TLR4 and MD-2 Expression Is Regulated by Immune-mediated Signals in Human Intestinal Epithelial Cells
2002; Elsevier BV; Volume: 277; Issue: 23 Linguagem: Inglês
10.1074/jbc.m110333200
ISSN1083-351X
AutoresMaría T. Abreu, Elizabeth T. Arnold, Lisa S. Thomas, Rivkah Gonsky, Yuehua Zhou, Bing Hu, Moshe Arditi,
Tópico(s)Mycobacterium research and diagnosis
ResumoThe normal intestinal epithelium is not inflamed despite contact with a high density of commensal bacteria. Intestinal epithelial cells (IEC) express low levels of TLR4 and MD-2 and are lipopolysaccharide (LPS)-unresponsive. We hypothesized that immune-mediated signals regulate the expression of TLR4 and MD-2 in IEC. Expression of TLR4 and MD-2 was examined in normal colonic epithelial cells or intestinal epithelial cell lines. The effect of the cytokines interferon (IFN)-γ, IFN-α, and tumor necrosis factor-α (TNF-α) on TLR4 and MD-2 expression was examined by reverse transcription-PCR and Western blot. NF-κB transcriptional activation and interleukin-8 secretion were used as measures of LPS responsiveness. Native colonic epithelial cells and IEC lines express a low level of TLR4 and MD-2 mRNA. IFN-γ regulates MD-2 expression in both IEC lines, whereas IFN-γ and TNF-α regulate TLR4 mRNA expression in IEC lines. Pre-incubation with IFN-γ and/or TNF-α sensitizes IEC to LPS-dependent interleukin-8 secretion. To examine MD-2 transcriptional regulation, we cloned a 1-kb sequence proximal to the MD-2 gene translational start site. This promoter directed expression of a reporter gene in endothelial cells and IEC. IFN-γ positively regulated MD-2 promoter activity in IEC. Co-expression of a STAT inhibitor, SOCS3, blocked IFN-γ-mediated MD-2 promoter activation. T cell-derived cytokines lead to increased expression of TLR4 and MD-2 and LPS-dependent pro-inflammatory cytokine secretion in IEC. IFN-γ regulates expression of the critical TLR4 co-receptor MD-2 through the Janus tyrosine kinase-STAT pathway. Th1 cytokines may initiate or perpetuate intestinal inflammation by altering toll-like receptor expression and bacterial reactivity. The normal intestinal epithelium is not inflamed despite contact with a high density of commensal bacteria. Intestinal epithelial cells (IEC) express low levels of TLR4 and MD-2 and are lipopolysaccharide (LPS)-unresponsive. We hypothesized that immune-mediated signals regulate the expression of TLR4 and MD-2 in IEC. Expression of TLR4 and MD-2 was examined in normal colonic epithelial cells or intestinal epithelial cell lines. The effect of the cytokines interferon (IFN)-γ, IFN-α, and tumor necrosis factor-α (TNF-α) on TLR4 and MD-2 expression was examined by reverse transcription-PCR and Western blot. NF-κB transcriptional activation and interleukin-8 secretion were used as measures of LPS responsiveness. Native colonic epithelial cells and IEC lines express a low level of TLR4 and MD-2 mRNA. IFN-γ regulates MD-2 expression in both IEC lines, whereas IFN-γ and TNF-α regulate TLR4 mRNA expression in IEC lines. Pre-incubation with IFN-γ and/or TNF-α sensitizes IEC to LPS-dependent interleukin-8 secretion. To examine MD-2 transcriptional regulation, we cloned a 1-kb sequence proximal to the MD-2 gene translational start site. This promoter directed expression of a reporter gene in endothelial cells and IEC. IFN-γ positively regulated MD-2 promoter activity in IEC. Co-expression of a STAT inhibitor, SOCS3, blocked IFN-γ-mediated MD-2 promoter activation. T cell-derived cytokines lead to increased expression of TLR4 and MD-2 and LPS-dependent pro-inflammatory