Vitamin C Recycling Is Enhanced in the Adaptive Response to Leptin-Induced Oxidative Stress in Keratinocytes
2003; Elsevier BV; Volume: 121; Issue: 4 Linguagem: Inglês
10.1046/j.1523-1747.2003.12538.x
ISSN1523-1747
AutoresIsabella Savini, Maria Valeria Catani, Antonello Rossi, Guglielmo Duranti, Marco Ranalli, Gerry Melino, Stefania Sabatini, Luciana Avigliano,
Tópico(s)Antioxidant Activity and Oxidative Stress
ResumoLeptin acts on energy metabolism and plays a role in skin repair and in the modulation of cellular redox balance as well. Here, we investigated the effects of leptin on the redox homeostasis in keratinocytes, by evaluating reactive oxygen species (ROS) generation, glutathione content, antioxidant enzymes, activating protein 1 (AP-1) activity, and expression of AP-1-dependent, differentiation-specific genes. We also evaluated the systems involved in the maintenance of a positive ascorbate/dehydroascorbate ratio, i.e., transport and recycling. Leptin altered the keratinocyte redox state, as evident by enhanced ROS generation, oxidized/reduced glutathione ratio, and AP-1 activity. Still, this phenomenon was temporary. Indeed, we found an adaptive response, as demonstrated by an early induction of catalase and a late induction of specific dehydroas-corbate reductase activities. In particular, leptin-treated cells showed an increased ability to reduce dehydroascorbate, both in a NADH, lipoic acid- and in a NADPH, thioredoxin-dependent manner. Our results show that leptin may induce adaptation to oxidative stress in skin, leading to an improved vitamin C homeostasis. Leptin acts on energy metabolism and plays a role in skin repair and in the modulation of cellular redox balance as well. Here, we investigated the effects of leptin on the redox homeostasis in keratinocytes, by evaluating reactive oxygen species (ROS) generation, glutathione content, antioxidant enzymes, activating protein 1 (AP-1) activity, and expression of AP-1-dependent, differentiation-specific genes. We also evaluated the systems involved in the maintenance of a positive ascorbate/dehydroascorbate ratio, i.e., transport and recycling. Leptin altered the keratinocyte redox state, as evident by enhanced ROS generation, oxidized/reduced glutathione ratio, and AP-1 activity. Still, this phenomenon was temporary. Indeed, we found an adaptive response, as demonstrated by an early induction of catalase and a late induction of specific dehydroas-corbate reductase activities. In particular, leptin-treated cells showed an increased ability to reduce dehydroascorbate, both in a NADH, lipoic acid- and in a NADPH, thioredoxin-dependent manner. Our results show that leptin may induce adaptation to oxidative stress in skin, leading to an improved vitamin C homeostasis. ascorbic acid activating protein 1 ascorbyl free radical 5-(and-6)-chloromethyl-2′7′-dichlorodihydrofluorescein diacetate, acetyl ester dehydroascorbic acid deoxy-d-glucose glutathione peroxidase reduced glutathione oxidized glutathione 55′66′-tetrachloro-1133′-tetraethylbenzimidazolcarbocyanine iodide reactive oxygen species superoxide dismutase thioredoxin reductase Leptin, the product of ob gene, is a small peptide hormone produced mostly in adipose tissue, which acts in the hypothalamus to inhibit food intake and increase energy expenditure (Zhang et al., 1994Zhang Y. Proenca R. Maffei M. Barone M. Leopold L. Friedman J.M. Positional cloning of the mouse obese gene and its human homologue.Nature. 