Portal de Periódicos da CAPES

Impaired Mitochondrial Glutamate Transport in Autosomal Recessive Neonatal Myoclonic Epilepsy

2005; Elsevier BV; Volume: 76; Issue: 2 Linguagem: Inglês

10.1086/427564

1537-6605

Florence Molinari, Annick Raas‐Rothschild, Marlène Rio, Giuseppe Fiermonte, Féréchté Encha‐Razavi, Luigi Palmieri, Ferdinando Palmieri, Ziva Ben‐Neriah, Noman Kadhom, Michel Vekemans, Tania Attié‐Bitach, Arnold Münnich, Pierre Rustin, Laurence Colleaux,

Neuroscience and Neuropharmacology Research

Severe neonatal epilepsies with suppression-burst pattern are epileptic syndromes with either neonatal onset or onset during the first months of life. These disorders are characterized by a typical electroencephalogram pattern—namely, suppression burst, in which higher-voltage bursts of slow waves mixed with multifocal spikes alternate with isoelectric suppression phases. Here, we report the genetic mapping of an autosomal recessive form of this condition to chromosome 11p15.5 and the identification of a missense mutation (p.Pro206Leu) in the gene encoding one of the two mitochondrial glutamate/H+ symporters (SLC25A22, also known as "GC1"). The mutation cosegregated with the disease and altered a highly conserved amino acid. Functional analyses showed that glutamate oxidation in cultured skin fibroblasts from patients was strongly defective. Further studies in reconstituted proteoliposomes showed defective [14C]glutamate uniport and [14C]glutamate/glutamate exchange by mutant protein. Moreover, expression studies showed that, during human development, SLC25A22 is specifically expressed in the brain, within territories proposed to contribute to the genesis and control of myoclonic seizures. These findings provide the first direct molecular link between glutamate mitochondrial metabolism and myoclonic epilepsy and suggest potential insights into the pathophysiological bases of severe neonatal epilepsies with suppression-burst pattern. Severe neonatal epilepsies with suppression-burst pattern are epileptic syndromes with either neonatal onset or onset during the first months of life. These disorders are characterized by a typical electroencephalogram pattern—namely, suppression burst, in which higher-voltage bursts of slow waves mixed with multifocal spikes alternate with isoelectric suppression phases. Here, we report the genetic mapping of an autosomal recessive form of this condition to chromosome 11p15.5 and the identification of a missense mutation (p.Pro206Leu) in the gene encoding one of the two mitochondrial glutamate/H+ symporters (SLC25A22, also known as "GC1"). The mutation cosegregated with the disease and altered a highly conserved amino acid. Functional analyses showed that glutamate oxidation in cultured skin fibroblasts from patients was strongly defective. Further studies in reconstituted proteoliposomes showed defective [14C]glutamate uniport and [14C]glutamate/glutamate exchange by mutant protein. Moreover, expression studies showed that, during human development, SLC25A22 is specifically expressed in the brain, within territories proposed to contribute to the genesis and control of myoclonic seizures. These findings provide the first direct molecular link between glutamate mitochondrial metabolism and myoclonic epilepsy and suggest potential insights into the pathophysiological bases of severe neonatal epilepsies with suppression-burst pattern. Severe neonatal epilepsies with suppression-burst pattern are early-onset epileptic syndromes characterized by a typical electroencephalogram (EEG) pattern—namely, suppression burst, in which higher-voltage bursts of slow waves mixed with multifocal spikes alternate with isoelectric suppression phases (Ohtsuka et al. Ohtsuka et al., 1993Ohtsuka Y Oka E Terasaki T Ohtahara S Aicardi syndrome: a longitudinal clinical and electroencephalographic study.Epilepsia. 1993; 34: 627-634Crossref PubMed Scopus (41) Google Scholar; Vigevano and Bartuli Vigevano and Bartuli, 2002Vigevano F Bartuli A Infantile epileptic syndromes and metabolic etiologies.J Child Neurol. 