Prevention of Hepatic Apoptosis and Embryonic Lethality in RelA/TNFR-1 Double Knockout Mice
2000; Elsevier BV; Volume: 156; Issue: 3 Linguagem: Inglês
10.1016/s0002-9440(10)64967-x
ISSN1525-2191
AutoresMaryland E. Rosenfeld, Lisa Prichard, Nobuyoshi Shiojiri, Nelson Fausto,
Tópico(s)Immune Response and Inflammation
ResumoMice deficient in the nuclear factor κB (NF-κB)-transactivating gene RelA (p65) die at embryonic days 14–15 with massive liver apoptosis. In the adult liver, activation of the NF-κB heterodimer RelA/p50 can cause hepatocyte proliferation, apoptosis, or the induction of acute-phase response genes. We examined, during wild-type fetal liver development, the expression of the Rel family member proteins, as well as other proteins known to be important for NF-κB activation. We found these proteins and active NF-κB complexes in the developing liver from at least 2 days before the onset of lethality observed in RelA knockouts. This suggests that the timing of NF-κB activation is not related to the timing of lethality. We therefore hypothesized that, in the absence of RelA, embryos were sensitized to tumor necrosis factor (TNF) receptor 1 (TNFR-1)-mediated apoptosis. Thus, we generated mice that were deficient in both RelA and TNFR-1 to determine whether apoptotic signaling through TNFR-1 was responsible for the lethal phenotype. RelA/TNFR-1 double knockout mice survived embryonic development and were born with normal livers without evidence of increased hepatocyte apoptosis. These animals became runted shortly after birth and survived an average of 10 days, dying from acute hepatitis with an extensive hepatic infiltration of immature neutrophils. We conclude that neither RelA nor TNFR-1 is required for liver development and that RelA protects the embryonic liver from TNFR-1-mediated apoptotic signals. However, the absence of both TNFR-1 signaling and RelA activity in newborn mice makes these animals susceptible to endogenous hepatic infection. Mice deficient in the nuclear factor κB (NF-κB)-transactivating gene RelA (p65) die at embryonic days 14–15 with massive liver apoptosis. In the adult liver, activation of the NF-κB heterodimer RelA/p50 can cause hepatocyte proliferation, apoptosis, or the induction of acute-phase response genes. We examined, during wild-type fetal liver development, the expression of the Rel family member proteins, as well as other proteins known to be important for NF-κB activation. We found these proteins and active NF-κB complexes in the developing liver from at least 2 days before the onset of lethality observed in RelA knockouts. This suggests that the timing of NF-κB activation is not related to the timing of lethality. We therefore hypothesized that, in the absence of RelA, embryos were sensitized to tumor necrosis factor (TNF) receptor 1 (TNFR-1)-mediated apoptosis. Thus, we generated mice that were deficient in both RelA and TNFR-1 to determine whether apoptotic signaling through TNFR-1 was responsible for the lethal phenotype. RelA/TNFR-1 double knockout mice survived embryonic development and were born with normal livers without evidence of increased hepatocyte apoptosis. These animals became runted shortly after birth and survived an average of 10 days, dying from acute hepatitis with an extensive hepatic infiltration of immature neutrophils. We conclude that neither RelA nor TNFR-1 is required for liver development and that RelA protects the embryonic liver from TNFR-1-mediated apoptotic signals. However, the absence of both TNFR-1 signaling and RelA activity in newborn mice makes these animals susceptible to endogenous hepatic infection. The NF-κB transcription factor modulates gene expression in many cellular responses, including inflammation, apoptosis, and liver regeneration.1Wulczyn FG Krappmann D Scheidereit C The NF-κB/Rel, and IκB gene families: mediators of immune response and inflammation.J Mol Med. 1996; 74: 749-769Crossref PubMed Scopus (245) Google Scholar, 2Sonenshein GE Rel/NF-κB transcription factors, and the control of apoptosis.Sem Cancer Biol. 1997; 8: 113-119Crossref PubMed Scopus (218) Google Scholar, 3Yamada Y Kirillova I Peschon JJ Fausto N Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type 1 tumor necrosis factor receptor.Proc Natl Acad Sci USA. 1997; 94: 1441-1446Crossref PubMed Scopus (827) Google Scholar The NF-κB transactivating subunit, RelA (p65), plays a critical role in mouse liver development because RelA−/− mice die during mid-gestation from massive hepatocyte apoptosis.4Beg AA Sha WC Bronson RT Ghosh S Baltimore D Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-κB.Nature. 