Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Conditional Deletion of Gremlin Causes a Transient Increase in Bone Formation and Bone Mass

2007; Elsevier BV; Volume: 282; Issue: 43 Linguagem: Inglês

10.1074/jbc.m701317200

ISSN

1083-351X

Autores

Elisabetta Gazzerro, Anna Smerdel‐Ramoya, Stefano Zanotti, Lisa Stadmeyer, Deena Durant, Aris N. Economides, Ernesto Canalis,

Tópico(s)

Neurogenetic and Muscular Disorders Research

Resumo

Gremlin is a glycoprotein that binds bone morphogenetic proteins (BMPs) 2, 4, and 7, antagonizing their actions. Gremlin opposes BMP effects on osteoblastic differentiation and function in vitro and in vivo, and its overexpression causes osteopenia. To define the function of gremlin in the skeleton, we generated gremlin 1 (grem1) conditional null mice by mating mice where grem1 was flanked by loxP sequences with mice expressing the Cre recombinase under the control of the osteocalcin promoter. grem1 null male mice displayed increased trabecular bone volume due to enhanced osteoblastic activity, because mineral apposition and bone formation rates were increased. Osteoblast number and bone resorption were not altered. Marrow stromal cells from grem1 conditional null mice expressed higher levels of alkaline phosphatase activity. Gremlin down-regulation by RNA interference in ST-2 stromal and MC3T3 osteoblastic cells increased the BMP-2 stimulatory effect on alkaline phosphatase activity, on Smad 1/5/8 phosphorylation, and on the transactivation of the BMP/Smad reporter construct 12×SBE-Oc-pGL3. Gremlin down-regulation also enhanced osteocalcin and Runx-2 expression, Wnt 3a signaling, and activity in ST-2 cells. In conclusion, deletion of grem1 in the bone microenvironment results in sensitization of BMP signaling and activity and enhanced bone formation in vivo. Gremlin is a glycoprotein that binds bone morphogenetic proteins (BMPs) 2, 4, and 7, antagonizing their actions. Gremlin opposes BMP effects on osteoblastic differentiation and function in vitro and in vivo, and its overexpression causes osteopenia. To define the function of gremlin in the skeleton, we generated gremlin 1 (grem1) conditional null mice by mating mice where grem1 was flanked by loxP sequences with mice expressing the Cre recombinase under the control of the osteocalcin promoter. grem1 null male mice displayed increased trabecular bone volume due to enhanced osteoblastic activity, because mineral apposition and bone formation rates were increased. Osteoblast number and bone resorption were not altered. Marrow stromal cells from grem1 conditional null mice expressed higher levels of alkaline phosphatase activity. Gremlin down-regulation by RNA interference in ST-2 stromal and MC3T3 osteoblastic cells increased the BMP-2 stimulatory effect on alkaline phosphatase activity, on Smad 1/5/8 phosphorylation, and on the transactivation of the BMP/Smad reporter construct 12×SBE-Oc-pGL3. Gremlin down-regulation also enhanced osteocalcin and Runx-2 expression, Wnt 3a signaling, and activity in ST-2 cells. In conclusion, deletion of grem1 in the bone microenvironment results in sensitization of BMP signaling and activity and enhanced bone formation in vivo. Bone morphogenetic proteins (BMPs) 3The abbreviations used are: BMP, bone morphogenetic protein; APA, alkaline phosphatase activity; BAC, bacterial artificial chromosome; BMD, bone mineral density; CMV, cytomegalovirus; Dan, differentially screening-selected gene aberrative in neuroblastoma; drm, down-regulated by v-mos; ES, embryonic stem; ERK, extracellular regulated kinases; FGF, fibroblast growth factor; FRT, flippase recombinase target; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Lef-1/Tcf-4, lymphoid enhancer binding factor/T cell-specific