1994; 372: 425-432Crossref PubMed Scopus (11165) Google Scholar). The leptin receptor (Ob-Rb) is expressed in the central nervous system, as well as in peripheral tissues. In accordance with the distribution of its receptor, leptin exerts several important metabolic effects in pancreatic islets and liver, hematopoietic, renal, and intestinal cells (Gainsford et al., 1996Gainsford T. Willson T.A. Metcalf D. et al.Leptin can induce proliferation, differentiation, and functional activation of hematopoietic cells.Proc Natl Acad Sci USA. 1996; 93: 14564-14568Crossref PubMed Scopus (650) Google Scholar; Emilsson et al., 1997Emilsson V. Liu Y.L. Cawthorne M.A. Morton N.M. Davenport M. Expression of the functional leptin receptor mRNA in pancreatic islets and direct inhibitory action of leptin on insulin secretion.Diabetes. 1997; 46: 313-316Crossref PubMed Scopus (0) Google Scholar; Wang et al., 1997Wang Y. Kuropatwinski K.K. White D.W. Awley T.S. Hawley R.G. Tartaglia L.A. Baumann H. Leptin receptor action in hepatic cells.J Biol Chem. 1997; 272: 16216-16223Crossref PubMed Scopus (198) Google Scholar; Stan et al., 2001Stan S. Levy E. Bendayan M. et al.Effect of human recombinant leptin on lipid handling by fully differentiated Caco-2 cells.FEBS Lett. 2001; 508: 80-84Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar; Wolf et al., 2002Wolf G. Chen S. Han D.C. Ziyadeh F.N. Leptin and renal disease.Am J Kidney Dis. 2002; 39: 1-11Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). In addition, it has recently been reported that leptin action is targeted also toward the epithelial compartment, where it has been shown to play an important role during skin repair. Indeed, leptin administration improves reepithelialization of excisional wounds in leptin-deficient ob/ob mice and accelerates normal wound healing in wild-type mice (Frank et al., 2000Frank S. Stallmeyer B. Kampfer H. Kolb N. Pfeilschifter J. Leptin enhances wound re-epithelialization and constitutes a direct function of leptin in skin repair.J Clin Invest. 2000; 106: 501-509Crossref PubMed Scopus (234) Google Scholar; Ring et al., 2000Ring B.D. Scully S. Davis C.R. Baker M.B. Cullen M.J. Pelleymounter M.A. Danilenko D.M. Systemically and topically administered leptin both accelerate wound healing in diabetic ob/ob mice.Endocrinology. 2000; 141: 446-449Crossref PubMed Scopus (107) Google Scholar). Skin repair is a complex process in which the cellular antioxidant state plays a crucial role. An increased production of reactive oxygen species (ROS) and a large oxidation of ascorbic acid (AA) usually accompany wound healing (Kim et al., 1994Kim M. Otsuka M. Yu R. Kurata T. Arakawa N. The distribution of ascorbic acid and dehydroascorbic acid during tissue regeneration in wounded dorsal skin of guinea pigs.Int J Vitam Nutr Res. 1994; 64: 56-59PubMed Google Scholar). Vitamin C supplementation has been proven to facilitate wound healing in humans (Silverstein and Landsman, 1999Silverstein R.J. Landsman A.S. The effects of a moderate and high dose of vitamin C on wound healing in a controlled guinea pig model.J Foot Ankle Surg. 1999; 38: 333-338Abstract Full Text PDF PubMed Scopus (21) Google Scholar) and to improve the epidermal barrier function in human keratinocytes (Uchida et al., 2001Uchida Y. Behne M. Quiec D. Elias P.M. Holleran W.M. Vitamin C stimulates sphingolipid production and markers of barrier formation in submerged human keratinocyte cultures.J Invest Dermatol. 2001; 117: 1307-1313Crossref PubMed Scopus (64) Google Scholar). Epidermal keratinocytes possess very efficient systems to maintain high levels of intracellular AA, which is accumulated in millimolar concentrations. Vitamin C is imported inside keratinocytes both in the reduced and in the oxidized forms, through specific transporters, and it is maintained in the reduced form by several enzymatic systems (Savini et al., 1999Savini I. D'Angelo I. Ranalli M. Melino G. Avigliano L. Ascorbic acid maintenance in HaCaT cells prevents radical formation and apoptosis by UV-B.Free Radic Biol Med. 1999; 26: 1172-1180Crossref