecific antibody molecules showed specific binding to both antigens (CEA and CD3) and were able to retarget and activate effector cells in vitro to various extents. Compared with the parental antibodies, all bispecific albumin fusion proteins showed strong increase of the serum half-life in mice. Materials—Antibodies were purchased from Santa Cruz Biotechnology (CA) (HRP-conjugated anti-His tag antibody), Dianova (Hamburg, Germany) (unconjugated anti-His tag antibody), and Sigma (Taufkirchen, Germany) (anti-mouse IgG-fluorescein isothiocyanate or phycoerythrin-conjugated antibody). Carcinoembryonic antigen was obtained from Europa Bioproducts (Cambridge, UK). Total RNA from human liver was purchased from Stratagene (Amsterdam, Netherlands) and the First Strand cDNA Synthesis kit from Fermentas (St. Leon-Rot, Germany). The human colon adenocarcinoma cell line LS174T was purchased from ECACC (Wiltshire, UK) and cultured in Earle's minimal essential medium (Invitrogen, Karlsruhe, Germany) supplemented with 2 mm glutamine, 1% non-essential amino acids, and 10% fetal bovine serum. HT1080#13.8 were a kind gift of W. Rettig (Boehringer Ingelheim Pharma, Vienna, Austria). HT1080#13.8 were grown in RPMI 5% fetal bovine serum in the presence of 200 μg/ml G418. Jurkat and HEK293 were cultured in RPMI, 10 and 5% fetal bovine serum, respectively. Buffy coat from a healthy human donor was kindly provided by Prof. G. Multhoff (Regensburg, Germany). IL-2 was purchased from Immunotools (Friesoythe, Germany) and phytohemagglutinin-L from Roche Applied Science. CD1 mice were purchased from Elevage Janvier (Le Genest St. Isle, France). Oligonucleotides—The following oligonucleotides were used: HSA-XhoI-back, 5′-ACCGTCTCGAGTGGTGGATCAGGCGGTGATGCACACAAGAGTGAGGTTGC-3′; HSA-Asc-for, 5′-GGCCGAGGCGCGCCCACCGCTGCCACCGGCAGCTTGACTTGCAGCAACAAG-3′; scFVCD3-Sfi-back, 5′-GACGCGGCCCAGCCGGCCGATATCCAGATGACCCAGTCCCCG-3′; scFvCD3-XhoI-for, 5′-ACCACTCGAGACGGTGACTAGGGTTCC-3′; scFvCEA-Asc-back, 5′-GGTGGGCGCGCCTCGGGCGGAGGTGGCTCAGGAGGGCAGGTGAAACTGCAGCAGTCTGGG-3′; scFvCEA-Not-for, 5′-GCTCGATGCGGCCGC TTAGTGATGGTGATGATGGTGACCTCCCCGTTTCAGCTCCAGCTTGGTGCC-3′; XhoI-M6-CEA-back, 5′-CCGCTCGAGTAGTACTGATGGTAATACTCAGGTGAAACTGCAGCAGTCTGG-3′; Not-HSA-back, 5′-ATAAGAATGCGGCCGCAGGTGGATCAGGCGGTGATGCACACAAGAGTGAGGTTGC-3′; LMB2, 5′-GTAAAACGACGGCCAGT-3′; HSA-His-stop-EcoRI-for, 5′-CCGGAATTCTTAGTGATGGTGATGATGGTGGCCACCGGCAGCTTGACTTGCAGCAACAAG-3′; NcoI-B7.2-back, 5′-CATGCCATGGCCGCTCCTCTGAAGATTCAAGCT-3′; B7.2-(2–225)-XhoI-for, 5′-TACCGCTCGAGCCACCTCCTGAACCGCCTCCAGGAATGTGGTCTGGGGGAGGCTG-3′; XhoI-CEA(VH)-back, 5′-AACCGCTCGAGCGGAGGCGGTTCACAGGTGAAACTGCAGCAGTCT-3′. Cloning of Recombinant Antibody Fusion Proteins—scFvCEA corresponds to murine scFvMFE-23 (30Chester K.A. Begent R.H. Robson L. Keep P. Pedley R.B. Boden J.A. Boxer G. Green A. Winter G. Cochet O. Hawkins R.E. Lancet. 1994; 343: 455-456Abstract PubMed Scopus (164) Google Scholar) and was expressed in the VH-VL orientation using a (G4S)4 linker. scFvCD3 is derived from humanized variant 9 of UCHT-1 (31Zhu Z. Carter P. J. Immunol. 1995; 155: 1903-1910PubMed Google Scholar). VLCD3 and VHCD3 were linked by the sequence GGGGSGGRASGGGGSGGGGS. scDbCEACD3 is organized VHCEA-VLCD3-VHCD3-VL-CEA. The cloning strategy for this format has been described elsewhere (32Korn T. Völkel T. Kontermann R.E. Dübel S. Antibody Engineering, A Laboratory Manual. 