factor; MAP, mitogen activated protein; Smad, mothers against decapentaplegic; Neo, neomycin phosphotransferase; RT, reverse transcription; RNAi, RNA interference; Runx-2, runt-related transcription factor 2; SHH, sonic hedgehog; siRNA, small interfering RNA.3The abbreviations used are: BMP, bone morphogenetic protein; APA, alkaline phosphatase activity; BAC, bacterial artificial chromosome; BMD, bone mineral density; CMV, cytomegalovirus; Dan, differentially screening-selected gene aberrative in neuroblastoma; drm, down-regulated by v-mos; ES, embryonic stem; ERK, extracellular regulated kinases; FGF, fibroblast growth factor; FRT, flippase recombinase target; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Lef-1/Tcf-4, lymphoid enhancer binding factor/T cell-specific factor; MAP, mitogen activated protein; Smad, mothers against decapentaplegic; Neo, neomycin phosphotransferase; RT, reverse transcription; RNAi, RNA interference; Runx-2, runt-related transcription factor 2; SHH, sonic hedgehog; siRNA, small interfering RNA. are important determinants of cell fate and play a central role in the regulation of osteoblastogenesis and endochondral bone formation (1Canalis E. Kim A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar). BMPs, in conjunction with Wnt, induce the differentiation of mesenchymal cells toward the osteoblastic lineage and enhance the pool and function of mature osteoblasts (2Thies R.S. Kim M. Ashton B.A. Kurtzberg L. Wozney J.M. Rosen V. Endocrinology. 1992; 130: 1318-1324Crossref PubMed Scopus (329) Google Scholar, 3Ghosh-Choudhury N. Kim M.A. Feng J.Q. Mundy G.R. Harris S.E. Crit. Rev. Eukaryot. Gene Expr. 1994; 4: 345-355Crossref PubMed Scopus (58) Google Scholar, 4Westendorf J.J. Kim R.A. Schroeder T.M. Gene (Amst.). 2004; 341: 19-39Crossref PubMed Scopus (676) Google Scholar). Upon ligand binding, BMPs initiate a signal transduction cascade activating the mothers against the decapentaplegic (Smad) or mitogen-activated protein kinase signaling pathways (1Canalis E. Kim A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar, 5Miyazono K. Bone. 1999; 25: 91-93Crossref PubMed Scopus (153) Google Scholar, 6Nohe A. Kim E. Knaus P. Petersen N.O. Cell Signal. 2004; 16: 291-299Crossref PubMed Scopus (442) Google Scholar, 7Nohe A. Kim S. Ehrlich M. Neubauer F. Sebald W. Henis Y.I. Knaus P. J. Biol. Chem. 2002; 277: 5330-5338Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar, 8Lai C.F. Kim S.L. J. Biol. Chem. 2002; 277: 15514-15522Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). In osteoblastic cells, Wnt binding to specific receptors and co-receptors leads to the stabilization of β-catenin and its translocation to the nucleus, where it associates with nuclear factors to regulate transcription (4Westendorf J.J. Kim R.A. Schroeder T.M. Gene (Amst.). 2004; 341: 19-39Crossref PubMed Scopus (676) Google Scholar, 9Krishnan V. Kim H.U. MacDougald O.A. J. Clin. Invest. 2006; 116: 1202-1209Crossref PubMed Scopus (1121) Google Scholar, 10Wodarz A. Kim R. Annu. Rev. Cell Dev. Biol. 1998; 14: 59-88Crossref PubMed Scopus (1728) Google Scholar).The effects of BMPs and Wnt are controlled by a large group of secreted polypeptides that prevent BMP or Wnt signaling by binding BMPs or Wnt, or their receptors/co-receptors, precluding ligand-receptor interactions (1Canalis E. Kim A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar, 4Westendorf J.J. Kim R.A. Schroeder T.M. Gene (Amst.). 2004; 341: 19-39Crossref PubMed Scopus (676) Google Scholar, 11Gazzerro E. Kim E. Rev. Endocr. Metab. Disord. 