1995; 376: 167-170Crossref PubMed Scopus (1625) Google Scholar, 5Doi TS Takahashi T Taguchi O Azuma T Obata Y NF-κB relA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses.J Exp Med. 1997; 185: 953-961Crossref PubMed Scopus (244) Google Scholar Whereas much work has been done establishing the roles of NF-κB/Rel proteins in adult tissues, (for recent review, see6Ghosh S May MJ Kopp EB NF-κB, and Rel proteins: evolutionarily conserved mediators of immune responses.Annu Rev Immunol. 1998; 16: 225-260Crossref PubMed Scopus (4570) Google Scholar), little is known about their functions in the developing animal. Except for RelA−/− mice, other Rel knockouts have not demonstrated critical roles for Rel proteins during development.7Kontgen F Grumont RJ Strasser A Metcalf D Li R Tarlinton D Gerondakis S Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression.Genes Dev. 1995; 9: 1965-1977Crossref PubMed Scopus (636) Google Scholar, 8Weih F Carrasco D Durham SK Barton DS Rizzo CA Ryseck R-P Lira SA Bravo R Multiorgan inflammation and hematopoietic abnormalities in mice with a targeted disruption of RelB, a member of the NF-κB/Rel family.Cell. 1995; 80: 331-340Abstract Full Text PDF PubMed Scopus (707) Google Scholar, 9Beg AA Sha WC Bronson RT Baltimore D Constitutive NF-κB activation, enhanced granulopoiesis, and neonatal lethality in IκBα-deficient mice.Genes Dev. 1995; 9: 2736-2746Crossref PubMed Scopus (408) Google Scholar Schmidt-Ullrich et al generated transgenic mice expressing a NF-κB-driven LacZ reporter gene construct to provide information on the timing and cellular location of NF-κB activation during murine development. NF-κB activity was detected late in development, with no evidence of LacZ-positive cells until E12.5. Furthermore, NF-κB transactivation was predominantly noted within the developing brain, spinal medulla, and thymus of their transgenic lines. Only one of their transgenic lines showed any expression in the fetal liver, starting at E13.10Schmidt-Ullrich R Memet S Lilienbaum A Feuillard J Raphael M Israel A NF-κB activity in transgenic mice: developmental regulation and tissue specificity.Development. 1996; 122: 2117-2128PubMed Google Scholar Thus, the finding by Beg et al that RelA−/− embryos die of massive liver apoptosis is particularly intriguing because of the lack of demonstration of NF-κB activation during mouse liver development.The tumor necrosis factor (TNF) rapidly and potently activates NF-κB in a variety of cell types, including adult hepatocytes. TNF mediates its cellular responses by signaling through two receptors, TNFR-1 and TNFR-2, but most of its biological functions are signaled through TNFR-1.11Liu Z-G Hsu H Goeddel DV Karin M Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-κB activation prevents cell death.Cell. 1996; 87: 565-576Abstract Full Text Full Text PDF PubMed Scopus (1778) Google Scholar, 12Baker SJ Reddy EP Transducers of life and death: TNF receptor superfamily and associated proteins.Oncogene. 1996; 12: 1-9PubMed Google Scholar TNFR-1 is a death domain-containing receptor that, on ligand binding and trimerization, recruits the adapter protein TRADD. The signals elicited in response to TNF bifurcate at the level of TRADD binding. The overexpression of TRADD stimulates both apoptosis and NF-κB activation through differential binding domains.13Hsu H Xiong J Goeddel DV The TNF receptor 1-associated protein TRADD signals cell death, and NF-κB activation.Cell. 1995; 81: 495-504Abstract Full Text PDF PubMed Scopus (1734) Google Scholar The C-terminal portion of TRADD binds the death domain-containing protein FADD, resulting in apoptosis.14Hsu H Shu H-B Pan M-G Goeddel DV TRADD-TRAF2, and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways.Cell. 1996; 84: 299-308Abstract Full Text Full Text PDF PubMed Scopus (1725) Google Scholar The N-terminal portion of TRADD binds the TNF receptor-associated factor 2 (TRAF-2), and other more recently identified proteins such as RIP, ultimately resulting in the activation of NF-κB.15Rothe M Sarma V Dixit VM Goeddel DV TRAF2-mediated activation of NF-kappa B by TNF receptor 2, and CD40.Science. 