Oligomerization of the Human ARF Tumor Suppressor and Its Response to Oxidative Stress
2003; Elsevier BV; Volume: 278; Issue: 21 Linguagem: Inglês
10.1074/jbc.m211007200
ISSN1083-351X
AutoresSergio Ménendez, Zeb Khan, David Coomber, David P. Lane, Maureen Higgins, Maria M. Koufali, Sonia Laı́n,
Tópico(s)Cancer-related Molecular Pathways
ResumoThe tumor suppressor ARF plays an important role as an inhibitor of the Mdm2-mediated degradation of p53. Here we demonstrate that human ARF (p14ARF) can form homo-oligomers. The stability of the oligomers is favored by oxidizing agents in a reversible fashion and involves all three cysteine residues in p14ARF. Furthermore, the effect of p14ARF in clonogenic assays is moderately but reproducibly increased by the mutation of its cysteine residues. We also observed that altering the amino terminus of p14ARF resulted in the appearance of remarkably stable oligomers. This indicates that the amino terminus of p14ARF interferes with the ability of the protein to form multimeric complexes. These observations suggest that p14ARF activity may be linked to its oligomerization status and sensitive to the redox status of the cell. The tumor suppressor ARF plays an important role as an inhibitor of the Mdm2-mediated degradation of p53. Here we demonstrate that human ARF (p14ARF) can form homo-oligomers. The stability of the oligomers is favored by oxidizing agents in a reversible fashion and involves all three cysteine residues in p14ARF. Furthermore, the effect of p14ARF in clonogenic assays is moderately but reproducibly increased by the mutation of its cysteine residues. We also observed that altering the amino terminus of p14ARF resulted in the appearance of remarkably stable oligomers. This indicates that the amino terminus of p14ARF interferes with the ability of the protein to form multimeric complexes. These observations suggest that p14ARF activity may be linked to its oligomerization status and sensitive to the redox status of the cell. In normal non-stressed cells p53 has a very short half-life (5–20 min) due to an autoregulatory feedback loop mechanism in which the Mdm2 protein plays a key role (reviewed in Refs. 1Vousden K.H. Lu X. Nat. Rev. Cancer. 2002; 2: 594-604Crossref PubMed Scopus (2702) Google Scholar and 2Lane D.P. Lain S. Trends Mol. Med. 2002; 8: 38-42Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). It has been well established that wild type p53 acts as a transcriptional activator of the Mdm2 gene. In turn, Mdm2, which itself has a brief half-life due its auto-ubiquitination activity, has the ability to interact with p53 and to function as a ubiquitin E3 1The abbreviations used are: E3, ubiquitin-protein isopeptide ligase; CMV, cytomegalovirus; PBS, phosphate-buffered saline; DTT, dithiothreitol; MOPS, 4-morpholinepropanesulfonic acid; IVT, in vitro transcription translation; RIPA, radioimmune precipitation assay buffer.1The abbreviations used are: E3, ubiquitin-protein isopeptide ligase; CMV, cytomegalovirus; PBS, phosphate-buffered saline; DTT, dithiothreitol; MOPS, 4-morpholinepropanesulfonic acid; IVT, in vitro transcription translation; RIPA, radioimmune precipitation assay buffer. ligase that promotes the conjugation of p53 to ubiquitin (3Fang S. Jensen J.P. Ludwig R.L. Vousden K.H. Weissman A.M. J. Biol. Chem. 2000; 275: 8945-8951Abstract Full Text Full Text PDF PubMed Scopus (864) Google Scholar, 4Honda R. Tanaka H. Yasuda H. FEBS Lett. 1997; 420: 25-27Crossref PubMed Scopus (1591) Google Scholar, 5Honda R. Yasuda H. Oncogene. 