2006; 7: 51-65Crossref PubMed Scopus (281) Google Scholar, 12Kawano Y. Kim R. J. Cell Sci. 2003; 116: 2627-2634Crossref PubMed Scopus (1337) Google Scholar). The binding affinity and selectivity of secreted antagonists for specific BMPs varies, and selected antagonists can have dual BMP and Wnt antagonistic activity (1Canalis E. Kim A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar, 13Winkler D.G. Kim M.S. Ojala E. Turcott E. Geoghegan J.C. Shpektor D. Skonier J.E. Yu C. Latham J.A. J. Biol. Chem. 2005; 280: 2498-2502Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar, 14Li X. Kim Y. Kang H. Liu W. Liu P. Zhang J. Harris S.E. Wu D. J. Biol. Chem. 2005; 280: 19883-19887Abstract Full Text Full Text PDF PubMed Scopus (1029) Google Scholar, 15Laurikkala J. Kim Y. Pakkasjarvi L. Thesleff I. Itoh N. Dev. Biol. 2003; 264: 91-105Crossref PubMed Scopus (206) Google Scholar, 16Bell E. Kim I. Altmann C.R. Vonica A. Brivanlou A.H. Development. 2003; 130: 1381-1389Crossref PubMed Scopus (113) Google Scholar).Gremlin and its rat homolog, down-regulated by v-mos (drm), are secreted glycoproteins with a molecular mass of 20.7 kDa (17Hsu D.R. Kim A.N. Wang X. Eimon P.M. Harland R.M. Mol. Cell. 1998; 1: 673-683Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar, 18Topol L.Z. Kim B. Zhang Q. Resau J. Huillard E. Marx M. Calothy G. Blair D.G. J. Biol. Chem. 2000; 275: 8785-8793Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 19Topol L.Z. Kim M. Laugier D. Bogdanova N.N. Boubnov N.V. Clausen P.A. Calothy G. Blair D.G. Mol. Cell Biol. 1997; 17: 4801-4810Crossref PubMed Scopus (105) Google Scholar). Gremlin 1 (grem1) is a member of the differentially screening-selected gene aberrative in neuroblastoma (dan)/cerberus family of genes, and gremlin was originally identified as a dorsalizing agent, with BMP antagonistic activity, in Xenopus embryos (1Canalis E. Kim A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar, 17Hsu D.R. Kim A.N. Wang X. Eimon P.M. Harland R.M. Mol. Cell. 1998; 1: 673-683Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar). Gremlin binds and prevents the activity of BMP-2, -4, and -7. Gremlin is expressed by stromal cells surrounding certain neoplastic cells, and it is considered to play a role in cell survival and possibly tumorigenesis (19Topol L.Z. Kim M. Laugier D. Bogdanova N.N. Boubnov N.V. Clausen P.A. Calothy G. Blair D.G. Mol. Cell Biol. 1997; 17: 4801-4810Crossref PubMed Scopus (105) Google Scholar, 20Sneddon J.B. Kim H.H. Montgomery K. van de R.M. Tward A.D. West R. Gladstone H. Chang H.Y. Morganroth G.S. Oro A.E. Brown P.O. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 14842-14847Crossref PubMed Scopus (235) Google Scholar). Homozygous null mutations of the grem1 gene in mice result in serious developmental limb, metanephric, and lung abnormalities, leading to absent kidneys and intrauterine or newborn lethality (21Khokha M.K. Kim D. Brunet L.J. Dionne M.S. Harland R.M. Nat. Genet. 2003; 34: 303-307Crossref PubMed Scopus (298) Google Scholar, 22Michos O. Kim L. Vintersten K. Beier K. Zeller R. Zuniga A. Development. 2004; 131: 3401-3410Crossref PubMed Scopus (294) Google Scholar). The patterning of distal limb skeletal elements is tightly regulated by the reciprocal interactions between BMPs, fibroblast growth factors (FGFs) 4 and 8, and Sonic hedgehog (SHH) (21Khokha M.K. Kim D. Brunet L.J. Dionne M.S. Harland R.M. Nat. Genet. 2003; 34: 303-307Crossref PubMed Scopus (298) Google Scholar). By inhibiting BMP action, gremlin allows for FGF 4/8 expression, which in turn promotes SHH expression in the posterior limb bud, which is required for proper limb patterning and development.Later in skeletal development, after the pattern of skeletal elements has been established, grem1 is expressed by osteoblasts (23Pereira R.C. Kim A.N. Canalis E. Endocrinology. 