1995; 269: 1424-1427Crossref PubMed Scopus (972) Google Scholar, 16Hsu H Huang J Shu H-B Baichwal V Goeddel DV TNF-dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex.Immunity. 1996; 4: 387-396Abstract Full Text Full Text PDF PubMed Scopus (972) Google ScholarNF-κB activation is initiated by its release from the cytoplasmic inhibitory proteins IκBα or IκBβ.17Henkel T Machleidt T Alkalay I Kronke M Ben-Neriah Y Baeuerle PA Rapid proteolysis of IκB-α is necessary for activation of transcription factor NF-κB.Nature. 1993; 365: 182-185Crossref PubMed Scopus (1034) Google Scholar Two IκB kinases, IKK-1 and IKK-2, which are responsible for phosphorylating IκB proteins, are components of a large multisubunit complex.18Zandi E Rothwarf DM Delhase M Hayakawa M Karin M The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation.Cell. 1997; 91: 243-252Abstract Full Text Full Text PDF PubMed Scopus (1570) Google Scholar, 19DiDonato JA Hayakawa M Rothwarf DM Zandi E Karin M A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB.Nature. 1997; 388: 548-554Crossref PubMed Scopus (1896) Google Scholar Phosphorylation of IκB leads to its ubiquitination and subsequent degradation by the proteasome, resulting in nuclear translocation of NF-κB.20Traenckner EB-M Wilk S Baeuerle PA A proteasome inhibitor prevents activation of NF-κB and stabilizes a newly phosphorylated form of IκB-α that is still bound to NF-κB.EMBO J. 1994; 13: 5433-5441Crossref PubMed Scopus (652) Google Scholar, 21Brown K Gerstberger S Carlson L Franzoso G Siebenlist U Control of IκB-α proteolysis by site-specific, signal-induced phosphorylation.Science. 1995; 267: 1485-1488Crossref PubMed Scopus (1310) Google Scholar Recent work has shown that IKK-2 knockouts die during development of liver degeneration and apoptosis, similar to RelA knockouts.22Li Q Van Antwerp D Mercurio F Lee K-F Verma IM Severe liver degeneration in mice lacking the IκB kinase 2 gene.Science. 1999; 284: 321-325Crossref PubMed Scopus (848) Google Scholar, 23Tanaka M Fuentes ME Yamaguchi K Durnin MH Dalrymple SA Hardy KL Goeddel DV Embryonic lethality, liver degeneration, and impaired NF-κB activation in IKK-β-deficient mice.Immunity. 1999; 10: 421-429Abstract Full Text Full Text PDF PubMed Scopus (490) Google Scholar This suggests that IKK-2 is directly responsible for activating NF-κB in the developing liver.Work from this and other laboratories demonstrated that TNF is required for the initiation of liver regeneration in mice, and that its proliferative effect on hepatocytes is strictly dependent on signaling through TNFR-1.3Yamada Y Kirillova I Peschon JJ Fausto N Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type 1 tumor necrosis factor receptor.Proc Natl Acad Sci USA. 1997; 94: 1441-1446Crossref PubMed Scopus (827) Google Scholar, 24Yamada Y Webber EM Kirillova I Peschon JJ Fausto N Analysis of liver regeneration in mice lacking type 1 or type 2 tumor necrosis factor receptor: requirement for type 1 but not type 2 receptor.Hepatology. 1998; 28: 959-970Crossref PubMed Scopus (214) Google Scholar Mice lacking TNFR-1 have high mortality during the early stages of liver regeneration and the surviving animals have a deficit in DNA replication. TNFR-1−/− mice fail to activate the transcription factors NF-κB and STAT3 at the start of liver regeneration. However, DNA synthesis can be restored in these animals by interleukin 6 (IL-6) injection, which also restores STAT3 but not NF-κB activation.3Yamada Y Kirillova I Peschon JJ Fausto N Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type 1 tumor necrosis factor receptor.Proc Natl Acad Sci USA. 1997; 94: 1441-1446Crossref PubMed Scopus (827) Google Scholar These and other experiments25Cressman DE Greenbaum LE DeAngelis RA Ciliberto G Furth EE Poli V Taub R Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice.Science. 