2000; 19: 1473-1476Crossref PubMed Scopus (309) Google Scholar). This conjugation to ubiquitin serves as a tag that effectively targets p53 for degradation by the proteasome. In this way, in normal non-stressed cells, p53 is maintained at low levels, and cells are allowed to proliferate. The ARF tumor suppressor (p14ARF in human, p19ARF in mouse) is encoded by the INK4/ARF locus (6Quelle D.E. Zindy F. Ashmun R.A. Sherr C.J. Cell. 1995; 83: 993-1000Abstract Full Text PDF PubMed Scopus (1313) Google Scholar). This small protein has been shown to inhibit degradation of p53 mediated by Mdm2 (7Pomerantz J. SchreiberAgus N. Liegeois N.J. Silverman A. Alland L. Chin L. Potes J. Chen K. Orlow I. Lee H.W. CordonCardo C. DePinho R.A. Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1329) Google Scholar, 8Zhang Y.P. Xiong Y. Yarbrough W.G. Cell. 1998; 92: 725-734Abstract Full Text Full Text PDF PubMed Scopus (1393) Google Scholar). Several models have been proposed to explain this effect of p14ARF. In vitro biochemical studies indicate that p14ARF inhibits the ubiquitin E3 ligase activity of Mdm2 (9Honda R. Yasuda H. EMBO J. 1999; 18: 22-27Crossref PubMed Scopus (612) Google Scholar), (10Midgley C.A. Desterro J.M.P. Saville M.K. Howard S. Sparks A. Hay R.T. Lane D.P. Oncogene. 2000; 19: 2312-2323Crossref PubMed Scopus (230) Google Scholar) and a decrease in the levels of polyubiquitinated p53 by p14ARF was also shown in vivo (11Xirodimas D. Saville M.K. Edling C. Lane D.P. Laín S. Oncogene. 2001; 20: 4972-4983Crossref PubMed Scopus (155) Google Scholar). In addition, p14ARF was reported to sequester the p53·Mdm2 complex in discrete subnuclear compartments and to inhibit the nuclear export of the complex, a step suggested to be essential for p53 degradation (12Zhang Y.P. Xiong Y. Mol. Cell. 1999; 3: 579-591Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar). According to Tao and Levine (13Tao W.K. Levine A.J. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6937-6941Crossref PubMed Scopus (496) Google Scholar) this export step could occur via the nucleolus. Finally, in another study, overexpressed p14ARF was shown to induce the localization of Mdm2 in the nucleolus, which is where ARF is primarily detected (14Rizos H. Darmanian A.P. Mann G.J. Kefford R.F. Oncogene. 2000; 15: 2978-2985Crossref Scopus (91) Google Scholar, 15Weber J.D. Taylor L.J. Roussel M.F. Sherr C.J. BarSagi D. Nat. Cell Biol. 1999; 1: 20-26Crossref PubMed Scopus (798) Google Scholar) and proposed to sequester Mdm2 in this compartment. This would prevent its effects on p53 (15Weber J.D. Taylor L.J. Roussel M.F. Sherr C.J. BarSagi D. Nat. Cell Biol. 1999; 1: 20-26Crossref PubMed Scopus (798) Google Scholar). Whether this mechanism is entirely responsible for the activation of p53 by p14ARF has been questioned by others (16Llanos S. Clark P.A. Rowe J. Peters G. Nat. Cell Biol. 2001; 3: 445-452Crossref PubMed Scopus (227) Google Scholar, 17Clark P.A. Llanos S. Peters G. Oncogene. 2002; 21: 4498-4507Crossref PubMed Scopus (35) Google Scholar, 18Korgaonkar C. Zhao L. Modestou M. Quelle D.E. Mol. Cell. Biol. 2002; 22: 196-206Crossref PubMed Scopus (109) Google Scholar). p53-independent tumor suppressor effects of ARF have also been described (19Weber J.D. Jeffers J.R. Rehg J.E. Randle D.H. Lozano G. Roussel M.F. Sherr C.J. Zambetti G.P. Genes Dev. 2000; 14: 2358-2365Crossref PubMed Scopus (332) Google Scholar, 20Carnero A. Hudson J.D. Price C.M. Beach D.H. Nat. Cell Biol. 2000; 2: 148-155Crossref PubMed Scopus (252) Google Scholar). ARF expression has been shown to be regulated at the transcriptional level (reviewed in Ref. 21Sherr C.J. Nat. Rev. Mol. Cell. Biol. 2001; 2: 731-737Crossref PubMed Scopus (820) Google Scholar). The expression of the ARF gene is induced by several oncogenic signals such as Myc, E1A, E2F, mutated ras, and v-Abl. ARF expression is inhibited by Twist and Tbx-2 and is actively repressed during development by the