2000; 141: 4558-4563Crossref PubMed Scopus (79) Google Scholar). Transgenic mice overexpressing gremlin under the control of the osteocalcin promoter exhibit severe osteopenia secondary to decreased bone formation (24Gazzerro E. Kim R.C. Jorgetti V. Olson S. Economides A.N. Canalis E. Endocrinology. 2005; 146: 655-665Crossref PubMed Scopus (144) Google Scholar), consistent with the role of gremlin as a BMP antagonist. Gremlin binds and inhibits BMP signaling and activity in cells of the osteoblastic lineage, and tempers Wnt signaling (24Gazzerro E. Kim R.C. Jorgetti V. Olson S. Economides A.N. Canalis E. Endocrinology. 2005; 146: 655-665Crossref PubMed Scopus (144) Google Scholar). This is in accordance with the dual, BMP and Wnt, inhibitory activity reported for other members of the dan/cerberus family of genes (1Canalis E. Kim A.N. Gazzerro E. Endocr. Rev. 2003; 24: 218-235Crossref PubMed Scopus (723) Google Scholar, 15Laurikkala J. Kim Y. Pakkasjarvi L. Thesleff I. Itoh N. Dev. Biol. 2003; 264: 91-105Crossref PubMed Scopus (206) Google Scholar, 16Bell E. Kim I. Altmann C.R. Vonica A. Brivanlou A.H. Development. 2003; 130: 1381-1389Crossref PubMed Scopus (113) Google Scholar).Null mutations of grem1 nearly always cause embryonic lethality, not allowing for the study of their adult skeletal phenotype (21Khokha M.K. Kim D. Brunet L.J. Dionne M.S. Harland R.M. Nat. Genet. 2003; 34: 303-307Crossref PubMed Scopus (298) Google Scholar, 22Michos O. Kim L. Vintersten K. Beier K. Zeller R. Zuniga A. Development. 2004; 131: 3401-3410Crossref PubMed Scopus (294) Google Scholar). In the present study, a conditional grem1 deletion to inactivate gremlin in the bone environment post-natally was used. For this purpose, genetically engineered mice, where the coding sequence of grem1 was flanked by loxP sequences, were created and crossed with transgenic mice expressing the Cre recombinase under the control of the human osteocalcin promoter, and their skeletal phenotype was determined. In addition, mechanisms of gremlin action were explored in vitro, following its down-regulation in ST-2 stromal and MC3T3 osteoblastic cells using RNA interference (RNAi).EXPERIMENTAL PROCEDURESConditional Deletion of grem1—To generate a conditional-null allele of grem1, a segment of exon 2, where the coding sequence of grem1 resides in its totality, was flanked with loxP sequences to allow the excision of the entire open reading frame by Cre recombination (Fig. 1, A and B). Targeted embryonic stem (ES) cells harboring a loxP-flanked allele for grem1loxP/+ were generated using Velocigene™ technology (25Valenzuela D.M. Kim A.J. Frendewey D. Gale N.W. Economides A.N. Auerbach W. Poueymirou W.T. Adams N.C. Rojas J. Yasenchak J. Chernomorsky R. Boucher M. Elsasser A.L. Esau L. Zheng J. Griffiths J.A. Wang X. Su H. Xue Y. Dominguez M.G. Noguera I. Torres R. Macdonald L.E. Stewart A.F. DeChiara T.M. Yancopoulos G.D. Nat. Biotechnol. 2003; 21: 652-659Crossref PubMed Scopus (458) Google Scholar). Briefly, a bacterial artificial chromosome (BAC) containing mouse genomic DNA encompassing grem1 sequences was selected by PCR screen from a 129/SvJ mouse BAC library containing ∼140 kb of genomic DNA (Release I, BAC id 427a3, Incyte Genomics, Wilmington, DE). To generate the targeting vector, BAC 427a3 was modified using bacterial homologous recombination in a three-step process as follows: 1) a loxP site was introduced in a non-conserved region 335 bp upstream of exon 2, by inserting a LoxP_I-SceI_EM7-Zeo_I-SceI cassette; 2) the I-SceI_EM7-Zeo_I-SceI cassette was removed from the modified BAC by restricting with I-SceI, re-ligating, and selecting for modified BACs that had lost the Zeo cassette while retaining the LoxP_I-SceI sequence upstream of exon 2; and 3) a loxP site was inserted 550 bp downstream of the stop codon of grem1 as part of