2002; 17: S9-S13Google Scholar). Early myoclonic encephalopathy (EME), first described by Aicardi and Goutières in Aicardi and Goutières, 1978Aicardi J Goutières F [Neonatal myoclonic encephalopathy.].Rev Electroencephalogr Neurophysiol Clin. 1978; 8: 99-101Crossref PubMed Scopus (96) Google Scholar, is characterized by a very early onset (during the 1st month of life); erratic, fragmentary myoclonus; massive myoclonus; partial motor seizures; and late tonic spasms (Aicardi and Goutières Aicardi and Goutières, 1978Aicardi J Goutières F [Neonatal myoclonic encephalopathy.].Rev Electroencephalogr Neurophysiol Clin. 1978; 8: 99-101Crossref PubMed Scopus (96) Google Scholar; Aicardi Aicardi, 1992Aicardi J Early myoclonic encephalopathy.in: Roger J Bureau M Dravet C Dreifuss FE Perret A Wolf P Epileptic syndromes in infancy, childhood and adolescence. 2nd ed. John Libbey, London1992: 13-23Google Scholar). The prognosis of EME is poor, with no effective treatment, and children with the condition either die within 1–2 years after birth or survive in a persistent vegetative state. The lack of consistent neuropathological features suggests that etiology may vary from case to case. EME has been reported in nonketotic hyperglycinemia (MIM 605899), propionic acidemia (MIM 606054), and some malformative disorders (Guerrini et al. Guerrini et al., 2003Guerrini R Sicca F Parmeggiani L Epilepsy and malformations of the cerebral cortex.Epileptic Disord. 2003; 5: S9-S26PubMed Google Scholar). In most cases, however, the underlying mechanism of these disorders remains unknown. Early infantile epileptic encephalopathy, which includes West syndrome and Lennox-Gastaut syndrome, is characterized by a very early onset (during the first few months of life), frequent tonic spasms, and a suppression-burst EEG pattern. Partial motor seizures may also occur. The course is severe, with early death or marked psychomotor retardation and intractable seizures with frequent evolution to West syndrome. Brain imaging usually discloses gross structural abnormalities, in the majority of cases. Metabolic disorders are also present in a few cases, but the proportion of cryptogenic cases is high. We have investigated a sibship of four affected children (two girls and two boys) and four healthy children born to Arab Muslim parents from Jerusalem who are first cousins (fig. 1A). The proband (patient II.7 in fig. 1A) was first examined at age 2 d because of intractable seizures and neonatal hypotonia. At age 3 years, computerized tomography of the head revealed brain atrophy, and EEG showed myoclonic seizures and burst suppression. Nonketotic hyperglycinemia was ruled out. His eldest sister (patient II.1 in fig. 1A) also had hypotonia and seizures a few hours after birth. Computerized tomography of the head at age 3 years showed brain atrophy. Electroretinogram (ERG) was normal, whereas visual-evoked potential (VEP) showed a low amplitude signal and a slow response suggestive of abnormal visual nerve-conduction velocity. Electron-microscopy examination of a skin biopsy ruled out storage disease, and high-resolution karyotype was normal. The eldest brother (patient II.2 in fig. 1A) also had hypotonia and neonatal myoclonic seizures. Plasma amino acid, copper, biotinidase lactate, carnitine, and urinary organic acids were normal. He died at age 8 years. Finally, the fourth affected child (patient II.4 in fig. 1A) was hypotonic and presented with neonatal seizures. At age 7 wk, ERG-VEP examination showed abnormal conduction and retinal function. At 3 years of age, brain magnetic resonance imaging (MRI) showed subarachnoid enlargement, especially in the frontal region. EEG showed myoclonic seizures with burst suppression. Extensive metabolic work-up was consistently normal. Electron-microscopy examination of skin fibroblasts and optic examination of muscle biopsy were normal as well. In conclusion, very-early-onset intractable myoclonus epilepsy with progressive microcephaly, periodic EEG with suppression burst, and