Bmi repressor. Additionally, the human ARF promoter can be silenced by methylation or expression of wild type p53 (22Stott F.J. Bates S. James M.C. McConnell B.B. Starborg M. Brookes S. Palmero I. Ryan K. Hara E. Vousden K.H. Peters G. EMBO J. 1998; 17: 5001-5014Crossref PubMed Scopus (1007) Google Scholar). However, to our knowledge, there are no reports on the regulation of p14ARF function at the protein level. Here we propose that p14ARF forms homo-oligomers and that these are stabilized by oxidative agents. Interestingly, the amino terminus of p14ARF, which is known to be critical for its function, can modulate the appearance of the oligomeric forms. Cells, Antibodies, and Reagents—H1299 and U2OS cells were obtained from the ATCC cultured in RPMI or Dulbecco's modified Eagle's medium, respectively, supplemented with 10% fetal calf serum and gentamicin at 37 °C, 5% CO2 in a humidified atmosphere. 4B2 and 2A10 are mouse monoclonal antibodies against Mdm2 (23Chen J. Marechal V. Levine A.J. Mol. Cell. Biol. 1993; 13: 4107-4114Crossref PubMed Scopus (621) Google Scholar). Human p53 was detected using the mouse monoclonal antibody DO1 (24Stephen C.W. Helminen P. Lane D.P. J. Mol. Biol. 1995; 248: 58-78Crossref PubMed Scopus (183) Google Scholar). Rabbit anti-p14ARF serum (IPI) was a kind gift from Dr. K. Vousden (20Carnero A. Hudson J.D. Price C.M. Beach D.H. Nat. Cell Biol. 2000; 2: 148-155Crossref PubMed Scopus (252) Google Scholar). The rabbit serum against fibrillarin was a kind gift from Dr. A. Lamond. The mouse monoclonal antibodies against B23 (nucleophosmin) and the His tag were obtained from Zymed Laboratories Inc. and Novagen, respectively. Proteasome inhibitor MG132 was obtained from Calbiochem, and stock solutions were prepared in Me2SO. Plasmids—Expression from all constructs was under the control of CMV promoter. pCMVhMdm2 and pcDNA3p14ARF were a kind gift from Dr. A. Levine and Dr. K. Vousden, respectively. pcDNA3 β-galactosidase was a kind gift from R. Stad. All pcDNA3p14ARF derivatives were generated by standard site-directed mutagenesis. The vectors for the expression and purification of His-tagged p14ARF are described below. Transfection of Cells—H1299 or U2OS cells were seeded on 10-cm tissue culture plates at a density of 9 × 105 cells per well and transfected using the calcium-phosphate method essentially as described previously (11Xirodimas D. Saville M.K. Edling C. Lane D.P. Laín S. Oncogene. 2001; 20: 4972-4983Crossref PubMed Scopus (155) Google Scholar). In all experiments, 1 μg of a plasmid encoding the β-galactosidase protein was used as a transfection efficiency control. Equivalent amounts of CMV promoter in the transfections were maintained with the pcDNA3 control vector. The amount of plasmid used in each transfection was topped up to 20 μg with the bacterial plasmid Bluescript. After 36 h cells were harvested in PBS. Cell pellets were washed with PBS and lysed using Nonidet P-40 lysis buffer (150 mm NaCl, 50 mm Tris-HCl, pH 7.5, 1% (v/v) Nonidet P-40, and protease inhibitors (Complete, Roche Molecular Biochemicals)) for 15 min after which they were centrifuged for 20 min at 16,000 rpm, and the cell pellet was discarded. The volumes of the samples were adjusted to equivalent protein concentration and Laemmli buffer or Novex loading buffer (with or without 0.1 m DTT) was added. Where indicated, cell pellets were directly lysed in Laemmli buffer or Novex loading buffer supplemented or not with 0.1 m DTT. The quality of the transfections, sample preparation, and Western blot analysis were always monitored by the expression of β-galactosidase. Western Blot Analysis—Samples were separated by denaturing electrophoresis on 4–12% (to detect p53 and Mdm2) or 12% (to detect p14ARF and all other antigens) Novex polyacrylamide gels run with MOPS buffer with or without antioxidant agent. Similar results were obtained using classic Tris-glycine gels. Proteins were transferred to nitrocellulose or Immobilon membranes and developed with the relevant primary antibodies and horseradish peroxidase-conjugated secondary antibodies as described in (11Xirodimas D. Saville M.K. Edling C. Lane D.P. Laín S. Oncogene. 