a flippase recombinase target (FRT)-flanked-phosphoglycerate kinase (PGK)-neomycin phosphotransferase (Neo)-polyA_FRT_LoxP cassette, while simultaneously deleting 66 bp (GATGGCAAACGGGACAGAGGACTGACGCAGGAACGGTCAGGCTGAGGACCAGTCGGCCAGTGA) of non-conserved exon 2 sequence, to accommodate PCR probes for genotyping by loss of native allele assay (25Valenzuela D.M. Kim A.J. Frendewey D. Gale N.W. Economides A.N. Auerbach W. Poueymirou W.T. Adams N.C. Rojas J. Yasenchak J. Chernomorsky R. Boucher M. Elsasser A.L. Esau L. Zheng J. Griffiths J.A. Wang X. Su H. Xue Y. Dominguez M.G. Noguera I. Torres R. Macdonald L.E. Stewart A.F. DeChiara T.M. Yancopoulos G.D. Nat. Biotechnol. 2003; 21: 652-659Crossref PubMed Scopus (458) Google Scholar, 26Zhang Y. Kim F. Muyrers J.P. Stewart A.F. Nat. Genet. 1998; 20: 123-128Crossref PubMed Scopus (956) Google Scholar). Using restriction mapping, it was determined that the modified BAC had homology arms of ∼70 kb adjoining the loxP-flanked allele, and the modified BAC was used as a vector to target grem1 in an F1 (129SvJ/C57BL/6) hybrid ES cell line (25Valenzuela D.M. Kim A.J. Frendewey D. Gale N.W. Economides A.N. Auerbach W. Poueymirou W.T. Adams N.C. Rojas J. Yasenchak J. Chernomorsky R. Boucher M. Elsasser A.L. Esau L. Zheng J. Griffiths J.A. Wang X. Su H. Xue Y. Dominguez M.G. Noguera I. Torres R. Macdonald L.E. Stewart A.F. DeChiara T.M. Yancopoulos G.D. Nat. Biotechnol. 2003; 21: 652-659Crossref PubMed Scopus (458) Google Scholar, 26Zhang Y. Kim F. Muyrers J.P. Stewart A.F. Nat. Genet. 1998; 20: 123-128Crossref PubMed Scopus (956) Google Scholar). Genotyping of ES cell clones using loss of native allele assay revealed that 12 of 288 clones screened were targeted, indicating a targeting frequency of ∼4.2%. Two independent targeted ES cell lines were used to generate male chimeric mice. Chimeras that were complete transmitters of ES-derived sperm were bred to C57BL/6 females to generate F1 heterozygous mice, which were genotyped by loss of native allele assay. Heterozygous mice were intermated to create homozygous grem1loxP/loxP mice in a mixed 129SvJ/C57BL/6 genetic background. To ensure that none of the genetic manipulations caused a skeletal phenotype, grem1loxP/loxP were compared with wild type littermate controls.Transgenic mice overexpressing the Cre recombinase under the control of a 3.9-kb human osteocalcin promoter (Oc-Cre), created in an FVB genetic background, were obtained from T. Clemens (Birmingham, AL) (27Zhang M. Kim S. Bouxsein M.L. von Stechow D. Akeno N. Faugere M.C. Malluche H. Zhao G. Rosen C.J. Efstratiadis A. Clemens T.L. J. Biol. Chem. 2002; 277: 44005-44012Abstract Full Text Full Text PDF PubMed Scopus (574) Google Scholar). Cre recombinase activity was confirmed in bone tissue by mating osteocalcin Cre transgenics with lacZ-expressing, Gtrosa26tm1Sor test mice, and demonstrating β-galactosidase staining in calvariae following the excision of a loxP-flanked intervening stop codon (not shown) (28Soriano P. Nat. Genet. 1999; 21: 70-71Crossref PubMed Scopus (4134) Google Scholar).Grem1loxP mice were studied in a grem1 heterozygous null background. For this purpose, osteocalcin Cre mice were mated to grem1 heterozygous (grem1+/LacZ) null C57BL/6 mice, obtained from R. Harland (Berkeley), and then intermated for the creation of homozygous osteocalcin Cre mice in a heterozygous grem1+/LacZ null background (grem1+/LacZ:Oc-Cre/Oc-Cre) (21Khokha M.K. Kim D. Brunet L.J. Dionne M.S. Harland R.M. Nat. Genet. 