abnormal VEPs evolving into a severe encephalopathy and spasticity were consistent features in the four affected siblings. A genomewide screening, performed using the Perkin Elmer Biosystems linkage mapping set (version 1), identified a single homozygous marker, D11S4046, on chromosome 11p15.5 in the four affected sibs. Further marker typing and haplotype analyses reduced the genetic interval to a 2.5-Mb interval between marker D11S4088 and the telomere (fig. 1A). Linkage analysis using LINKAGE software (version M-LINK) gave a Zmax of 3.06 at θ=0 at the D11S4177 locus. Concordant data from the National Center for Biotechnology Information (NCBI) and the University of California–Santa Cruz (UCSC) database genome browsers indicate that 54 known genes and ∼25 EST clusters map to this interval. On the basis of the hypothesis that this condition is of metabolic origin, nine genes were considered as candidates (fig. 1B). Among them, SLC25A22 (also known as "GC1") was regarded as a strong candidate gene because of position, expression, and function. The SLC25 gene family encodes mitochondrial carriers that transport a variety of metabolites across the inner mitochondrial membrane (Palmieri Palmieri, 2004Palmieri F The mitochondrial transporter family (SLC25): physiological and pathological implications.Pflugers Arch. 2004; 447: 689-709Crossref PubMed Scopus (591) Google Scholar). The SLC25A22 protein catalyzes either the cotransport of l-glutamate with H+ or its exchange with OH− (Fiermonte et al. Fiermonte et al., 2002Fiermonte G Palmieri L Todisco S Agrimi G Palmieri F Walker JE Identification of the mitochondrial glutamate transporter: bacterial expression, reconstitution, functional characterization, and tissue distribution of two human isoforms.J Biol Chem. 2002; 277: 19289-19294Crossref PubMed Scopus (143) Google Scholar). The genomic structure of the human SLC25A22 gene was identified by alignment of the cDNA sequence (GenBank accession number NM_024698) with the sequence of PAC clone RP13-569C6 (GenBank accession number AC132936). Nine coding exons were identified, and primers were designed for direct sequencing of all exons and exon-intron junctions (see table A1 [online only]). Homozygosity for a missense mutation in exon 8 of the SLC25A22 gene was detected in patient II.1, with the change of a proline into a leucine in the protein (p.Pro206Leu). Sequence analyses showed cosegregation of the mutation with the disease in all affected individuals, whereas both parents were heterozygous (fig. 1A). This mutation was not found in 200 unrelated control individuals (100 of Arab origin and 100 of various ethnic origins). Real-time PCR analysis of fibroblast RNAs from patient II.1 detected normal amounts of the mutant gene transcripts, compared with those of various controls (data not shown). To estimate the prevalence of SLC25A22 mutations in EME, we collected DNA from 25 unrelated children with EME and progressive microcephaly and sequenced the coding region of the SLC25A22 gene, but no mutation was identified.Table A1Primers and PCR Conditions for SLC25A22 AnalysisPrimer (5′→3′)Exon(s)ForwardReverseTa (°C)2–3CCTGAAGGTGGAGCACCACCCCTCTCCTGCTGCCACATGC584TCAGCCCTAGACAGTCCAGGTACCCAGGCCTGCCCATATC585TTTGCCAGCCAGGAGGCAAGGAGTGTCTGCCAGGCAGAAC586–7GCAGGTAGACCTGTCTCTTCCCGAGTCCCTTGTAGAGACC557–8CCAGAGGAAGATCCTGGCTGCATGCACTGACCATCACAGG558–10AGGAGAAGTCGCCTTTCTACCGTGTGCACCACCTATGTG55Note.—Ta = annealing temperature. Open table in a new tab Note.