2001; 20: 4972-4983Crossref PubMed Scopus (155) Google Scholar). Horseradish peroxidase activity was detected by ECL (Amersham Biosciences). Immunoprecipitations—H1299 cells were transfected with 10 μg of pcDNA3p14ARF or pcDNA3p14ARFC15,100,123A together with 10 μg of pCMVhMdm2. After 36 h cells were lysed in 200 μl of RIPA buffer (50 mm Tris-HCl, 0.1% (w/v) SDS, 0.5% (w/v) sodium deoxycolate, 1% (v/v) Nonidet P-40, 150 mm NaCl, pH 7.5) and diluted with 2 volumes of Nonidet P-40 buffer. 10 μg of the indicated antibodies were added and samples were incubated for1hat4 °C. Protein G-Sepharose beads were added, and samples were rotated for another hour at 4 °C. Complexes bound to the beads were washed six times with Nonidet P-40 buffer in the presence of 0.5% bovine serum albumin, and samples were resuspended and heated in Novex loading buffer with or without 0.1 m DTT. p14ARF was analyzed by Western blotting. Preparation of Nucleoli—The protocol used was adapted from the one described previously (25Andersen J.S. Lyon C.E. Fox A.H. Leung A.K. Lam Y.W. Steen H. Mann M. Lamond A.I. Curr. Biol. 2002; 12: 1-11Abstract Full Text Full Text PDF PubMed Scopus (811) Google Scholar). 3 × 106 H1299 cells were seeded. After 36 h, cells were harvested in PBS and cell pellets were resuspended in 3 ml of 10 mm Tris-HCl, pH 7.4, 10 mm NaCl, and 1.5 mm MgCl2. Cells were broken with the loose pestle of a Dounce homogenizer, and nuclei were sedimented by centrifugation at 228 × g for 5 min. Supernatants ("cytoplasmic" fraction) were concentrated with Centricon tubes and stored. The pellet containing the nuclei was resuspended in 0.75 ml of 0.25 m sucrose and 10 mm MgCl2 and layered onto 0.75 ml of 0.35 m sucrose and 0.5 mm MgCl2. Samples were centrifuged at 1430 × g for 5 min to obtain purified nuclei. These were resuspended in 0.3 ml of 0.35 m sucrose and 0.5 mm MgCl2 and sonicated six times for 10 s. The effectiveness of the sonication was checked by microscopy. Samples were layered on top of 0.3 ml of 0.88 m sucrose and 0.5 mm MgCl2 and centrifuged at 2800 × g for 20 min. The supernatants were stored, and the pellets were resuspended in 0.1 ml of 0.35 m sucrose and 0.35 mm MgCl2 and centrifuged again at 2800 × g for 5 min. The pellet fraction contains the nucleoli. Samples were always maintained in ice, and centrifugations were carried out at 4 °C. Equivalent amounts of cytoplasmic, nuclear, nuclear non-nucleolar, and nucleolar fractions were analyzed by Western blotting. Immunofluorescence—U2OS cells (1 × 105/well) were seeded on two well Nunc Permanox slides. 36 h after transfection using the calcium phosphate method, cells were fixed with ice-cold methanol-acetone and incubated with primary antibodies followed by fluorescein isothiocyanate-conjugated donkey anti-mouse or Texas Red-conjugated donkey anti-rabbit secondary antibodies (Jackson ImmunoResearch) as described previously (26Laín S. Midgley C. Sparks A. Lane E.B. Lane D.P. Exp. Cell Res. 1999; 248: 457-472Crossref PubMed Scopus (123) Google Scholar). p53 Reporter Assays—U2OS cells were seeded in 24-well plates and transfected with 60 ng of the RGCΔFos-lacZ p53 reporter plasmid, 60 ng of the control SV-promoter-dependent luciferase reporter, and 6.25 ng of the indicated p14ARF-expressing plasmids using FuGENE (Roche Molecular Biochemicals) as described in a previous study (10Midgley C.A. Desterro J.M.P. Saville M.K. Howard S. Sparks A. Hay R.T. Lane D.P. Oncogene. 