cytokine secretion in IEC. IFN-γ regulates expression of the critical TLR4 co-receptor MD-2 through the Janus tyrosine kinase-STAT pathway. Th1 cytokines may initiate or perpetuate intestinal inflammation by altering toll-like receptor expression and bacterial reactivity. The intestinal epithelium is continually exposed to a high intraluminal concentration of diverse bacteria and bacterial products (1Dunne C. Inflamm. Bowel Dis. 2001; 7: 136-145Crossref PubMed Scopus (149) Google Scholar, 2Naidu A.S. Bidlack W.R. Clemens R.A. Crit. Rev. Food Sci. Nutr. 1999; 39: 13-126Crossref PubMed Scopus (543) Google Scholar). Despite the density of commensal bacteria and their products, the intestinal mucosa maintains a controlled state of inflammation. By contrast, invasive or toxin-producing pathogenic bacteria elicit acute inflammation and secretion of pro-inflammatory cytokines by intestinal epithelial cells and lamina propria mononuclear cells (3Kim J.M. Eckmann L. Savidge T.C. Lowe D.C. Witthoft T. Kagnoff M.F. J. Clin. Invest. 1998; 102: 1815-1823Crossref PubMed Scopus (260) Google Scholar, 4Hecht G. Am. J. Physiol. 1999; 277: C351-C358Crossref PubMed Google Scholar). Idiopathic inflammatory bowel disease in humans and animals is characterized by acute and chronic inflammation in the absence of a specific pathogen. Compelling evidence in genetically susceptible animal models of inflammatory bowel disease demonstrates that Th1 cytokines and commensal bacteria are required for the induction of chronic inflammation (5Schultz M. Sartor R.B. Am. J. Gastroenterol. 2000; 95 Suppl. 1: S19-S21Crossref Scopus (137) Google Scholar, 6Rath H.C. Ikeda J.S. Linde H.J. Scholmerich J. Wilson K.H. Sartor R.B. Gastroenterology. 1999; 116: 310-319Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 7MacDonald T.T. Pettersson S. Inflamm. Bowel Dis. 2000; 6: 116-122Crossref PubMed Google Scholar, 8French N. Pettersson S. Gut. 2000; 47: 162-163Crossref PubMed Scopus (28) Google Scholar, 9Veltkamp C. Tonkonogy S.L., De Jong Y.P. Albright C. Grenther W.B. Balish E. Terhorst C. Sartor R.B. Gastroenterology. 2001; 120: 900-913Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). The recent discovery of a genetic association in inflammatory bowel disease patients with a mutation in a gene involved in LPS 1The abbreviations used are: LPSlipopolysaccharideTLRtoll-like receptorIECintestinal epithelial cell(s)IFNinterferonJAKJanus tyrosine kinaseSTATsignal transducers and activators of transcriptionIRFinterferon response factorcontiggroup of overlapping clonesILinterleukinELISAenzyme-linked immunosorbent assayGAPDHglyceraldehyde-3-phosphate dehydrogenaseFBSfetal bovine serumPen/Streppenicillin/streptomycinRTreverse transcriptionGASinterferon-γ activation siteHMEChuman dermal endothelial cell signaling,NOD2, supports the idea that innate immunity may be defective in patients with idiopathic inflammatory bowel disease (10Ogura Y. Bonen D.K. Inohara N. Nicolae D.L. Chen F.F. Ramos R. Britton H. Moran T. Karaliuskas R. Duerr R.H. Achkar J.P. Brant S.R. Bayless T.M. Kirschner B.S. Hanauer S.B. Nunez G. Cho J.H. Nature. 2001; 411: 603-606Crossref PubMed Scopus (4271) Google Scholar,11Hugot J.P. Chamaillard M. Zouali H. Lesage S. Cezard J.P. Belaiche J. Almer S. Tysk C. O'Morain C.A. Gassull M. Binder V. Finkel Y. Cortot A. Modigliani R. Laurent-Puig P. Gower-Rousseau C. Macry J. Colombel J.F. Sahbatou M. Thomas G. Nature. 