2003; 34: 303-307Crossref PubMed Scopus (298) Google Scholar, 27Zhang M. Kim S. Bouxsein M.L. von Stechow D. Akeno N. Faugere M.C. Malluche H. Zhao G. Rosen C.J. Efstratiadis A. Clemens T.L. J. Biol. Chem. 2002; 277: 44005-44012Abstract Full Text Full Text PDF PubMed Scopus (574) Google Scholar). These were mated with homozygous grem1loxP/loxP mice, generating an experimental cohort, where Cre deletes the loxloxP-flanked sequences from the grem1loxP allele, and where a grem1 null allele is retained (grem1Δ/LacZ), and a control littermate cohort carrying a Cre deleted grem1loxP allele and a wild-type allele (grem1Δ/+). To ensure that the latter were appropriate controls, non-conditional grem1 heterozygous (grem1+/LacZ) null mice were compared with wild-type littermate C57BL/6 mice, obtained from heterozygous/wild-type matings, for their skeletal phenotype. Male mice of identical genetic composition were compared at 4 weeks of age, a time of marked expression of the osteocalcin gene, and at 3 months of age. LacZ/β-galactosidase staining of long bones was carried out in 3-day-old mice. Genotyping of grem1loxP mice was carried out in tail DNA by PCR using the common reverse primer, 5′-AAACAGGAGTGGTCAGCA-3′, and the forward primer, 5′-ACGGGACAGAGGACTGA-3′, for the wild-type allele (328 bp), or the forward primer, 5′-GGTGGGGTGGGATTAGATA-3′, for the targeted loxP allele (696 bp). Genotyping of grem1+/LacZ, grem1Δ/LacZ, and grem1Δ/+ mice was carried out by PCR using forward primer, 5′-AAAGGTTCCCAAGGAGCCATTCC-3′, and reverse primer, 5′-AACAGAAGCGGTTGATGATAGTGCG-3′, for the wild-type allele (300 bp), and forward primer, 5′-GGTCAATCCGCCGTTTGTTCC-3′, and reverse primer, 5′-TAGTCACGCAACTCGCCGCACATC-3′, for the targeted LacZ allele (500 bp). Deletion of loxP flanked sequences by the Cre recombinase was documented by PCR in DNA extracted from calvariae of 1-month-old mice using the forward primer 5′-GGTTGAAAAGTGGGGTCT-3′ and the reverse primer 5′-AAACAGGAGTGGTCA GCA-3′, to create a 670-bp product. Grem1 deletion was confirmed by determination of gremlin mRNA levels by real-time reverse transcription (RT)-PCR in calvarial extracts. Animal experiments were approved by the Animal Care and Use Committee of Saint Francis Hospital and Medical Center.X-ray Analysis and Bone Mineral Density—Radiography was performed on anesthetized or sacrificed mice on a Faxitron x-ray system (model MX 20, Faxitron x-ray Corp., Wheeling, IL). The x-rays were performed at an intensity of 30 kV for 20 s. Bone mineral density (BMD, g/cm2) was measured on anesthetized mice using the PIXImus small animal DEXA system (GE Medical Systems/LUNAR, Madison, WI) (29Nagy T.R. Kim C.W. Li J. J. Bone Miner. Res. 2001; 16: 1682-1687Crossref PubMed Scopus (62) Google Scholar). Calibrations were performed with a phantom of a defined value, and quality assurance measurements were performed prior to each use. The coefficient of variation for total BMD was <1% (n = 9 mice).Bone Histomorphometric Analysis—Static and dynamic histomorphometry was carried out on femurs from experimental and control littermate mice at 1 month and 3 months of age. Mice were injected with calcein, 20 mg/kg, and demeclocycline, 50 mg/kg, at an interval of 2 or 7 days, for 1- or 3-month-old mice, respectively, and sacrificed by CO2 inhalation 2 days after the demeclocycline injection. Femurs were dissected, fixed in 70% ethanol, dehydrated, and embedded undecalcified in methyl methacrylate. Longitudinal sections, 5 μm thick, were cut on a Microm microtome (Microm, Richard-Allan Scientific, Kalamazoo, MI) and stained with 0.1% toluidine blue, pH 6.4, or Von Kossa. Static parameters of bone formation and resorption were measured in a defined area between 725 μm and 1270 μm from the growth plate, using an OsteoMeasure morphometry system (Osteometrics, Atlanta, GA). For dynamic histomorphometry, mineralizing surface per bone surface and mineral apposition rate were measured in unstained sections under ultraviolet light, as described (24Gazzerro E. Kim R.C. Jorgetti V. Olson S. Economides A.N. Canalis E. Endocrinology. 