2000; 19: 2312-2323Crossref PubMed Scopus (230) Google Scholar). Cells were harvested at 48 h after transfection. β-Galactosidase activity was analyzed as described previously (10Midgley C.A. Desterro J.M.P. Saville M.K. Howard S. Sparks A. Hay R.T. Lane D.P. Oncogene. 2000; 19: 2312-2323Crossref PubMed Scopus (230) Google Scholar). Luciferase activity was analyzed using the Dual-Luciferase® reporter assay system (Promega) and a MicroLumat LB96V (EG&G Berthold) luminometer. Clonogenic Assays—5 × 104 U2OS cells were seeded to each well of a six-well plate (Nunc). After 24 h they were transfected with 1 μg of each indicated plasmid using FuGENE (Roche Molecular Biochemicals) as recommended by the manufacturer. 24 h after transfection, Neomycin-resistant cells were selected for 15 days using 1 mg/ml G418. After selection, the cells were fixed in methanol and stained with Giemsa. IVT and hMdm2 Binding—pcDNA3p14ARF is very poorly expressed in rabbit reticulocyte lysates as well as in bacteria. To overcome these problems a T7- and histidine-tagged p14ARF gene was constructed (pET23bp14ARF). The codon usage of this construct was optimized for expression in Escherichia coli. Three sense primers, arf1 (5′-GGTAATCAAGCTAGAGCTCTATGGTGCGCCGTTTCCTGGTGACCCTGCGTATTCGTCGCGCGTGCGGCCCGCCGCGCGTACGTGTTTTCGTTGTTCA CAT), arf 3 (5′-GTTCTGATGCTGCTGCGTAGCCAGCGTCTGGGTCAGCAGCCGCTGCCGCGTCGTCCGGGTCATGATGATGGTCAGCGCCCGAGCGGCGGTGCTGCTGCT), and arf 5 (5′-TCCTGATGCCAAGCTTTTCGCCCGGACCACGAGCAGACGGACCCA GGCAACGCGCACGACCAGCCGCGCCACGGCCCGGTGCAGC ACCACCAGCGTGACCCGG), were annealed with three antisense primers, arf2 (5′-GCTACGCAGCAGCATCAGAACCAGTGCAACAGCCGCCGGCGCACCCGGCGCTGCCCACTCACCGGTCAGACGCGGGATGTGAACAACGAAAACACGTAC), Arf4 (5′-CCGGGTCACGCTGGTGGTGCTGCACCGGGCCGTGGCGCGGCTGG TCGTGCGCGTTGCCTGGGTCCGTCTGCTCGTGGTCCGGGCGAAAA GCTTGGCATCAGGA), Arf6 (5′-TCCTGATGCCAAGCTTTTCGCC), and then 20 rounds of PCR were used to extend from the overlapping ends. Each round of the PCR consisted of DNA denaturation for 1 min at 95 °C, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. The full-length ARF cDNA was amplified from 1 μl of this PCR, using the arf7 sense (5′-GGTAATCAAGCTAGAGCTCTAT) and arf6 antisense oligonucleotides, over 30 cycles, under the same cycling conditions described above. The 415-bp PCR product was gel-purified, digested with HindIII and SacI, and cloned into the pET23b vector. The gene was cloned in-frame for the production of p14ARF with a T7 tag at the amino terminus and a six-residue His tag at the carboxyl terminus. The gene was also cloned into the pcDNA3 vector for expression in mammalian cells. 35S-p14ARF was expressed from these constructs by in vitro transcription translation (IVT) using the TnT T7 Quick Coupled transcription/translation kit from Promega. 100 μl of IVT mix was mixed together with 2.4 μg of recombinant hMdm2 obtained as described previously (10Midgley C.A. Desterro J.M.P. Saville M.K. Howard S. Sparks A. Hay R.T. Lane D.P. Oncogene. 2000; 19: 2312-2323Crossref PubMed Scopus (230) Google Scholar) and incubated for 30 min at 4 °C. This mixture was divided into four aliquots, and the indicated antibodies, previously coupled to protein G (4B2 and DO2) or protein A (2A10 and 421) beads, were added. After 1 h of rotation at 4 °C antibody-bound complexes were purified by centrifugation and extensive washing in Nonidet P-40 buffer. Samples were run on 12% Novex gels with MOPS buffer in non-reducing conditions. 