1st Ed. Springer, Heidelberg2001: 619-636Google Scholar). All constructs were cloned in pAB1 via SfiI/NotI and exhibit a C-terminal c-Myc and a His6 tag. scFvCEA, scFvCD3, and scDbCEACD3 were further used as starting material for the cloning of taFvCD3CEA and the recombinant antibody-HSA fusion proteins. The coding sequence of HSA (amino acids 25–604 of the precursor protein) was amplified by PCR (primer: HSA-XhoI-back and HSA-Asc-for) with cDNA from human liver as a template and cloned into pAB1 via XhoI/AscI. scFvCD3 (primers: scFVCD3-Sfi-back and scFvCD3-XhoI-for) and scFvCEA (primers scFvCEA-Asc-back and scFv-CEA-Not-for) were PCR amplified and introduced N-terminal (scFvCD3) and C-terminal (scFvCEA) of the HSA sequence in the pAB1 vector, generating the bispecific scFvCD3-HSA-scFv-CEA (scFv2-HSA) construct. Through the primers, an -AAAGGSGG- linker was introduced between scFvCD3 and HSA and a -GGGGSGGRASGGGGS- linker between HSA and scFvCEA. taFvCD3CEA-HSA (taFv-HSA) was cloned by amplifying scFvCEA (primers XhoI-M6-CEA-back and LMB2) and HSA (primers Not-HSA-back and HSA-His-stop-EcoRI-for), respectively, and introducing first the HSA (NotI/EcoRI) behind the scFvCD3 into pAB1 scFvCD3-HSA-scFvCEA, generating an intermediate scFvCD3-HSA-scFvCEA-HSA product. In the next step, the HSA-scFvCEA region was replaced by scFvCEA (XhoI/NotI) introducing a -STDGNT- linker between scFvCD3 and scFvCEA and a -GGSGG- linker between scFvCEA and HSA. scDbCEACD3-HSA (scDb-HSA) was generated by replacing the scFvCD3-HSA-scFvCEA of the pAB1 scFvCD3-HSA-scFvCEA-HSA intermediate construct by scDbCEACD3 (SfiI/NotI). taFvCD3CEA was cloned by amplifying scFvCEA (primers XhoI-M6-CEA-back and scFv-CEA-Not-for) and cloning the fragment (XhoI/NotI) behind scFvCD3 in pAB1 scFvCD3-HSA-scFvCEA, replacing HSA-scFvCEA. Introduced by primer design, all cloned HSA fusion proteins and taFvCD3CEA contain a His6 tag at their C terminus. Finally, all HSA fusion protein constructs, as well as scDb-CEACD3 and the taFvCD3CEA were cloned as SfiI/EcoRI fragments into mammalian expression vector pSecTagA (Invitrogen, Karlsruhe, Germany). For cloning of B7-DbCEA, the extracellular region of B7.2 (amino acids 2–225) was amplified by PCR (primers NcoI-B7.2-back and B7.2-(2–225)-XhoI-for) using cDNA provided by Prof. Winfried Wels (Frankfurt, Germany). In parallel DbCEA was amplified (primers XhoI-CEA(VH)-back and LMB2) from plasmid pAB1-DbCEA (33Kontermann R.E. Martineau P. Cummings C.E. Karpas A. Allen D. Derbyshire E. Winter G. Immunotechnology. 1997; 3: 137-144Crossref PubMed Scopus (39) Google Scholar). PCR fragments of B7.2 and DbCEA were digested with NcoI/XhoI and XhoI/NotI, respectively, and cloned into pAB1 (NcoI/NotI). Finally, the whole B7-DbCEA construct was cloned (SfiI/NotI) into a modified pSecTagA vector (pSecTagA-His) devoid of the c-Myc tag sequence. Expression and Purification of Recombinant Antibodies and Their Respective HSA Fusion Proteins—scFvCEA, scFvCD3, and scDbCEACD3 were expressed in the periplasm of Escherichia coli strain TG1. Two liters of 2× TY, 100 μg/ml ampicillin, 0.1% glucose were inoculated with 20 ml of overnight culture of transformed TG1 and grown to exponential phase (A600 = 0.8) at 37 °C. Protein expression was induced by addition of 1 mm isopropyl 1-thio-β-d-galactopyranoside and bacteria were grown for an additional 3 h at room temperature. Cells were harvested by centrifugation and resuspended in 100 ml of 30 mm Tris-HCl, pH 8.0, 1 mm EDTA, 20% sucrose. After addition of 5 mg of lysozyme, cells were incubated for 15–30 min on ice. After addition of 10 mm Mg2SO4, cells were centrifuged at 10,000 × g for 30 min at 4 °C. Supernatant was dialyzed against PBS and loaded onto a nickel-nitrilotriacetic acid column (Qiagen, Hilden, Germany) equilibrated with 50 mm sodium phosphate buffer, pH 7.5, 500 mm NaCl, 20 mm imidazole. After a washing step (50 mm sodium phosphate buffer, pH 7.5, 500 mm NaCl, 35 mm imidazole) the His-tagged recombinant antibody fragments were eluted with 50 mm sodium phosphate buffer, pH 7.5, 500 mm NaCl, 100 mm imidazole. Protein fractions were pooled and dialyzed against PBS. Protein concentration was determined spectrophotometrically and calculated using the calculated ϵ value of each protein. Plasmid-DNA (pSecTagA expression vector) encoding taFvCD3CEA, scFvCD3-HSA-scFvCEA, scDbCEACD3, scDb-CEACD3-HSA, taFvCD3CEA-HSA, and B7-DbCEA were transfected with Lipofectamine™ 2000 (Invitrogen) into HEK293 cells. Stable transfectants were generated by selection with zeocin (300 μg/ml). Cells were expanded and grown in RPMI, 5% fetal calf serum to 90% confluence. For protein production cells were cultured in Opti-MEM® I (Invitrogen) replacing media every 3 days for 3–4 times. Supernatants were pooled and proteins were concentrated by ammonium sulfate precipitation (60% saturation), before loading onto a nickel-nitrilotriacetic acid column (Qiagen) (16Alt M. Müller R. Kontermann R.E. FEBS Lett. 1999; 454: 90-94Crossref PubMed Scopus (68) Google Scholar). Purification by immobilized metal ion affinity chromatography was performed as described above. Flow Cytometry—1 × 106 cells/well were incubated with 10 μg/ml recombinant antibody or recombinant antibody-HSA fusion protein for 2 h at 4°C. After washing, cells were incubated for 1 h at 4°C with mouse anti-His tag antibody followed by washing and 30 min incubation with fluorescein isothiocyanate-labeled anti-mouse IgG. Wash cycles and incubation steps were performed in PBS, 2% fetal calf serum, 0.02% azide. Finally, cells were analyzed by flow cytometry using an EPICS XL-MCL (Beckman Coulter, Krefeld, Germany). ELISA—Binding properties of recombinant antibodies or antibody-HSA fusion proteins to CEA were analyzed by ELISA as following: 96-well plates were coated with carcinoembryonic antigen (300 ng/well) overnight at 4 °C. After 2 h blocking with 2% (w/v) dry milk/PBS, recombinant antibody fragments or HSA fusion proteins were titrated in duplicate and incubated for 1 h at room temperature. Detection was performed with mouse HRP-conjugated anti-His tag antibody using 3,3′,5,5′-tetramethylbenzidine substrate (1 mg/ml 3,3′,5,5′-tetramethylbenzidine, sodium acetate buffer, pH 6.0, 0.006% H2O2). The reaction was stopped with 50 μlof 1 m H2SO4. Absorbance was measured at 450 nm in an ELISA reader. Binding properties of B7-DbCEA were analyzed in the following setting: 96-well plates were coated and blocked as described above, followed by incubation with 1 μm B7-DbCEA fusion protein or DbCEA for 1 h at room temperature. Detection was performed via binding to recombinant CTLA-4-Fc (1 h at room temperature) followed by anti-mouse Fc-HRP conjugate (1 h at room temperature). Plates were developed with 3,3′,5,5′-tetramethylbenzidine substrate as described above. Concentration of human IL-2 in the supernatant after T-cell retargeting was determined by an IL-2 sandwich ELISA. Anti-human IL-2 antibodies as well as the standard of recombinant human IL-2 was provided by the DuoSet IL-2 ELISA Development System kit (R&D Systems, Nordenstadt, Germany) and the assay was performed following the manufacturer's protocol. Size Exclusion Chromatography—Apparent molecular weight of recombinant antibody and recombinant antibody-HSA fusion proteins was determined by HPLC on a BioSep-Sec-3000 column or a BioSep-Sec-2000 column (Phenomenex, Torrance, CA) with a flow rate of 0.5 ml/min and PBS as running buffer. The following standard proteins were used: thyroglobulin, apoferritin, β-amylase, bovine serum albumin, carbonic anhydrase, and cytochrome c. Preparation of Peripheral Blood Mononuclear Cells (PBMC)— Buffy coat (leukapheresis) from a healthy human donor was diluted 1:4 in RPMI 1640, layered onto a LSM 1077 Ficoll/Hypaque gradient (PAA, Cölbe, Germany), and centrifuged for 20 min at 670 × g at room temperature. The PBMC fraction was aspirated and washed once with medium, before resuspending in 10% Me2SO, 40% RPMI, 50% fetal calf serum and storing at -80 °C. For flow cytometry PBMCs were preactivated by incubation with phytohemagglutinin-L (1 