— Ta = annealing temperature. The changed proline residue is highly conserved across species in the glutamate and aspartate/glutamate carriers (fig. A1 [online only]), suggesting that this base change might impair glutamate transport. To test this hypothesis, we investigated the oxidation of glutamate in cultured skin fibroblasts from patients (fig. 2A and the "Methods" section of appendix A [online only]). Because a balanced proportion of oxidizing activities is consistently observed in cultured fibroblasts and is required for optimum function of the respiratory chain and for continuous metabolic fluxes, activity ratios rather than absolute values were used to evaluate glutamate oxidation efficiency. Figure 2B presents the mean (± 1 SD) of six independent experiments. Under standard conditions, polarographic studies showed normal cell respiration by intact cells, indicating that glutamate does not represent a major respiratory substrate, at least in the cell type tested. However, after permeabilization of cell membranes by digitonin in the presence of amino-oxyacetate, a specific inhibitor of amino-aspartate transferase (fig. 2C), patient cells failed to normally oxidize glutamate, as compared with controls, whereas oxidation of another substrate, succinate, was normal in patient cells (fig. 2B). Simultaneous spectrophotometric studies detected similar glutamate dehydrogenase activities in patient and control cells (data not shown). These results provide evidence that patient cells show a clear defect in mitochondrial glutamate metabolism.Figure 2Respiration and mitochondrial substrate oxidation in cultured skin fibroblasts from patients and controls. A, After polarographic measurement of intact cell respiration, digitonin-permeabilized cells were loaded with adenosine diphosphate (ADP) and amino oxyacetate. This compound inhibits the aspartate-amino transferase enzyme activity (see panel C). A subsequent addition of glutamate allowed estimation of mitochondrial glutamate oxidation under phosphorylation conditions (i.e., presence of ADP). Note the lack of glutamate-triggered oxygen uptake in patient cells. A similar succinate oxidation rate was measured in control and patient cells. Numbers along the traces are nmol O2 consumed per minute per microgram of protein. B, Various ratios showing the profound defect of glutamate oxidation (GOx) in patient cells (unblackened boxes), as compared with cell respiration (R) or succinate oxidation (SOx). Values are the means (±1 SD) of six experiments. C, Features of mitochondrial glutamate metabolism, with inner membrane–associated glutamate-H+ symporter (1) and aspartate/glutamate antiporter (4), and the matrix-located enzymes, glutamate dehydrogenase (2) and amino-oxyacetate–sensitive aspartate-amino transferase (3). AOA = amino oxyacetate; Asp = aspartate; Glut = glutamate; α-KG = α-ketoglutarate; and OAA = oxaloacetate. Experimental conditions were as described in the "Methods" section of appendix A (online only).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To get further insight into the functional consequences of this base change, wild-type and mutant SLC25A22 proteins were overexpressed in Escherichia coli and were purified (see the "Methods" section of appendix A [online only]). Equivalent amounts of neosynthesized proteins were then used for in vitro reconstitution of the transporter into liposomes (Palmieri et al. Palmieri et al., 1995Palmieri F Indiveri C Bisaccia F Iacobazzi V Mitochondrial metabolite carrier proteins: purification, reconstitution, and transport studies.Methods Enzymol. 1995; 260: 349-369Crossref PubMed Scopus (217) Google Scholar). Observation of the time course of [14C]glutamate uniport and [14C]glutamate/glutamate exchange in reconstituted proteoliposomes showed that the wild-type protein efficiently catalyzed glutamate transport and exchange, whereas, despite normal insertion of the mutant protein in the liposomal membrane, neither transport nor exchange activities were detected with the mutant construct (fig. 3). Northern blot analysis of human fetal tissues revealed a strong hybridization signal with brain mRNA, whereas a very faint signal was detected in the lung, kidney, and liver mRNAs (data not shown). Further expression analyses, by use of in situ hybridization experiments, detected no signal in 32-, 44-, and 47-d-old human embryos (data not shown). By contrast, at 15 wk of development, prominent expression was detected in the cortex (fig. 4A–4D), the hippocampal formation (fig. 4E and 4F), and the pontine nuclei (data not shown). In the cortex, signal was detected