1996; 274: 1379-1383Crossref PubMed Scopus (1300) Google Scholar, 26Akerman P Cote P Yang SQ McClain C Nelson S Bagby GJ Diehl AM Antibodies to tumor necrosis factor-α inhibit liver regeneration after partial hepatectomy.Am J Physiol. 1992; 263: G579-G585PubMed Google Scholar show that, on one hand, TNF, signaling through TNFR-1 and downstream activation of NF-κB, IL-6, and STAT3, is an important proliferative agent for hepatocytes. On the other hand, direct blockage of NF-κB activation, both in vivo and in hepatocyte cultures, switches the biological effect of TNF from proliferative to apoptotic.27Van Antwerp DJ Martin SJ Kafri T Green DR Verma IM Suppression of TNF-α-induced apoptosis by NF-κB.Science. 1996; 274: 787-789Crossref PubMed Scopus (2440) Google Scholar, 28Beg AA Baltimore D An essential role for NF-κB in preventing TNF-α-induced cell death.Science. 1996; 274: 782-784Crossref PubMed Scopus (2925) Google Scholar, 29Wang C-Y Mayo MW Baldwin Jr, AS TNF-and cancer therapy-induced apoptosis: potentiation by inhibition of NF-κB.Science. 1996; 274: 784-787Crossref PubMed Scopus (2499) Google Scholar, 30Arsura M FitzGerald MJ Fausto N Sonenshein GE Nuclear factor-κB/Rel blocks transforming growth factor β1-induced apoptosis of murine hepatocyte cell lines.Cell Growth Differ. 1997; 8: 1049-1059PubMed Google Scholar If, as in liver regeneration, TNFR-1−/− mice fail to activate NF-κB during liver development, it is surprising that these mice develop normally and show no obvious signs of hepatic apoptosis.To examine whether TNFR-1-mediated signaling is responsible for the lethal phenotype of RelA knockouts, we generated mice deficient in both RelA and TNFR-1. We show that double-knockout mice survive embryonic development and that gestation in these animals is apparently unaffected because newborn mice have normal liver morphology with little detectable apoptosis. Thus, RelA−/− mice die from apoptotic signals mediated through TNFR-1 during liver development. RelA and p50, the components necessary for NF-κB activation, are present during fetal liver development in wild-type (WT) mice from at least E12, suggesting that the timing of NF-κB activation is not related to the timing of embryonic lethality in RelA−/− mice. Survival of the RelA/TNFR-1 double knockouts suggests that neither RelA nor TNFR-1 is critical for hepatic development in mice. However, newborn animals with these deficiencies become sensitive to infection and the neutrophilic invasion that cause damage to the liver and other organs, resulting in early postnatal mortality.Materials and MethodsAnimalsThe C57BL/6J (WT) mice were obtained from Jackson Laboratories (Bar Harbor, ME).The RelA heterozygous breeder mice were obtained from Amer Beg (Columbia University, New York, NY), and the TNFR-1 knockout mice have been previously described.3Yamada Y Kirillova I Peschon JJ Fausto N Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type 1 tumor necrosis factor receptor.Proc Natl Acad Sci USA. 1997; 94: 1441-1446Crossref PubMed Scopus (827) Google Scholar To obtain fetal samples, timed matings were performed, and the presence of a vaginal plug the following morning was considered embryonic day 0 (E0). To generate mice deficient in both RelA and TNFR-1, RelA+/− females were crossed with TNFR-1−/− males producing double heterozygous RelA+/−/TNFR-1+/− offspring that were subsequently back crossed. The breeding cages from RelA+/−/TNFR-1+/− matings were examined daily, and the first day that pups were found in the cage was considered day 1 of postnatal life. The number of pups born to each female was recorded, and, within 24 hours, a small piece of tail was removed from each newborn for DNA analysis.Animals were maintained in a specific pathogen-free facility under 12-hour dark/light cycles and given standard diet and water ad libitum. All animal work was in accordance with policies at the University of Washington.Isolation of Murine Liver SamplesFor isolation of fetal livers, pregnant mice were sacrificed between E12 and E19. Fetuses were dissected free of extra embryonic membranes and decidual tissue and placed in phosphate-buffered