35S-Labeled bands were analyzed by autoradiography. Purification of Recombinant p14ARF—The E. coli strain BLR(DE3λ) was transformed with pET23b vectors encoding different forms of p14ARF. Bacteria were grown, and protein expression was induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside for up to 16 h. Bacteria were sedimented and resuspended in denaturing buffer (6 m guanidinium-HCl, 150 mm NaCl, and 50 mm HEPES, pH 7.2), and then sonicated. Insoluble material was removed by centrifugation at 11,000 × g for 30 min. Imidazole was added to the solubilized protein to a concentration of 10 mm and then passed through a 2-ml nickel-nitrilotriacetic acid-Sepharose column equilibrated with the denaturing buffer. The column was then washed with 20 ml of wash buffer (8 m urea, 150 mm NaCl, 50 mm HEPES, pH 7.2), followed by 10 ml with wash buffer with 15 mm imidazole. His-tagged protein was eluted in wash buffer with 300 mm imidazole. Protein was dialyzed extensively against Tris-HCl, pH 7.5, 150 mm NaCl. Gel Filtration Chromatography—Cell pellets were lysed in RIPA buffer (see above) and diluted with 4 volumes of Nonidet P-40 buffer. Lysates were centrifuged at 16,000 × g for 20 min, and supernatants were filtered through a 0.2-μm membrane. Total protein concentration was ∼1 mg/ml as determined by Bradford analysis. Alternatively, 12.5 μg of recombinant p14ARFC15,100,123A were diluted in 50 μl of the indicated buffer (RIPA/Nonidet P-40, 1:4) and filtered as above. 50 μl of sample (cell lysate or purified protein) were loaded onto a SuperdexTM 200HR gel filtration column and separated using the Amersham Biosciences Biotech Smart system. Equilibration and elution of the column were performed in the same buffer used for the dilution of the samples. 50-μl fractions were collected. Bio-Rad Gel Filtration Standards were used for calibration. Ectopic p14ARF Forms Homodimers—We observed that the electrophoretic mobility of p14ARF varies depending on the presence of reducing agents in the sample and electrophoresis buffers. As shown in Fig. 1A (left panel), in the presence of reducing agents most of p14ARF in soluble cell extracts migrates to a position that corresponds well with its molecular mass, ∼14 kDa. However, in the absence of reducing agents most of p14ARF in these cell extracts migrates to a position corresponding to ∼28-kDa and other p14ARF-related bands of slower mobility are also detected (Fig. 1A, right panel). The presence of the higher molecular mass forms of p14ARF was insensitive to the sulfhydryl chelating agent N-ethylmaleimide in the lysis buffer. This result indicated that the higher molecular mass forms of p14ARF are produced inside the cell and not during the cell lysate preparation procedure. To test whether the high molecular mass products actually contained the p14ARF moiety and were not due to the induction of the expression of proteins non-specifically recognized by the serum against p14ARF, we compared the mobility of full-length p14ARF with the mobility of a p14ARF deletion mutant lacking amino acid residues 2 through 14 (p14ARFΔ2–14). We observed that, under non-reducing electrophoresis conditions, a large proportion of this p14ARF deletion mutant migrated slightly faster than the 28-kDa band obtained with full-length p14ARF (Fig. 1B). This result unequivocally shows that p14ARF is able to oligomerize with itself or with other proteins of similar molecular mass. To test whether p14ARF forms homo-oligomers in vivo and that this did not occur during sample preparation, we analyzed the pattern of bands in the 28-kDa region in cells overexpressing the full-length p14ARF together with the p14ARFΔ2–14 deletion mutant. As in the experiment shown in Fig. 1A, a band of ∼28 kDa was observed when full-length ARF was overexpressed on its own (Fig. 1C, lane 1) and a band corresponding to a slightly smaller molecular mass form appeared when the cells were