in all the laminae of the cortical plate, from laminae II through VI. In the hippocampal formation, SLC25A22 was uniformely expressed in the CA1, CA2, and CA3 pyramidal cell fields as well as in the granular layer of the dentate gyrus. No expression was detected in the spinal cord. At a later stage (20 wk of development), the highest gene expression was detected in the cerebral cortex, the brain stem, and the cerebellum (fig. 4G–4L). In the brainstem, a moderate-to-high level of SLC25A22 mRNA expression was observed in the red nuclei, the substantia nigra, and the cranial nerves nuclei III, as well as in the olivary complexes. Finally, SLC25A22 expression was also detected in the cerebellum, within the dentate nucleus. Mutations in mitochondrial carriers in humans have been reported elsewhere (Palmieri Palmieri, 2004Palmieri F The mitochondrial transporter family (SLC25): physiological and pathological implications.Pflugers Arch. 2004; 447: 689-709Crossref PubMed Scopus (591) Google Scholar), but none of these mutations have been shown to cause early myoclonic epilepsy. SLC25A13 (encoding aspartate/glutamate carrier 2) mutations cause type II citrullinemia (MIM 603471), SLC25A15 (encoding ornithine carrier 1) mutations are associated with hyperornithinaemiahyperammonaemia-homocitrulliniria syndrome (triple H syndrome [MIM 238970]), SLC20A19 (encoding deoxynucleotide carrier) mutations cause Amish microcephaly (MIM 607196), SLC25A4 mutations cause autosomal dominant progressive external ophthalmoplegia (adPEO [MIM 157640]), and SLC25A20 (encoding carnithine/acylcarnithine carrier) mutations are responsible for Stanley syndrome (MIM 212138). These genes encode proteins involved in the urea cycle, mtDNA metabolism, or translocation of fatty acids into the mitochondria. An increasing number of studies have also shown that mitochondrial dysfunction can result in seizures and drug-resistant forms of severe epilepsy (Wallace et al. Wallace et al., 1988Wallace DC Zheng XX Lott MT Shoffner JM Hodge JA Kelley RI Epstein CM Hopkins LC Familial mitochondrial encephalomyopathy (MERRF): genetic, pathophysiological, and biochemical characterization of a mitochondrial DNA disease.Cell. 1988; 55: 601-610Abstract Full Text PDF PubMed Scopus (424) Google Scholar; Goto et al. Goto et al., 1990Goto Y Nonaka I Horai S A mutation in the tRNALeu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies.Nature. 1990; 348: 651-653Crossref PubMed Scopus (1651) Google Scholar; Degoul et al. Degoul et al., 1995Degoul F Diry M Rodriguez D Robain O Francois D Ponsot G Marsac C Desguerre I Clinical, biochemical, and molecular analysis of a maternally inherited case of Leigh syndrome (MILS) associated with the mtDNA T8993G point mutation.J Inherit Metab Dis. 1995; 18: 682-688Crossref PubMed Scopus (22) Google Scholar). Presumably, all these mutations act by impairing mitochondrial respiratory chain function and ATP synthesis. By contrast, the present study provides the first evidence that, despite normal oxidative phosphorylation, impaired mitochondrial glutamate import/metabolism leads to an alteration of neuronal excitability, possibly linking glutamate transport to the pathogenesis of myoclonic seizures. Previously published data regarding SLC25A22 expression showed that it is ubiquitously expressed in adult tissues and is particularly abundant in liver and pancreas (Fiermonte et al. Fiermonte et al., 2002Fiermonte G Palmieri L Todisco S Agrimi G Palmieri F Walker JE Identification of the mitochondrial glutamate transporter: bacterial expression, reconstitution, functional characterization, and tissue distribution of two human isoforms.J Biol Chem. 2002; 277: 19289-19294Crossref PubMed Scopus (143) Google Scholar). To understand why the SLC25A22 mutation results in a pure neurological phenotype, we studied the SLC25A22 gene expression during human development. Northern blot analyses and in situ hybridization experiments confirmed that SLC25A22 expression is restricted to the brain. Interestingly, SLC25A22 expression was found within territories proposed to contribute to the genesis and control of myoclonic seizures. It is worth remembering that the substantia nigra is the central part of the nigral control of the epilepsy system that, when activated, inhibits seizure generation and propagation (Depaulis et al. Depaulis et al., 1994Depaulis A Vergnes M Marescaux C Endogenous control of epilepsy: the nigral inhibitory system.Prog Neurobiol. 