2001; 411: 599-603Crossref PubMed Scopus (4796) Google Scholar). lipopolysaccharide toll-like receptor intestinal epithelial cell(s) interferon Janus tyrosine kinase signal transducers and activators of transcription interferon response factor group of overlapping clones interleukin enzyme-linked immunosorbent assay glyceraldehyde-3-phosphate dehydrogenase fetal bovine serum penicillin/streptomycin reverse transcription interferon-γ activation site human dermal endothelial cell We wished to understand the mechanism by which the normal intestinal epithelium guards against chronic activation in the presence of commensal flora. Commensal gut bacteria include both Gram-positive and Gram-negative organisms (2Naidu A.S. Bidlack W.R. Clemens R.A. Crit. Rev. Food Sci. Nutr. 1999; 39: 13-126Crossref PubMed Scopus (543) Google Scholar). The cell wall of Gram-negative bacteria contains LPS, a potent pro-inflammatory pathogen-associated molecular pattern responsible for the systemic manifestations of septic shock (12Aderem A. Ulevitch R.J. Nature. 2000; 406: 782-787Crossref PubMed Scopus (2665) Google Scholar). The response to LPS is mediated by its interaction with toll-like receptor 4 (TLR4) in conjunction with secreted MD-2 and soluble or membrane-bound CD14 and transduced via the IL-1 receptor signaling complex to activate NF-κB and pro-inflammatory cytokine secretion (13da Silva Correia J. Soldau K. Christen U. Tobias P.S. Ulevitch R.J. J. Biol. Chem. 2001; 276: 21129-21135Abstract Full Text Full Text PDF PubMed Scopus (561) Google Scholar, 14Bowie A. O'Neill L.A. J. Leukocyte Biol. 2000; 67: 508-514Crossref PubMed Scopus (401) Google Scholar, 15Zhang F.X. Kirschning C.J. Mancinelli R. Xu X.P. Jin Y. Faure E. Mantovani A. Rothe M. Muzio M. Arditi M. J. Biol. Chem. 1999; 274: 7611-7614Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar, 16Jiang Q. Akashi S. Miyake K. Petty H.R. J. Immunol. 2000; 165: 3541-3544Crossref PubMed Scopus (279) Google Scholar). We and others have previously described that intestinal epithelial cells are unresponsive to purified, protein-free LPS as measured by NF-κB activation and IL-8 secretion (17Abreu M.T. Vora P. Faure E. Thomas L.S. Arnold E.T. Arditi M. J. Immunol. 2001; 167: 1609-1617Crossref PubMed Scopus (600) Google Scholar, 18Naik S. Kelly E.J. Meijer L. Pettersson S. Sanderson I.R. J. Pediatr. Gastroenterol. Nutr. 2001; 32: 449-453Crossref PubMed Scopus (135) Google Scholar). To determine the reason for LPS unresponsiveness, we assayed for the presence of TLR4 and its co-receptor MD-2 and found that intestinal epithelial cells express low levels of TLR4 and MD-2 (17Abreu M.T. Vora P. Faure E. Thomas L.S. Arnold E.T. Arditi M. J. Immunol. 2001; 167: 1609-1617Crossref PubMed Scopus (600) Google Scholar). Expression of both TLR4 and MD-2 restores the ability of intestinal epithelial cells to respond to LPS, suggesting that the intracellular signaling pathway leading to NF-κB is intact in these cells. These in vitro model systems are consistent with findings in normal adult human colonic biopsies, small intestinal resections, and fetal intestinal epithelial cells, which have demonstrated low TLR4 expression by immunohistochemistry and RT-PCR (18Naik S. Kelly E.J. Meijer L. Pettersson S. Sanderson I.R. J. Pediatr. Gastroenterol. Nutr. 2001; 32: 449-453Crossref PubMed Scopus (135) Google Scholar, 19Cario E. Podolsky D.K. Infect. Immun. 2000; 68: 7010-7017Crossref PubMed Scopus (1077) Google Scholar). These studies did not examine the expression of the MD-2 co-receptor, which is required for LPS responsiveness, nor did they measure TLR4 function. Little is known about the regulation of TLR4 or MD-2 expression. Whereas normal intestinal epithelial cells express low levels of TLR4, colonic biopsies from patients with inflammatory bowel disease have increased TLR4 expression (19Cario E. Podolsky D.K. Infect. Immun. 