saline. livers were carefully removed under a dissecting microscope at 30×. For the isolation of neonatal livers, newborn pups were killed at 2, 4, 7, and 16 days of age, and livers were carefully dissected from the animal.Polymerase Chain Reaction (PCR) GenotypingFor fetal samples, a portion of the brain was isolated from each sample. For newborns, a small piece of tail was removed. All samples were digested in GNTK buffer, (50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.5, 0.01. gelatin, 0.45% Nonidet P-40, 0.45% Tween-20) supplemented with 100 μg/ml proteinase K at 55°C. Proteinase K was heat inactivated, and 1–3 μl of the extract was used in PCR. For RelA PCR, a three-primer reaction amplified a 120-bp fragment of the WT allele and a 160-bp fragment of the RelA mutant allele. For TNFR-1, a four-primer PCR reaction amplified a 120-bp fragment of the WT allele and a 155-bp fragment of the mutant allele. The PCR products were run on 2% agarose (SeaKem, FMC BioProducts, Rockland, ME) gels and visualized with a UVP gel documentation system (Upland, CA).Protein ExtractionsWhole-cell extracts from the fetal livers were isolated by resuspension in a tissue lysis buffer (20 mmol/L 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.5, 2 mmol/L ethylene glycol bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 10. glycerol, 1% Tween-20, 1 mmol/L dithiothreitol, 0.5 mmol/L phenylmethyl sulfonyl fluoride, 0.5 mmol/L benzamidine-HCl, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 10 μg/ml pepstatin A) and incubated on ice for 30 minutes. Extracts were cleared by centrifugation at 4°C at 16,000 × g for 15 minutes and stored at −80°C. Whole-cell extracts from the newborn-liver samples were homogenized in a glass homogenizer in 0.5–1 ml of the tissue lysis buffer before incubation on ice and centrifugation.Nuclear extracts from the fetal liver were isolated in a manner similar to the methods described by Han and Brasier.31Han Y Brasier AR Mechanism for biphasic Rel A NF-κB1 nuclear translocation in tumor necrosis factor α-stimulated hepatocytes.J Biol Chem. 1997; 272: 9825-9832Crossref PubMed Scopus (84) Google Scholar All buffers were supplemented with the following protease inhibitors before use: 240 μg/ml antipain, 2 μg/ml aprotinin, 0.01 mol/L benzamidine-HCl, 0.2 mmol/L dithiothreitol, 10 μg/ml leupeptin, 10 μg/ml pepstatin A, 0.5 mmol/L phenylmethyl sulfonyl fluoride, 0.15 μmol/L spermine, 0.5 μmol/L spermidine. In a brief description of the procedure, livers were resuspended in Buffer A (50 mmol/L HEPES, pH 7.4, 10 mmol/L KCl, 1 mmol/L ethylenediaminetetraacetic acid (EDTA), 1 mmol/L EGTA, 0.5% Nonidet P-40) and kept on ice for at least 10 minutes. The samples were cleared by centrifugation at 4°C at 4000 × g for 5 minutes. Pellets were resuspended in 200–500 μl of buffer B (1.7 mol/L sucrose, 50 mmol/L HEPES, pH 7.4, 10 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA) and centrifuged at 4°C at 16,000 × g for 30 minutes. Pellets were resuspended in buffer C (10% glycerol, 50 mmol/L HEPES, pH 7.4, 400 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA), incubated on ice for 30 minutes with frequent vortexing, and centrifuged at 4°C at 16,000 × g for 5 minutes. Extracts were stored at −80°C.Nuclear extracts from newborn livers were isolated as previously described.3Yamada Y Kirillova I Peschon JJ Fausto N Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type 1 tumor necrosis factor receptor.Proc Natl Acad Sci USA. 1997; 94: 1441-1446Crossref PubMed Scopus (827) Google ScholarWestern BlotProtein was quantitated by the Bradford method (Bio-Rad, Hercules, CA) and 25 μg of protein per lane was resolved on a 10% sodium dodecyl sulfate-polyacrylamide gel. The gels were transferred to nitrocellulose membranes (Amersham, Piscataway, NJ) and blocked overnight at 4°C in Tris-buffered saline containing 0.1. Tween-20 and 5% nonfat milk. Antibodies were obtained from Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA). RelA (#SC-372-G), IκBα (#SC-371), and IκBβ (#SC-945) were used at 1:2000 dilutions and TRAF-2 (#SC-876) was used at 1:1000 dilution. The membranes were incubated for one hour at room temperature, washed