1994; 42: 33-52Crossref PubMed Scopus (199) Google Scholar; Deransart et al. Deransart et al., 2001Deransart C Le-Pham BT Hirsch E Marescaux C Depaulis A Inhibition of the substantia nigra suppresses absences and clonic seizures in audiogenic rats, but not tonic seizures: evidence for seizure specificity of the nigral control.Neuroscience. 2001; 105: 203-211Crossref PubMed Scopus (58) Google Scholar). More interesting is that several cases of neonatal epilepsy with suppression-burst EEG pattern and olivary-dentate dysplasia have been reported (Harding and Boyd Harding and Boyd, 1991Harding BN Boyd SG Intractable seizures from infancy can be associated with dentato-olivary dysplasia.J Neurol Sci. 1991; 104: 157-165Abstract Full Text PDF PubMed Scopus (30) Google Scholar; Robain and Dulac Robain and Dulac, 1992Robain O Dulac O Early epileptic encephalopathy with suppression bursts and olivary-dentate dysplasia.Neuropediatrics. 1992; 23: 162-164Crossref PubMed Scopus (42) Google Scholar), and the olivocerebellar pathway was proposed to contribute to the genesis of myoclonic seizures. Several lines of evidence, based on immunohistochemical, pharmacological, and electrophysiological experiments, suggest that glutamate plays an important role in olivocerebellar transmission (Clements et al. Clements et al., 1987Clements JR Monaghan PL Beitz AJ An ultrastructural description of glutamate-like immunoreactivity in the rat cerebellar cortex.Brain Res. 1987; 421: 343-348Crossref PubMed Scopus (22) Google Scholar; Zhang et al. Zhang et al., 1990Zhang N Walberg F Laake JH Meldrum BS Ottersen OP Aspartate-like and glutamate-like immunoreactivities in the inferior olive and climbing fibre system: a light microscopic and semiquantitative electron microscopic study in rat and baboon (Papio anubis).Neuroscience. 1990; 38: 61-80Crossref PubMed Scopus (80) Google Scholar; Trinka et al. Trinka et al., 2001Trinka E Rauscher C Nagler M Moroder T Ladurner G Irnberger E Sperl W Pilz P A case of Ohtahara syndrome with olivary-dentate dysplasia and agenesis of mamillary bodies.Epilepsia. 2001; 42: 950-953Crossref PubMed Scopus (23) Google Scholar). The mitochondrial component of the glutamate system may thus be a key player in this pathway. How mutations in SLC25A22 cause epilepsy remains an open question. Neuronal dysfunction may result from an abnormal glutamate pool in the cytoplasm, from a secondary alteration of electron flow through the respiratory chain, or from impaired oxygen handling in a discrete subset of neurons. The mitochondrion is a major site of ammonia synthesis, especially through the glutamate dehydrogenase reaction. Hence, impaired ammonia synthesis (due to altered glutamate import) could also play a role in the pathogenesis of the disease. Epilepsy might also result from abnormal glutamate turnover. Indeed, it is worth remembering that glutamate is the major excitatory neurotransmitter in the mammalian brain. Efficient neurotransmission requires (1) low intrasynaptic glutamate concentration, so as to maximize the signal-to-noise ratio, and (2) rapid replacement of the transmitter that is released from presynaptic ends. This is achieved by the rapid uptake of glutamate into astrocytes, which converts glutamate into glutamine, thus ensuring the replenishment of the internal neuronal glutamate pool. In addition, high extracellular glutamate concentrations have been identified as a likely cause of epileptic seizures in mesial temporal lobe epilepsy (During and Spencer During and Spencer, 1993During MJ Spencer DD Extracellular hippocampal glutamate and spontaneous seizure in the conscious human brain.Lancet. 