μg/ml) and IL-2 (100 units/ml) for 3 days. Retargeting of T Cells—1 × 105 LS174T or HT1080#13.8 cells/100 μl/well were seeded in 96-well plates. The next day supernatant was removed and 100 μl of recombinant antibody ± costimulus added. After a 1-h preincubation at room temperature, 2 × 105 PBMC/100 μl/well were added. PBMCs had been thawed the day before and seeded on a culture dish, to remove monocytes by attachment to the plastic surface. Only cells that remained in suspension were used for the assay. After addition of PBMCs, the 96-well plate was incubated for 22–24 h at 37 °C, 5% CO2. Plates were centrifuged and cell-free supernatant was collected. IL-2 concentration in the supernatant was determined by ELISA. In Vitro Stability—Antibody molecules were incubated with human serum at a concentration of 10 μg/ml for up to 24 days at 37 °C. Aliquots were taken at various time points and stored at -20 °C. The concentration of active antibody molecules was then determined by ELISA as described above including dilutions of untreated antibody molecules as reference. Half-lives were calculated by linear regression. Pharmacokinetics—Animal care and all experiments performed were in accordance with federal guidelines and have been approved by university and state authorities. CD1 mice (female, 9–12 weeks, weight between 30 and 40 g, 3 mice/group) received intraveneous injections of 25 μg of recombinant antibody or antibody-HSA fusion protein in a total volume of 100–150 μl. In time intervals of 3, 10, 30, 60, 120, and 360 min (recombinant antibody) or 3, 30, 60, 120, 360 min, 24 h, and 6 days (recombinant antibody-HSA fusion protein) blood samples (100 μl) were taken from the tail and incubated on ice. Clotted blood was centrifuged at 10,000 × g for 10 min at 4 °C and serum samples stored at -20 °C. Serum concentration of CEA-binding recombinant antibody or recombinant antibody-HSA fusion proteins was determined by ELISA (as described above), interpolating the corresponding calibration curves. For comparison, the first value (3 min) was set to 100%. Pharmacokinetic parameters AUC, t½α, and t½β were calculated with Excel using the first 3 times points to calculate t½α and the last 3 time points to calculate t½β. For statistics, Student's t test was applied. Generation of Bispecific Recombinant Antibody-HSA Fusion Proteins—The structure of HSA shows that the N and C terminus of the protein are located on opposite sites and stick out of the molecule, thus providing a good precondition for the generation of fusion proteins (Fig. 1). By genetically fusing various antibody formats to HSA, the recombinant bispecific antibody-HSA fusion proteins scFv2-HSA, scDb-HSA, and taFv-HSA were generated (Fig. 1). In the scFv2-HSA variant scFvCD3 was fused to the N terminus and scFvCEA to the C terminus of HSA by short glycine/serine-rich linkers of 5 and 15 amino acids, respectively. scDb-HSA and taFv-HSA fusion proteins were generated by fusing scDbCEACD3 or taFvCD3CEA, respectively, by a linker of 8 amino acids to the N terminus of HSA. All HSA fusion proteins were C-terminal endowed with a His tag for detection and purification. scFvCD3 and scFvCEA were purified from the periplasm of transformed bacteria, whereas the HSA fusion proteins were purified from the cell culture supernatant of stably transfected HEK293 cells. scDb and taFv were produced in both expression systems. In the bacterial expression system the yield of scFv production was 0.3–0.35 mg/liter, i.e. three times higher than the yield of the scDb and taFv production (0.1 mg/liter). Higher yields of scDb and taFv were obtained in the mammalian expression system (5–6 mg/liter cell culture supernatant). The yields of purified HSA fusion proteins were 5 mg/liter for scFv2-HSA, 9 mg/liter for taFv-HSA, and 13 mg/liter for s
Referência(s)