PubMed Scopus (54) Google Scholar; Savini et al., 2000Savini I. Duflot S. Avigliano L. Dehydroascorbic acid uptake in a human keratinocyte cell line (HaCaT) is glutathione-independent.Biochem J. 2000; 345: 665-672Crossref PubMed Google Scholar). Furthermore, recent studies from our laboratory have provided evidence that vitamin C plays different biochemical functions in keratinocytes, by modulating the activity of the transcription factor activating protein 1 (AP-1). First of all, AA can act as protective agent by antagonizing the expression of UV-B-induced, AP-1-regulated genes (Savini et al., 1999Savini I. D'Angelo I. Ranalli M. Melino G. Avigliano L. Ascorbic acid maintenance in HaCaT cells prevents radical formation and apoptosis by UV-B.Free Radic Biol Med. 1999; 26: 1172-1180Crossref PubMed Scopus (54) Google Scholar; Catani et al., 2001Catani M.V. Rossi A. Costanzo A. Sabatini S. Levrero M. Melino G. Avigliano L. Induction of gene expression via AP-1 in the ascorbate protection against UV-induced damage.Biochem J. 2001; 356: 77-85Crossref PubMed Google Scholar). Second, vitamin C exerts prodifferentiating effects through the protein kinase C-dependent induction of AP-1 activity, which in turn increases the expression of marker genes of the cornified envelope (Savini et al., 2002Savini I. Catani M.V. Rossi A. Duranti G. Melino G. Avigliano L. Characterization of keratinocyte differentiation induced by ascorbic acid: Protein kinase C involvement and vitamin C homeostasis.J Invest Dermatol. 2002; 118: 372-379Crossref PubMed Scopus (64) Google Scholar). Leptin may also have a role in modulating the cellular redox balance. In endothelial cells, hyperleptinemia is associated with an increased oxidative stress (Bouloumie et al., 1999Bouloumie A. Marumo T. Lafontan M. Busse R. Leptin induces oxidative stress in human endothelial cells.FASEB J. 1999; 13: 1231-1238Crossref PubMed Scopus (590) Google Scholar), and it has been demonstrated that leptin induces ROS generation by increasing fatty acid oxidation (Yamagishi et al., 2001Yamagishi S. Du Edelstein D.X. Kaneda Y. Guzman M. Brownlee M. Leptin induces mitochondrial superoxide production and monocyte chemoattractant protein-1 expression in aortic endothelial cells by increasing fatty acid oxidation via protein kinase A.J Biol Chem. 2001; 276: 25096-25100Crossref PubMed Scopus (542) Google Scholar). On the other hand, leptin modulates the activity of several antioxidant enzymes: leptin supplementation restores defective antioxidant activities (including plasma and erythrocyte glutathione peroxidase (GPx) and erythrocyte copper/zinc superoxide dismutase (SOD)) in patients with leptin gene mutation (Ozata et al., 2000Ozata M. Uckaya G. Aydin A. Isimer A. Ozdemir C. Defective antioxidant defense system in patients with a human leptin gene mutation.Horm Metab Res. 2000; 32: 269-272Crossref PubMed Scopus (23) Google Scholar). On the basis of these findings, we wondered whether leptin could modulate the cellular redox state of keratinocytes and, in particular, vitamin C homeostasis. We used, as an experimental model, the human nontumoral HaCaT keratinocyte cell line (Boukamp et al., 1988Boukamp P. Petrussevska R.T. Breitkreutz D. Hornung J. Markham A. Fusenig N.E. Normal keratinization in a spontaneously immortalised aneuploid human keratinocyte cell line.J Cell Biol. 1988; 106: 761-771Crossref PubMed Scopus (3257) Google Scholar), which expresses the functional leptin receptor Ob-Rb (Stallmeyer et al., 2001Stallmeyer B. Kampfer H. Podda M. Kaufmann R. Pfeilschifter J. Frank S. A novel keratinocytes mitogen. Regulation of leptin and its functional receptor in skin repair.J Invest Dermatol. 