1993; 341: 1607-1610Abstract PubMed Scopus (733) Google Scholar). Thus, glial cells may play an important role in the pathogenesis of the disorder. This hypothesis is also favored by the observation that, at variance with neurons, adult glial cells do not significantly express the aspartate/glutamate carriers (Ramos et al. Ramos et al., 2003Ramos M del Arco A Pardo B Martinez-Serrano A Martinez-Morales JR Kobayashi K Yasuda T Bogonez E Bovolenta P Saheki T Satrustegui J Developmental changes in the Ca2+-regulated mitochondrial aspartate-glutamate carrier aralar1 in brain and prominent expression in the spinal cord.Brain Res Dev Brain Res. 2003; 143: 33-46Crossref PubMed Scopus (124) Google Scholar), so that glial mitochondrial glutamate import may be dependent on glutamate carrier activity only. We therefore speculate that impaired GC1 function could result in a severe alteration of glutamate metabolism in glial cells. Intact glutamate metabolism is crucial for amino acid synthesis and oxidation, for ureogenesis, and for normal function of the CNS. The identification of mutant GC1 as an etiology of early myoclonic epilepsy emphasizes the unexpected importance of the mitochondrial component of glutamate metabolism in normal brain function, thus opening a novel field in the pathophysiology of EME. We express our gratitude to the patients and their families, for their cooperation. We acknowledge G. Goudefroye and G. Mattei, for technical assistance. This study was supported by the Centre National de la Recherche Scientifique, the Fondation France Telecom, the Ministero dell'Istruzione dell'Università e della Ricerca (MIUR), the CNR-MIUR project "Functional genomics," the Ministero della Salute, the Center of Excellence in Genomics, and European Community's Sixth Framework Programme for Research contract LSHM-CT-2004-503116. Cultured skin fibroblasts were grown under standard conditions (Brines et al. Brines et al., 1997Brines ML Sundaresan S Spencer DD de Lanerolle NC Quantitative autoradiographic analysis of ionotropic glutamate receptor subtypes in human temporal lobe epilepsy: up-regulation in reorganized epileptogenic hippocampus.Eur J Neurosci. 1997; 9: 2035-2044Crossref PubMed Scopus (37) Google Scholar). Patients' cells were able to grow on glutamine in the absence of glucose (not shown). Respiration and mitochondrial substrate oxidation in the presence of either glutamate or succinate were polarographically studied in fibroblast suspensions before and after permeabilization by digitonin (Ramos et al. Ramos et al., 2003Ramos M del Arco A Pardo B Martinez-Serrano A Martinez-Morales JR Kobayashi K Yasuda T Bogonez E Bovolenta P Saheki T Satrustegui J Developmental changes in the Ca2+-regulated mitochondrial aspartate-glutamate carrier aralar1 in brain and prominent expression in the spinal cord.Brain Res Dev Brain Res. 2003; 143: 33-46Crossref PubMed Scopus (124) Google Scholar). Frozen cell pellets were thawed and used for spectrophotometric determination of respiratory chain (Bourgeron et al. Bourgeron et al., 1993Bourgeron T Chretien D Rotig A Munnich A Rustin P Fate and expression of the deleted mitochondrial DNA differ between human heteroplasmic skin fibroblast and Epstein-Barr virus-transformed lymphocyte cultures.J Biol Chem. 1993; 268: 19369-19376Abstract Full Text PDF PubMed Google Scholar) and glutamate dehydrogenase activities (Rustin et al. Rustin et al., 1994Rustin P Chretien D Bourgeron T Gerard B Rotig A Saudubray JM Munnich A Biochemical and molecular investigations in respiratory chain deficiencies.Clin Chim Acta. 1994; 228: 35-51Crossref PubMed Scopus (1053) Google Scholar; Aubert et al. Aubert et al., 2001Aubert S Bligny R Douce R Gout E Ratcliffe RG Roberts JK Contribution of glutamate dehydrogenase to mitochondrial glutamate metabolism studied by 13C and 31P nuclear magnetic resonance.J Exp Bot. 2001; 52: 37-45Crossref PubMed Google Scholar). Protein was measured in accordance with the methods of Bradford (Bradford, 1976Bradford MM A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.Anal Biochem. 