2000; 68: 7010-7017Crossref PubMed Scopus (1077) Google Scholar). The pro-inflammatory cytokine IL-1β can increase the level of TLR4 expression in a human fetal small intestinal epithelial cell line (18Naik S. Kelly E.J. Meijer L. Pettersson S. Sanderson I.R. J. Pediatr. Gastroenterol. Nutr. 2001; 32: 449-453Crossref PubMed Scopus (135) Google Scholar), and interferon-consensus sequences have been identified in the TLR4 promoter (20Rehli M. Poltorak A. Schwarzfischer L. Krause S.W. Andreesen R. Beutler B. J. Biol. Chem. 2000; 275: 9773-9781Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). These data support the hypothesis that dysregulated expression of TLRs in response to cytokines may contribute to the pathogenesis of idiopathic inflammatory bowel disease and inappropriate responsiveness to commensal bacteria. Because of its intimate contact with commensal bacterial products as well as potential pathogens, the intestinal epithelium must carefully regulate expression of pattern recognition receptors to avoid persistent activation. In the current study, we have examined the role of T cell-derived cytokines on the regulation of TLR4 and MD-2 expression. We have additionally cloned the promoter for MD-2. Our data demonstrate that MD-2 expression and transcriptional activity are positively regulated by interferon (IFN)-γ, whereas TLR4 expression is regulated by IFN-α. Expression of a STAT inhibitor, SOCS3, blocks IFN-γ-mediated increase in MD-2 promoter activity. The results of these studies have important implications for the understanding of host-microbial interactions in the gut. Intestinal epithelial cell lines Caco-2, HT-29, and T84 were obtained from ATCC (Rockville, MD). Subconfluent monolayers of these cell lines were kept in a humidified incubator at 37 °C with 5% CO2. T84 were cultured on 12-mm Transwell polycarbonate membranes (Costar 3401) and maintained in DMEM/F-12 (Invitrogen) with 5% Pen/Strep, 5% l-glutamine, supplemented with 5% FBS as previously described (21Abreu M.T. Palladino A.A. Arnold E.T. Kwon R.S. McRoberts J.A. Gastroenterology. 2000; 119: 1524-1536Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). T84 cells were used between passages 16 and 35 (22Dharmsathaphorn K. McRoberts J.A. Mandel K.G. Tisdale L.D. Masui H. Am. J. Physiol. 1984; 246: G204-G208Crossref PubMed Google Scholar). Caco-2 were maintained in minimum essential medium (Invitrogen) supplemented with 10% FBS, 2 mm l-glutamine, 0.1 mm nonessential amino acids, 1 mm sodium pyruvate, and 5% Pen/Strep. HT-29 were maintained in McCoy's 5A medium supplemented with 10% FBS and 5% Pen/Strep. The immortalized human dermal endothelial cells (HMEC) (23Ades E.W. Candal F.J. Swerlick R.A. George V.G. Summers S. Bosse D.C. Lawley T.J. J. Invest. Dermatol. 1992; 99: 683-690Abstract Full Text PDF PubMed Google Scholar) (generous gift of Dr. Candal, Center for Disease Control and Prevention, Atlanta, GA) were cultured in MCDB-131 medium supplemented with 10% heat-inactivated fetal bovine serum, 2 mmglutamine, and 100 μg/ml penicillin and streptomycin in 24-well plates, and used between passages 10 and 14, as described previously (15Zhang F.X. Kirschning C.J. Mancinelli R. Xu X.P. Jin Y. Faure E. Mantovani A. Rothe M. Muzio M. Arditi M. J. Biol. Chem. 1999; 274: 7611-7614Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar, 23Ades E.W. Candal F.J. Swerlick R.A. George V.G. Summers S. Bosse D.C. Lawley T.J. J. Invest. Dermatol. 