2001; 117: 98-105Crossref PubMed Google Scholar). To study the effect of leptin on the cellular redox balance, we investigated (1) the intracellular ROS production; (2) the intracellular glutathione content; (3) the DNA-binding activity of the redox-sensitive transcription factor AP-1 and the expression of differentiation-specific genes that are under the control of AP-1; (4) the transport and recycling of vitamin C; and (5) the activity of classical antioxidative enzymes, including catalase, GPx, and SOD. Dehydroascorbic acid (DHA) was obtained from ICN (Aurora, OH). Magnesium ascorbic acid-2 phosphate was obtained from Wako Pure Chemical Industries (Neuss, Germany). [γ-33P]ATP and [α-33P]dCTP were purchased from Amersham (Arlington Heights, IL). Human recombinant leptin and all the other reagents, unless otherwise indicated, were from Sigma Chemical Co. (St. Louis, MO). HaCaT cells were provided by N.E. Fusenig (German Cancer Research Center, Heidelberg, Germany) and were grown in a 1:1 mixture of minimal essential medium and Ham's F12 medium (Gibco) supplemented with 10% (vol/vol) heat-inactivated fetal calf serum (HyClone, Oud-Beijerland, Holland), 1.2 g per L Na-bicarbonate, 1% (vol/vol) nonessential amino acids, and 15 mM HEPES, at 37°C with 5% CO2 in a humidified atmosphere. No antibiotics were used. Cells were split 1:6 twice weekly and fed 24 h before each experiment. Intracellular ROS generation was measured by using the fluorescent probe 5-(and-6)-chloromethyl-2′,7′-dichlorodihydro-fluorescein diacetate, acetyl ester (CM-H2DCFDA; Molecular Probes Inc., Eugene, OR). Cells were treated with 100 ng per mL leptin for different incubation times and then incubated with 10 μM CM-H2DCFDA for 20 min at 37°C in the dark. Radical formation was assessed by flow cytometry in a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA). CM-H2DCFDA mean fluorescence was registered at 530 nm (bandwidth 30 nm) exciting at 488 nm using a 15-mW argon laser. Ten thousand events were evaluated for every analysis. When appropriate, inhibitors of electron transport were added to culture medium, to define the sites of ROS production. Rotenone (5 μM) and antimycin A (0.2 μM) inhibit complexes I and III, respectively, whereas carbonyl cyanide m-chlorophenylhydrazone (0.5 μM) leads to uncoupling of the respiratory chain from ATP synthesis. Indomethacin (20 μM, inhibitor of cyclooxygenase), 5,8,11,14-eicosatetraynoic acid (20 μM, inhibitor of lipoxygenase), and 1-aminobenzotriazole (50 μM, inhibitor of cytochrome P450) were also used. Mitochondrial mass and function were assessed by flow cytometry using 5,5′,6,6′-tetrachloro-1,1,3,3′-tetraethylbenzimidazol carbocyanine iodide (JC-1; Molecular Probes) staining. This mitochondrial dye can exist either as monomer or as dimer, depending on transmembrane potential, and the two different configurations show different fluorescence emissions. Thus, JC-1 staining allows the simultaneous analysis of mitochondrial mass (by measuring the green fluorescence, corresponding to JC-1 monomers) and potential (by measuring the red fluorescence, corresponding to JC-1 aggregates). After treatments, cells were trypsinized and incubated with 10 μM JC-1 for 20 min at 37°C before flow analysis. Mobility shift experiments were performed as previously described (Schreiber et al., 1989Schreiber E. Muller M.M. Schaffner W. Rapid detection of octamer-binding proteins with ‘mini-extracts,’ prepared from a small number of cells.Nucleic Acids Res. 1989; 17: 6419Crossref PubMed Scopus (3876) Google Scholar;Lee et al., 1996Lee J.H. Jang S.I. Markova N.G. Steinert P.M. The proximal promoter of the transglutaminase 3 gene.J Biol Chem. 1996; 271: 4561-4568Crossref PubMed Scopus (98) Google Scholar). The oligonucleotides were AP-1 consensus CGCTTGATGAGTCAGCCGGAA and AP-1 mutant CGCTTGATTAGTTAGCCGGAA. The complexes were