transfected with the construct expressing the p14ARFΔ2–14 deletion mutant (Fig. 1C, lane 2). When the full-length ARF and the p14ARFΔ2–14 deletion mutant were expressed together (Fig. 1C, lane 3), an additional intermediate band appeared. Furthermore, this extra band did not appear when cell pellets derived from cells transfected with either full-length p14ARF or the p14ARFΔ2–14 deletion mutant were mixed prior to lysis. This indicates that overexpressed p14ARF is able to form homodimers inside the cell. An equivalent result was obtained when these experiments were carried out using the U2OS cell line, and therefore, our observations are not limited to a single type of cell (see Fig. 9C below). Supporting that p14ARF can oligomerize with itself, high molecular weight forms of purified recombinant p14ARF could also be detected under non-reducing conditions (see below, Fig. 2C).Fig. 2The cysteine residues in human p14ARF are involved in the appearance of multimeric forms of p14ARF.A, analysis of the cysteine residues in the ARF sequence. Alignment of the human, murine, and South American opossum ARF sequences. Identical residues in the three sequences are labeled with an asterisk. Cysteine residues are underlined. The arginine-rich nucleolar localization signals proposed for the human and mouse proteins (12Zhang Y.P. Xiong Y. Mol. Cell. 1999; 3: 579-591Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 14Rizos H. Darmanian A.P. Mann G.J. Kefford R.F. Oncogene. 2000; 15: 2978-2985Crossref Scopus (91) Google Scholar, 15Weber J.D. Taylor L.J. Roussel M.F. Sherr C.J. BarSagi D. Nat. Cell Biol. 1999; 1: 20-26Crossref PubMed Scopus (798) Google Scholar) are boxed. B, comparison of the electrophoretic mobility of wild type p14ARF and p14ARF lacking cysteine residues. H1299 cells were transfected with an expression vector for wild type p14ARF (lane 1), p14ARFC15A (lane 2), p14ARFC100A (lane 3), p14ARFC123A (lane 4), p14ARFC15,100A (lane 5), p14ARFC15,123A (lane 6), p14ARFC100,123A (lane 7), p14ARFC15,100,123A (lane 8), or pcDNA3 empty vector (lane 9). Cell pellets were lysed in Nonidet P-40 buffer, and the supernatants were analyzed by electrophoresis in non-reducing (left panel) and reducing (right panel) conditions and Western blotting using the rabbit polyclonal serum against p14ARF. C, purified recombinant His-tagged p14ARF (lanes 1) and p14ARFC15,100,123A (lanes 2) were analyzed by electrophoresis in non-reducing conditions. In the left panel, proteins were detected by Coomassie Blue staining. In the right panel proteins were detected by Western blot using an antibody against the His tag.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The Cysteine Residues in Human p14ARF Are Involved in the Stabilization of the Multimeric Forms of p14ARF—Unlike Mdm2 (27Nasir L. Burr P.D. McFarlane S.T. Gault E. Thompson H. Argyle D.J. Cancer Lett. 2000; 152: 9-13Crossref PubMed Scopus (7) Google Scholar) ARF is poorly conserved between species. Only 38 of the 132 residues of human ARF are identical in both the mouse and opossum sequences (Fig. 2A). Human ARF (p14ARF) contains three cysteine residues at positions 15, 100, and 123 (Fig. 2A). Interestingly, the first two cysteine residues are adjacent to the arginine-rich sequences that are involved in the nucleolar localization of human ARF (12Zhang Y.P. Xiong Y. Mol. Cell. 1999; 3: 579-591Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 14Rizos H. Darmanian A.P. Mann G.J. Kefford R.F. Oncogene. 