with Tris buffered saline-T, and bound with the appropriate horseradish peroxidase-conjugated secondary antibody; blots were washed and, subsequently, detected by ECL (Amersham).Electrophoretic Mobility Shift Assay (EMSA)Four μg of nuclear protein were preincubated at room temperature for 10 minutes in a binding buffer (20 mmol/L HEPES, pH 7.5, 60 mmol/L KCl, 5 mmol/L MgCl2, 0.2 mmol/L EDTA, 8. glycerol, 1 μg poly dI/dC, 1% Nonidet P-40, 0.1 mmol/L dithiothreitol, 0.1 mmol/L phenylmethyl sulfonyl fluoride). A [32P]-labeled probe (1 × 105 cpm) was added per reaction, and incubation was continued for an additional 30 minutes. Double-stranded probes were obtained from Santa Cruz Biotechnologies, Inc. The NF-κB binding sequence probe used is 5′ AGTTGAGGGGACTTTCCCAGGC 3′. The SIE binding sequence probe used for Stat3 is 5′ GTGCATTTCCCGTAAATCTTGTCTACA 3′. Reactions were electrophoresed through a 5% polyacrylamide, 1× Tris-glycine-EDTA gel. For binding specificity, an unlabeled probe was added to one reaction 30 minutes before the addition of the labeled probe. For supershifts, after the 30-minute incubation of the labeled probe, specific antibodies obtained from Santa Cruz Biotechnologies, Inc. (RelA #SC-372X, p50 #SC-114X, p52 #SC-298X, c-Rel #SC-70X, and Stat3 #SC-482X) were added to indicated samples for an additional 30 minutes. The gels were dried and exposed to film for the detection of bands.ImmunohistochemistryEmbryos isolated at each gestational stage were fixed overnight in 10% buffered-formalin (Fisher Scientific, Pittsburgh, PA) and processed for paraffin embedding. The sections were cut onto glass slides and processed for immunohistochemistry by using the VECTASTAIN ABC kit and protocol (Vector Laboratories, Burlingame, CA). Antibodies were used at 1:100 dilution, and the control reactions were performed with an antibody prebound to a control peptide (Santa Cruz) before incubation on the slide (data not shown). The RelA, IκBα and TRAF-2 antibodies were the same as those used in Western blots. TNF- #SC-1348 and TNFR-1 #SC-1069 were also used. Biotinylated secondary antibodies and VECTASTAIN ABC solution were used at 1:100 dilutions. Antigen detection was through diaminobenzidine tetrahydrochloride (Sigma, St. Louis, MO) staining. The slides were counterstained with hematoxylin (Sigma).HistologyThe samples from newborn pups were fixed overnight in 10. buffered formalin (Fischer Scientific) and processed for paraffin embedding. The sections were cut onto glass slides and processed for routine hematoxylin and eosin staining.ResultsExpression of RelA Protein in WT Fetal Livers Does Not Correlate with Timing of Embryonic Lethality in RelA−/− MiceRelA−/− mice die within a specific time period during development (E14–E15). Therefore, we first investigated in WT (C57BL/6J) mice whether the appearance of RelA during liver development would coincide with the time of lethality observed in RelA knockouts. Whole cell protein samples were obtained from fetal livers of WT mice between E12 and E19. The top panel of Figure 1 demonstrates that RelA protein was present throughout liver development, from at least E12. These livers also contained the p50 subunit of NF-κB (data not shown), indicating that the components of the classic NF-κB heterodimer were present from a very early stage of liver formation.In many adult cell types, including hepatocytes, NF-κB is retained in an inactive complex with an inhibitory IκB protein.17Henkel T Machleidt T Alkalay I Kronke M Ben-Neriah Y Baeuerle PA Rapid proteolysis of IκB-α is necessary for activation of transcription factor NF-κB.Nature. 1993; 365: 182-185Crossref PubMed Scopus (1034) Google Scholar, 32Lin Y-C Brown K Siebenlist U Activation of NF-κB requires proteolysis of the inhibitor IκB-α: signal-induced phosphorylation of IκB-α alone does not release active NF-κB.Proc Natl Acad Sci USA. 1995; 92: 552-556Crossref PubMed Scopus (256) Google Scholar Examination of IκBα and IκBβ proteins in WT fetal livers demonstrated expression from E12 through E19 (Figure 1, middle panels). Because RelA, p50, IκBα, and IκBβ were all expressed in the fetal liver from the earliest time points analyzed, these data demonstrate that embryonic lethality in RelA−/− mice (E14–E15) does not correspond to a critical time when expression of these proteins becomes necessary in the fetal liver.Proteins have been identified in the TNF-signaling pathway that are important for the activation of NF-κB. TRAF-2 is a TNFR-associated factor downstream of TNFR-1 that is important for NF-κB activation after TNF stimulation.15Rothe M Sarma V Dixit VM Goeddel DV TRAF2-mediated activation of NF-kappa B by TNF receptor 2, and CD40.Science. 