resolved on nondenaturing 6% (wt/vol) polyacrylamide gels in 0.5 × TBE buffer for 1 h at 14 V per cm and autoradiographed overnight. Two million HaCaT cells were used to isolate total RNA by Trizol (Gibco). Amplification of sodium-dependent ascorbate transporters (hSVCT1 and hSVCT2), TGase 1, loricrin, and 18S rRNA were performed as described (Savini et al., 2002Savini I. Catani M.V. Rossi A. Duranti G. Melino G. Avigliano L. Characterization of keratinocyte differentiation induced by ascorbic acid: Protein kinase C involvement and vitamin C homeostasis.J Invest Dermatol. 2002; 118: 372-379Crossref PubMed Scopus (64) Google Scholar). As control of differentiation, we used HaCaT cells treated, for 3 days, with the classical inducer phorbol myristate acetate (10 ng/mL). For amplification of cytosolic thioredoxin reductase (TrxR), 1 μg of total RNA was reverse-transcribed using the Superscript preamplification system and oligo(dT) primer (Gibco), following the manufacturer's instructions; 10% of the first strand reaction was then PCR-amplified. Control reactions were performed to ensure complete removal of DNA and exponential amplification of mRNA. PCR was carried out in the presence of 3 μCi of [α-33P]dCTP. The amplification parameters were as follows: 94°C 30 s, 56°C 30 s, and 68°C 2 min. Linear amplification was observed after 20 cycles. Twenty microliters of the reaction was electrophoresed on a 6% (wt/vol) polyacrylamide gel, which was then dried and autoradiographed. The primers, which did not cross-react with the mitochondrial isoform of TrxR, were as follows: TrxR (+) 5′-TACGGTGATGCTGGCAATAGG-3′ and TrxR (–) 5′-TGGTCAGTCCACATTTGAGCG-3′. After treatment, cells were resuspended in lysis buffer (25 mM Tris–HCl, pH 8.0, 1 mM EDTA, 0.5% SDS) and sonicated. Total proteins (10–20 μg) were subjected to SDS–PAGE on a 10% polyacrylamide gel and electroblotted onto a PVDF membrane. Blots were blocked with 5% nonfat dry milk (Bio-Rad, Hercules, CA) and then incubated with anti-keratin 1 primary antibody (Babco, Tucson, AZ). After washings and incubation with the horseradish peroxidase-conjugated secondary antibody, detection was carried out with ECL (Amersham). Intracellular reduced (GSH) and oxidized (GSSG) glutathione content was quantified by a 5,5′-dithiobis(2-nitrobenzoic acid)–glutathione reductase recycling assay, according to the method ofAnderson, 1985Anderson M.E. Determination of glutathione and glutathione disulfide in biological samples.Methods Enzymol. 1985; 113: 548-555Crossref PubMed Scopus (2300) Google Scholar. GSSG was selectively measured in samples where GSH was masked by pretreatment with 2-vinylpyridine. Subcellular fractions were obtained as previously described (Savini et al., 1999Savini I. D'Angelo I. Ranalli M. Melino G. Avigliano L. Ascorbic acid maintenance in HaCaT cells prevents radical formation and apoptosis by UV-B.Free Radic Biol Med. 1999; 26: 1172-1180Crossref PubMed Scopus (54) Google Scholar). Mitochondrial fraction was typically enriched 12.3-fold over the whole homogenate, as assessed by analysis of cytochrome c oxidase activity (Storrie and Madden, 1990Storrie B. Madden E.A. Isolation of subcellular organelles.Methods Enzymol. 1990; 182: 214-215Google Scholar). Intracellular AA content was measured by using HPLC with UV detection at 265-nm wavelength, i.e., the absorbance peak of AA, as described (Savini et al., 2000Savini I. Duflot S. Avigliano L. Dehydroascorbic acid uptake in a human keratinocyte cell line (HaCaT) is glutathione-independent.Biochem J. 2000; 345: 665-672Crossref PubMed Google Scholar). Briefly, 2.5 × 106 cells were incubated in transport medium (5 mM KCl, 1.9 mM KH2PO4, 5.5 mM glucose, 0.3 mM MgSO4, 1 mM MgCl2, 0.3 mM CaCl2, 10 mM Hepes, 147 mM NaCl, 1.1 mM Na2HPO4, pH 7.4) containing