2005; 146: 655-665Crossref PubMed Scopus (144) Google Scholar). The bone formation rate was calculated. The terminology and units used are those recommended by the Histomorphometry Nomenclature Committee of the American Society for Bone and Mineral Research (30Parfitt A.M. Kim M.K. Glorieux F.H. Kanis J.A. Malluche H. Meunier P.J. Ott S.M. Recker R.R. J. Bone Miner. Res. 1987; 2: 595-610Crossref PubMed Scopus (4881) Google Scholar).Expression Analysis of the β-Galactosidase Reporter Gene—Whole mount LacZ/β-galactosidase gene expression was analyzed in 3-day-old femurs and tibiae from grem1Δ/LacZ and grem1Δ/+ controls (31Adams N.C. Kim N.W. Pease S. Lois C. Principle and Practice Mammalian and Avian Trangenesis-New Approaches. Springer-Verlag, New York2006: 131-172Google Scholar). Femurs and tibiae were harvested from 3-day-old mice, and fixed in a 0.4% glutaraldehyde at 4 °C overnight. Tissues were rinsed with phosphate-buffered saline and incubated in LacZ staining solution 4 h at 37 °C, decalcified in Decal-Stat (Decal Co., Tallman, NY) 24 h at 4 °C, and embedded in cryomatrix (Thermofisher, Waltham, MA). 5-μm sections were cut on a cryostat and counterstained with eosin and visualized by microscopy.Bone Marrow Stromal Cell Cultures—Femurs from grem1Δ/LacZ and grem1Δ/+ controls were aseptically removed from 4-week-old mice, after CO2 asphyxiation, and stromal cells were recovered by centrifugation, as described previously (24Gazzerro E. Kim R.C. Jorgetti V. Olson S. Economides A.N. Canalis E. Endocrinology. 2005; 146: 655-665Crossref PubMed Scopus (144) Google Scholar). Cells were plated at a density of 5 × 105 cells/cm2 and cultured in minimum essential medium (α-MEM, Invitrogen) containing 15% fetal bovine serum (Atlanta Biologicals, Norcross, GA) at 37 °C in a humidified 5% CO2 incubator. When cells reached confluence (6-7 days of culture), the medium was changed to α-MEM supplemented with 10% fetal bovine serum, 50 μg/ml ascorbic acid, and 5 mm β-glycerophosphate (Sigma-Aldrich). Cells were cultured for an additional 10- to 16-day period, and serum was deprived overnight, treated with BMP-2 (Wyeth, Collegeville, PA) for 24 h, and analyzed for alkaline phosphatase activity and gremlin mRNA expression.Culture of Cell Lines and RNA Interference—ST-2 cells, cloned stromal cells isolated from bone marrow of BC8 mice, and MC3T3-E1, osteoblastic cells derived from mouse calvariae, were plated at a density of 104 cells/cm2, and grown in a humidified 5% CO2 incubator at 37 °C in α-MEM, supplemented with 10% fetal bovine serum (32Otsuka E. Kim A. Hirose S. Hagiwara H. Am. J. Physiol. 1999; 277: C132-C138Crossref PubMed Google Scholar, 33Sudo H. Kim H.A. Amagai Y. Yamamoto S. Kasai S. J. Cell Biol. 1983; 96: 191-198Crossref PubMed Scopus (1485) Google Scholar). To down-regulate gremlin expression in vitro, a 19-mer double-stranded small interfering (si) RNA targeted to bp 884-902 of grem1 mouse DNA sequence was obtained commercially, and a 19-mer silencing scrambled RNA composed of sequences with no homology to known mouse or rat sequences was used as a control (Ambion, Austin, TX) (34Sharp P.A. Genes Dev. 2001; 15: 485-490Crossref PubMed Scopus (655) Google Scholar, 35Elbashir S.M. Kim J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8081) Google Scholar). Gremlin or scrambled siRNA, all at 20 nm, were transfected into sub-confluent ST-2 or MC3T3 cells using siLentFect lipid reagent, in accordance with manufacturer's instructions (Bio-Rad, Hercules, CA) (36Deregowski V. Kim E. Priest L. Rydziel S. Canalis E. J. Biol. Chem. 2006; 281: 6203-6210Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). To ensure adequate