1976; 72: 248-254Crossref PubMed Scopus (205559) Google Scholar). The human GC1 expression construct has been reported elsewhere (Fiermonte et al. Fiermonte et al., 2002Fiermonte G Palmieri L Todisco S Agrimi G Palmieri F Walker JE Identification of the mitochondrial glutamate transporter: bacterial expression, reconstitution, functional characterization, and tissue distribution of two human isoforms.J Biol Chem. 2002; 277: 19289-19294Crossref PubMed Scopus (143) Google Scholar). We introduced the mutation Pro206Leu into the wild-type human GC1 cDNA by overlap-extension PCR (Ho et al. Ho et al., 1989Ho SN Hunt HD Horton RM Pullen JK Pease LR Site-directed mutagenesis by overlap extension using the polymerase chain reaction.Gene. 1989; 77: 51-59Crossref PubMed Scopus (6682) Google Scholar), and we expressed the wild-type and mutant proteins as inclusion bodies in the bacterial cytosol in E. coli BL21(DE3) (Fiermonte et al. Fiermonte et al., 1993Fiermonte G Walker J Palmieri F Abundant bacterial expression and reconstitution of an intrinsic membrane-transport protein from bovine mitochondria.Biochem J. 1993; 294: 293-299Crossref PubMed Scopus (174) Google Scholar). We assayed the transport activities of the recombinant purified proteins, as described elsewhere (Palmieri et al. Palmieri et al., 1995Palmieri F Indiveri C Bisaccia F Iacobazzi V Mitochondrial metabolite carrier proteins: purification, reconstitution, and transport studies.Methods Enzymol. 1995; 260: 349-369Crossref PubMed Scopus (217) Google Scholar). The amount of protein incorporated into liposomes was as described elsewhere (Fiermonte et al. Fiermonte et al., 1998Fiermonte G Dolce V Palmieri F Expression in Escherichia coli, functional characterization, and tissue distribution of isoforms A and B of the phosphate carrier from bovine mitochondria.J Biol Chem. 1998; 273: 22782-22787Crossref PubMed Scopus (108) Google Scholar). Approximately 20% of wild-type or GC1 mutant proteins were reconstituted. Human embryos and fetuses were collected from medically terminated pregnancies, in accordance with French law (94-653) and the National Ethics Committee recommendations, under the supervision of a local ethics committee. A total of two embryonic stages (5 wk and 7 wk of development) and two fetal stages (15 wk and 20 wk of development) were studied. Tissues were prepared as described elsewhere (Odent et al. Odent et al., 1999Odent S Atti-Bitach T Blayau M Mathieu M Aug J Delezo de AL Gall JY Le Marec B Munnich A David V Vekemans M Expression of the Sonic hedgehog (SHH) gene during early human development and phenotypic expression of new mutations causing holoprosencephaly.Hum Mol Genet. 1999; 8: 1683-1689Crossref PubMed Scopus (115) Google Scholar). Brain sections of a 15-wk-old embryo were also studied. A 25-bp RT-PCR fragment was generated using primers GC1.F (5′-GCATTGCCGGTCTCTACAAGG-3′) and GC1.R (5′-GGTGTCCTCGTTGACGCCTC-3′), covering exons 7–9. T7 extension (TAATACGACTCACTATAGGGAGA) was added to both the GC1.F and GC1.R primers to generate templates for the antisense probe and the control sense probe, respectively. Probes were [35S]UTP labeled using T7 polymerase and were purified as described elsewhere (Odent et al. Odent et al., 1999Odent S Atti-Bitach T Blayau M Mathieu M Aug J Delezo de AL Gall JY Le Marec B Munnich A David V Vekemans M Expression of the Sonic hedgehog (SHH) gene during early human development and phenotypic expression of new mutations causing holoprosencephaly.Hum Mol Genet. 1999; 8: 1683-1689Crossref PubMed Scopus (115) Google Scholar). Hybridization and posthybridization washes were performed in accordance with standard protocols. Slides were dehydrated, were exposed to BIOMAX MR X-ray films (Amersham) for 3 d, and were dipped in Kodak NTB2 emulsion for 3 wk at 4°C. Developed and toluidine blue–counterstained slides were analyzed with dark-field and bright-field illumination. Hybridization with the sense probe revealed no signal (data not shown).