the stable vitamin C derivative ascorbic acid-2 phosphate or DHA. After incubation, AA was extracted and analyzed. Deoxyglucose (DOG) uptake was carried out by scintillation spectrometry measurements, 8 × 105 cells in 9-cm2 dishes were incubated in 300 μL of transport medium. In time-dependent experiments, 0.2 μCi of [1, 2-3H]2-DOG (50 Ci/mmol) and 0.3 mM of the respective unlabeled compound was used. At fixed intervals, cells were harvested, lyzed, and assayed by liquid scintillation spectrometry as described (Savini et al., 2000Savini I. Duflot S. Avigliano L. Dehydroascorbic acid uptake in a human keratinocyte cell line (HaCaT) is glutathione-independent.Biochem J. 2000; 345: 665-672Crossref PubMed Google Scholar). For accumulation studies, cells were incubated for 30 min with 0.2 μCi [1, 2-3H]2-DOG and adequate concentrations (0–3.5 mM) of the respective unlabeled compound. DHA reductase activities were measured at 37°C after incubation of cell homogenates with 1 mM DHA for 20 min in 50 mM Tris–HCl, pH 7.5, containing 1 mM EDTA. The 20-min period was chosen as DHA degradation was minimal and DHA reduction rate was linear with time. After incubation and precipitation of proteins by methanol, ascorbate content was evaluated by HPLC. The basal DHA reductase activity (i.e., measured in absence of exogenous cofactors) was calculated after correction for nonenzymatic reduction of DHA by a concentration of GSH corresponding to its cellular content. The contribution of single DHA reductase activities was measured in cell homogenates or subcellular fractions after overnight dialysis to remove endogenous cofactors such as glutathione and pyridine nucleotides. To test different DHA reductase activities single cofactors (NADPH plus GSH, NADPH plus thioredoxin, and NADH plus lipoic acid) were added to the reaction mixture. Ascorbyl free radical (AFR) reductase activity was measured spectrophotometrically, through the rate of ascorbate free radical-dependent oxidation of NADH, by monitoring the decrease in 340-nm absorbance (E=6.2 mM–1 cm–1) at 25°C (Savini et al., 1999Savini I. D'Angelo I. Ranalli M. Melino G. Avigliano L. Ascorbic acid maintenance in HaCaT cells prevents radical formation and apoptosis by UV-B.Free Radic Biol Med. 1999; 26: 1172-1180Crossref PubMed Scopus (54) Google Scholar). Corrections were made for direct oxidation of NADH by homogenates. The assay mixture contained 0.05 mM Tris–HCl buffer, pH 7.8, 1 mM EDTA, 0.1 mM NADH, 1 mM ascorbate and aliquots of each sample. The reaction was started by adding 0.28 U of ascorbate oxidase to generate ascorbate free radical. Transmembrane AFR reductase activity was measured as previously described, by monitoring at 265 nm the prevention of ascorbate autoxidation in the presence or in the absence of cells (Savini et al., 1998Savini I. D'Angelo I. Annicchiarico-Petruzzelli M. Bellincampi L. Melino G. Avigliano L. Ascorbic acid recycling in N-myc amplified human neuroblastoma cells.Anticancer Res. 1998; 18: 819-822PubMed Google Scholar). TrxR activity was assessed by the insulin-reducing assay (Holmgren and Bjornstedt, 1995Holmgren A. Bjornstedt M. Thioredoxin and thioredoxin reductase.Methods Enzymol. 1995; 252: 199-208Crossref PubMed Scopus (786) Google Scholar). Briefly, samples were incubated in a final volume of 120 μL containing 0.12 M HEPES/Tris buffer, pH 7.0, 3.4 mM EDTA, 0.85 mM NADPH, 30 μM thioredoxin, and 0.35 mM insulin. After 20 min of incubation at 37°C, the reaction was stopped by adding 0.5 mL of 6 M guanidine hydrochloride in 0.2 M Tris/HCl, pH 8.0, containing 10 mM EDTA and 1 mM 5, 5′-dithiobis(2-nitrobenzoic acid). Reduced insulin formation was followed by the increase of absorbance at 412 nm. Lipoamide dehydrogenase activity was assessed according toBerger et al., 1996Berger I. Elpeleg O.N. Saada A. Lipoamide dehydrogenase activity in lymphocytes.Clin Chim Acta. 1996; 256: 197-201Crossref PubMed Scopus (15) Google Scholar in 50 mM potassium phosphate buffer, pH 6.5, containing 1 mM EDTA and 0.3 mM NADH. Following addition of 2 mM lipoamide, the oxidation of NADH was monitored by the decrease in 340 nm absorbance. Manganese and copper/zinc SOD activities were determined according to the method ofCrapo et al., 1978Crapo J.D. McCord J.M. Fridovich I. Preparation and assay of superoxide dismutase.Methods Enzymol. 