2000; 15: 2978-2985Crossref Scopus (91) Google Scholar). The cysteine residues at positions 15 and 100 of human ARF are conserved in the sequence of the opossum ARF protein but absent in the reported murine ARF sequence. The lack of conservation of the first cysteine residue in the mouse sequence is not surprising, because the nucleolar localization signal for the mouse ARF protein (p19ARF) has been mapped further downstream in the region between residues 26 and 37 (15Weber J.D. Taylor L.J. Roussel M.F. Sherr C.J. BarSagi D. Nat. Cell Biol. 1999; 1: 20-26Crossref PubMed Scopus (798) Google Scholar). Coincidentally, there is a cysteine residue in the mouse sequence three residues downstream of the murine arginine-rich nucleolar localization signal. Although all three ARF sequences contain cysteine residues at the carboxyl terminus, cysteine 123 of the human p14ARF is only strictly conserved in mouse p19ARF. Given the effect of reducing conditions on the electrophoretic mobility of p14ARF described above, we proceeded to mutate the cysteine residues to alanine. Mutation of single cysteine residues still allowed the detection of the dimeric forms of p14ARF (Fig. 2B, lanes 2–4) and the substitution of cysteine 15 decreased the ability of p14ARF to form higher molecular mass complexes in SDS-gels (Fig. 2B, lane 2). Mutation of two of the three cysteines abolished the appearance of multimeric forms of p14ARF but did not affect the formation p14ARF dimers (Fig. 2B, lanes 5–7). Finally, the appearance of the dimeric and higher molecular forms of p14ARF was markedly decreased when all three cysteines were mutated (Fig. 2B, lane 8). These results show that all three cysteine residues in p14ARF are involved in the formation or the stabilization of homodimers and higher order forms. Recombinant p14ARF (His-tagged) analyzed in non-reducing conditions gave rise to the appearance of multimeric forms that were not present when the corresponding triple-cysteine mutant recombinant protein was analyzed (Fig. 2C). This supports that p14ARF can oligomerize with itself in the absence of other proteins. Cysteine-dependent p14ARF Oligomerization Increases in the Presence of the Oxidants—We then tested whether the oligomerization status of p14ARF was sensitive to the redox status in the cell. Cells overexpressing p14ARF were treated with two oxidizing agents, hydrogen peroxide or the sulfhydryl oxidizing agent azodicarboxylic acid bis(dimethylamide, diamide). As shown in Figs. 3 (A and B), after short incubations with these agents, the levels of high molecular mass forms of p14ARF increased in SDS-polyacrylamide gels, and a concomitant decrease in the levels of monomeric p14ARF was observed. It must be stressed that in these and the previous experiments we were analyzing p14ARF in a soluble fraction prepared by lysing cells in mild conditions using the Nonidet P-40 buffer. Instead, most of p14ARF is in the insoluble fraction (Fig. 3C). Accordingly, extraction with harsher detergent conditions (SDS-PAGE loading buffer) dramatically increased the levels of p14ARF detected (Fig. 3C). Therefore, we also analyzed the effect of these oxidizing agents in whole cell extracts prepared by lysing the cells directly in SDS-PAGE loading buffer. As shown in Figs. 3C (left panel) and 3D, H2O2 and diamide have an effect on the total population of p14ARF by increasing the proportion of cysteine-linked oligomeric forms over the non-covalently linked forms of p14ARF. In Fig. 3C (right panel), it is shown that no increase in the oligomeric forms was detected with the triple-cysteine mutant of p14ARF (p14ARFC15,100,123A) when cells were subjected to H2O2 treatment. We also tested whether the appearance of the higher molecular mass forms after treatment of the cells with oxidizing conditions could be occurring during sample preparation. For this purpose we carried out a similar experiment as the one described in Fig. 1C. As shown in Fig. 3E, even in the presence of diamide, the inter
Referência(s)