down-regulation, total RNA was extracted in cells 24-96 h following the transfection of siRNAs, and gremlin mRNA levels were determined by real-time RT-PCR. To test for effects on osteoblastic function, transfected cells were allowed to recover for 24 h, and treated with recombinant human BMP-2 or Wnt 3a (R&D Systems, Minneapolis, MN) for 72 h in the presence of 5 mm β-glycerophosphate and ascorbic acid (Sigma-Aldrich) and analyzed for alkaline phosphatase activity. In one experiment, ST-2 cells were allowed to recover for 24 h, treated with BMP-2 for 24 h, and analyzed for osteocalcin and runt-related transcription factor (Runx-2) mRNA expression. To test for effects on BMP or Wnt signaling, cells were allowed to recover for 24 h, transfected with BMP/Smad or Wnt/β-catenin reporter constructs, and treated with BMP or Wnt, as described under “Transient Transfections.” Alternatively, cells were allowed to reach confluence, serum-deprived, and treated with BMP-2 for 20 min to test for effects on Smad1/5/8 phosphorylation by Western blot analysis.Real-time Reverse Transcription-PCR—Total RNA was extracted from calvariae or cell cultures and mRNA levels determined by real-time RT-PCR (37Nazarenko I. Kim R. Lowe B. Obaidy M. Rashtchian A. Nucleic Acids Res. 2002; 30: 2089-2195Crossref PubMed Google Scholar, 38Nazarenko I. Kim B. Darfler M. Ikonomi P. Schuster D. Rashtchian A. Nucleic Acids Res. 2002; 30: e37Crossref PubMed Scopus (218) Google Scholar). For this purpose, 1-10 μg of RNA was reverse-transcribed using SuperScript III Platinum Two-Step qRT-PCR kit (Invitrogen), according to the manufacturer's instructions and amplified in the presence of 5′-CGGTTAGCCGCACTATCATCAAC[FAM]G-3′ and 5′-GTGAACTTCTTGGGCTTGCAGA-3′ primers for gremlin; 5′-CACTTACGGCGCTACCTTGGGTAAGT[FAM]G-3′ and 5′-CCCAGCACAACTCCTCCCTA-3′ primers for osteocalcin; 5′-CACAGGCGACAGTCCCAACTTCCTG[FAM]G-3′ and 5′-CACGGGCAGGGTCTTGTTG-3′ for Runx-2; 5′-CACTCCTGGTGAGCATCTTCGGAG[FAM]G-3′ and 5′-TCGTCGGTAAAGAAAGGCACAC-3′ for FGF-4; 5′-CACGCTCTGGAAAGCTGTGGCG[FAM]G-3′ and 5′-AGCTTCCCGTTCAGCTCTGG-3′ primers for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and Platinum Quantitative PCR SuperMix-UDG (Invitrogen) at 54-60 °C for 45 cycles. Gene copy number was estimated by comparison with a standard curve constructed using gremlin cDNA (Regeneron Pharmaceuticals) and corrected for gapdh (R. Wu, Ithaca, NY) copy number (17Hsu D.R. Kim A.N. Wang X. Eimon P.M. Harland R.M. Mol. Cell. 1998; 1: 673-683Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar, 39Tso J.Y. Kim X.H. Kao T.H. Reece K.S. Wu R. Nucleic Acids Res. 1985; 13: 2485-2502Crossref PubMed Scopus (1757) Google Scholar). Reactions were conducted in a 96-well spectrofluorometric thermal iCycler (Bio-Rad), and fluorescence was monitored during every PCR cycle at the annealing step.Alkaline Phosphatase Activity—Alkaline phosphatase activity (APA) was determined in cell extracts by the hydrolysis of p-nitrophenyl phosphate to p-nitrophenol, and measured by spectroscopy at 405 nm after 10 min of incubation at 25 °C, according to manufacturer's instructions (Sigma-Aldrich). Data are expressed as nanomoles of p-nitrophenol released per minute per microgram of protein. Total protein content was determined in cell extracts by the DC protein assay in accordance with manufacturer's instructions (Bio-Rad).Transient Transfections—To determine changes in BMP-2 signaling under conditions of gremlin RNAi, a construct containing 12 copies of a Smad 1/5 consensus sequence linked to an osteocalcin minimal promoter and a luciferase reporter gene (12×SBE-Oc-pGL3, M. Zhao, Antonio, TX) was tested in transient transfection experiments (40Zhao M. Kim M. Harris S.E. Oyajobi B.O. Mundy G.R. Chen D. J. B

Referência(s)