1978; 53: 382-393Crossref PubMed Scopus (598) Google Scholar, by monitoring the inhibition of reduction of cytochrome c in a coupled system with xanthine and xanthine oxidase. The specific inhibition of copper/zinc SOD by 9 mM potassium thiocyanate allows manganese determination by the same procedure. Catalase activity was measured by monitoring the decompo-sition of H2O2 at 240 nm (Aebi, 1984Aebi H. Catalase in vitro.Methods Enzymol. 1984; 105: 121-126Crossref PubMed Scopus (15643) Google Scholar). GPx activity was measured according toDel Maestro and McDonald, 1985Del Maestro R.F. McDonald W. Oxidative enzymes in tissue homogenates.in: Greenwald R.A. CRC Handbook of Methods for Oxygen Radical Research. CRC Press, Boca Raton (FL)1985: 294-296Google Scholar using tert-butylhydro-peroxide as the substrate. This was achieved by following the decrease in NADPH concentration at 340 nm over time. Statistical analysis of means±SD was conducted with the program Stat View 4.02 for Macintosh (Abacus Concepts Inc., Berkeley, CA). To evaluate the effect of leptin supplementation on the cellular redox state, we measured intracellular ROS production. Compared with untreated cells, leptin increased ROS levels by about 3.8-fold at 1-h incubation. This was a transient phenomenon, because at 24 h, ROS generation was decreased to 1.8-fold over control cells and, at 72 h, it returned close to the original basal level (Figure 1a). Because ROS can raise from mitochondria, lipoxygenase, cyclooxygenase, or microsomal systems, we investigated the sites of ROS production, by treating cells with inhibitors associated with the different systems. All the inhibitors were preincubated with cells for 20 min before leptin administration and were still present during the 1-h incubation with the hormone. Mitochondrial energy metabolism seemed to be the main ROS generator, because we found reduced levels of ROS in HaCaT cells incubated with leptin and inhibitors of electron transport (Figure 1b). The strongest blocking was observed with rotenone (an inhibitor of complex I) and antimycin A (inhibitor of complex III) (Figure 1b). Indeed, in the presence of rotenone or antimycin A, ROS were reduced to basal levels. Inhibition of ROS generation was also afforded by the third compound (carbonyl cyanide m-chlorophenylhydrazone; uncoupler of oxidative phosphorylation), although it was less effective: this was possibly a result of the increase over control ROS level induced by the drug alone (Figure 1b). An approximately 17% inhibition of leptin-mediated ROS production was also obtained by 5,8,11,14-eicosatetraynoic acid (inhibitor of lipoxygenase), whereas inhibitors of the cyclooxygenase (indomethacin) and microsomal cytochrome P450 (1-aminobenzotriazole) pathways had no effect (Figure 1b). Associated with increased mitochondrial ROS production, we also found a significant decrease in the mitochondrial energetic state (ΔΨm). With respect to control cells (Figure 1c), leptin-treated cells (Figure 1d) showed a decreased fluorescence of JC-1 aggregates (FL2-H), as the mitochondrial intermembrane potential decrea-sed. In the same time, the number of monomer-containing cells (FL1-H) increased (quoted triangle