1995; 269: 1424-1427Crossref PubMed Scopus (972) Google Scholar TRAF-2 is recruited to the TNFR-1 signaling pathway by the adapter molecule TRADD.14Hsu H Shu H-B Pan M-G Goeddel DV TRADD-TRAF2, and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways.Cell. 1996; 84: 299-308Abstract Full Text Full Text PDF PubMed Scopus (1725) Google Scholar Both TRAF-2 (Figure 1, bottom panel) and TRADD (data not shown) were expressed in the E12–E19 embryonic liver.IκBα and IκBβ Protein Levels Are Altered during Fetal Liver Development of RelA Knockouts but Not TNFR-1 KnockoutsWe next examined whether the expression of RelA, IκBα, IκBβ, TRAF-2, and TRADD was altered in fetal livers of RelA or TNFR-1 knockouts. We compared the expression of these proteins to WT mice at E12–E14 (Figure 2). As expected, RelA was absent from RelA knockouts. In addition, the IκBα expression in the RelA−/− fetal liver was decreased, and IκBβ was undetectable. In contrast, levels of RelA, IκBα, and IκBβ in TNFR-1 knockouts were similar to those observed in WT mice. It should be noted that, in these samples, the level of the IκBβ expression is lower at E12 when compared with E13 and E14. These results suggest that, within the developing liver, NF-κB participates in the regulation of IκBα. On the other hand, there appears to be a strict dependence of the IκBβ protein on NF-κB because this protein was not detectable in RelA knockouts. All of these proteins were normally expressed in TNFR-1−/− fetal livers, indicating that TNFR-1 does not mediate the signal for the activation of these genes. The expression of TRAF-2 (Figure 2, bottom panel) and TRADD (data not shown) was similar in WT mice and in RelA and TNFR-1 knockouts during these days of gestation. The evidence of TRADD and TRAF-2 proteins in the RelA−/− fetal liver also illustrates that not all proteins are aberrantly expressed in the developing liver of RelA knockouts.Figure 2Protein expression in the fetal livers of WT mice, RelA knockouts, and TNFR-1 knockouts. Western blots were performed with RelA, IκBα, IκBβ, and TRAF-2 antibodies. Lanes indicate fetal liver protein from E12, E13 and E14 for WT fetal livers, RelA−/− fetal livers and TNFR-1−/− fetal livers. RelA−/− fetal livers illustrate absent RelA and IκBβ proteins, diminished IκBα protein, and unaltered TRAF-2 protein levels. WT and TNFR-1−/− fetal livers express all proteins.View Large Image Figure ViewerDownload Hi-res image Download (PPT)WT and TNFR-1−/− Fetal Livers Have Active NF-κB and STAT3 during Development, whereas RelA−/− Fetal Livers Have Only Active STAT3To determine whether the NF-κB proteins detected by Western blot were capable of binding DNA, indicative of an active protein complex, we performed EMSA using nuclear protein isolated from WT mice, TNFR-1 knockout, and RelA knockout fetal livers between 12 and 14 days gestation. The NF-κB complex formation occurred in WT (Figure 3A) and, surprisingly, also in TNFR-1−/− (Figure 3B) fetal livers. In these samples, as in adult liver, NF-κB was composed of RelA/p50 heterodimers (top band) and p50 homodimers (bottom band). Nuclear protein isolated from E12–E14 RelA−/− fetal livers only demonstrated p50 homodimer formation (Figure 3C). This suggests that the lack of RelA is not compensated for by the formation of other NF-κB heterodimers. RelA and p50 specificity was determined by supershift analyses (shown in Figure 3, B and C). These figures seem to indicate that, in TNFR-1−/− fetal livers, the amount of NF-κB binding decreases with age, whereas in WT samples the inverse is seen. However, this was not a consistent finding when multiple fetal liver samples were analyzed at these gestationa
Referência(s)