gate). Because leptin increases the oxidative status, and glutathione together with vitamin C are the primary water-soluble antioxidants, we investigated the glutathione stores in leptin-supplemented cells. Although the total intracellular glutathione amount (10±0.7 mM) remained unchanged, its GSSG-to-GSH ratio (1:10) was increased by about 2-fold within the first hours of leptin treatment. The observed increase was reduced to 1.3-fold over untreated cells at 24 h and returned to normal levels at 48 and 72 h (Figure 2). To further investigate the effects of leptin on the cellular redox state, we measured the DNA-binding activity of the redox-sensitive transcription factor AP-1. Leptin was able to enhance the ability of nuclear extracts to bind a specific oligonucleotide containing an AP-1 responsive site, in a time-dependent fashion. A relevant effect could be seen at 1 h of incubation; it was still evident at 24 h and it returned to basal levels at 48 h (Figure 3a). Because most biologic markers of differentiating keratinocytes are under the control of AP-1, we investigated them under leptin treatment. The steady-state levels of mRNA transglutaminase-1 and loricrin were only slightly upregulated (Figure 3b). The protein expression of the suprabasal 68-kDa keratin 1 was not modified by leptin (Figure 3c). These results were confirmed in primary normal human keratinocytes (data not shown). Thus, the transient induction of AP-1 was not sufficient to promote differentiation. Human keratinocytes transport the reduced and oxidized forms of vitamin C intracellularly through two different systems: a Na+-dependent cotransporter for AA and a facilitative glucose transporter for DHA (Savini et al., 2000Savini I. Duflot S. Avigliano L. Dehydroascorbic acid uptake in a human keratinocyte cell line (HaCaT) is glutathione-independent.Biochem J. 2000; 345: 665-672Crossref PubMed Google Scholar). Leptin did not affect AA transport at any time of supple-mentation. Indeed, both time–course and dose–response studies showed superimposed curves (Figure 4a). In agreement with this result, transcription of both sodium-dependent ascorbate trans-porters hSVCT1 and hSVCT2 was not affected by leptin supple-mentation, as assessed by RT-PCR analysis (Figure 4a, inset). On the other hand, DHA uptake increased after leptin treatment. This was evident at 48 h and further enhanced at 72 h. On the basis of these findings, we carried out time-dependent and dose–response curves on DHA uptake in HaCaT cells supplemented with leptin for 72 h. Leptin-supplemented cells showed a higher AA content with respect to control cells, after a 30-min incubation with DHA (Figure 4c,d). At the time of maximum accumulation, DHA uptake reflects both its transport and its reduction to AA inside cells (Vera et al., 1995Vera J.C. Rivas C.I. Velasquez F.V. Zhang R.H. Concha I.I. Golde D.W. Resolution of the facilitated transport of dehydroAA from its intracellular accumulation as AA.J Biol Chem. 1995; 270: 23706-23712Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Thus, the transport efficiency was evaluated by performing rapid uptake experiments (up to 5 min) because under these conditions DHA reduction was not the rate-limiting step. Under these experimental conditions, leptin had no effect on DHA transport (data not shown). The finding that leptin did not act on DHA transport was further confirmed by measuring the activity of facilitative glucose transporters: as expected, deoxyglucose trans-port remained unchanged after leptin supplementation (Figure 4b). These results indicated that the improved ability of leptin-supplemented cells to accumulate AA should be only due to enhanced vitamin C recycling. In mammalian cells, vitamin C is maintained in the reduced form by d
Referência(s)