1992; 99: 683-690Abstract Full Text PDF PubMed Google Scholar, 24Faure E. Equils O. Sieling P.A. Thomas L. Zhang F.X. Kirschning C.J. Polentarutti N. Muzio M. Arditi M. J. Biol. Chem. 2000; 275: 11058-11063Abstract Full Text Full Text PDF PubMed Scopus (518) Google Scholar). Highly purified, phenol-water-extracted Escherichia coliK235 LPS (<0.008% protein), which was prepared according to the method of McIntire et al. (25McIntire F.C. Sievert H.W. Barlow G.H. Finley R.A. Lee A.Y. Biochemistry. 1967; 6: 2363-2372Crossref PubMed Scopus (189) Google Scholar), was obtained from Stefanie N. Vogel (Uniformed Services University of the Health Sciences, Bethesda, MD) (26Qureshi N. Takayama K. Sievert T.R. Manthey C.L. Vogel S.N. Hronowski X.L. Cotter R.J. Prog. Clin. Biol. Res. 1995; 392: 151-160PubMed Google Scholar, 27Hirschfeld M., Ma, Y. Weis J.H. Vogel S.N. Weis J.J. J. Immunol. 2000; 165: 618-622Crossref PubMed Scopus (985) Google Scholar). The purity of this LPS preparation has been previously demonstrated (25McIntire F.C. Sievert H.W. Barlow G.H. Finley R.A. Lee A.Y. Biochemistry. 1967; 6: 2363-2372Crossref PubMed Scopus (189) Google Scholar, 28Hogan M.M. Vogel S.N. J. Immunol. 1988; 140: 513-519PubMed Google Scholar, 29Hogan M.M. Vogel S.N. J. Immunol. 1987; 139: 3697-3702PubMed Google Scholar), and this preparation of E. coli LPS is active on TLR4 transfected HEK 293 cells and not on TLR2 transfectants. 2S. N. Vogel, personal communication. Human IL-1β and TNF-α were purchased from R&D Systems (Minneapolis, MN). 5-Azacytidine was purchased from Sigma. Human recombinant IFN-α2b was a kind gift of Schering-Plough (Kenilworth, NJ). ELAM-NF-κB luciferase (15Zhang F.X. Kirschning C.J. Mancinelli R. Xu X.P. Jin Y. Faure E. Mantovani A. Rothe M. Muzio M. Arditi M. J. Biol. Chem. 1999; 274: 7611-7614Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar) and pCMV-EGFP (CLONTECH) (30Abreu-Martin M.T. Chari A. Palladino A.A. Craft N.A. Sawyers C.L. Mol. Cell. Biol. 1999; 19: 5143-5154Crossref PubMed Scopus (181) Google Scholar) were used as described previously. Human IL-8 promoter-luciferase construct was kindly provided by Dr. N. Mukaida (31Matsusaka T. Fujikawa K. Nishio Y. Mukaida N. Matsushima K. Kishimoto T. Akira S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10193-10197Crossref PubMed Scopus (901) Google Scholar). A flag-tagged human TLR4 construct was obtained from Tularik (San Francisco, CA). MD-2 cDNA construct was kindly provided by Dr. Kensuke Miyake (Saga Medical School, Saga, Japan) (32Shimazu R. Akashi S. Ogata H. Nagai Y. Fukudome K. Miyake K. Kimoto M. J. Exp. Med. 1999; 189: 1777-1782Crossref PubMed Scopus (1781) Google Scholar). IRF-1/3X-GAS-luciferase was kindly provided by Dr. Richard Jove (Moffitt Cancer Center and Research, Tampa, FL) (33Turkson J. Bowman T. Garcia R. Caldenhoven E., De Groot R.P. Jove R. Mol. Cell. Biol. 1998; 18: 2545-2552Crossref PubMed Scopus (595) Google Scholar). The SOCS3 expression vector was kindly provided by Dr. Douglas Hilton (Walter and Eliza Hall Institute of Medical Research and Cooperative Research Centre for Cellular Growth Factors, Royal Melbourne Hospital, Victoria, Australia) (34Novak U. Marks D. Nicholson S.E. Hilton D. Paradiso L. Growth Factors. 1999; 16: 305-314Crossref PubMed Scopus (14) Google Scholar). Plasmids were prepared with endotoxin-free Plasmid Maxi-prep kit (Qiagen, Valencia, CA). Caco-2 cells or T84 cells were plated at a density of 150,000 or 200,000 cells/well, respectively, in 12-well plates 24 h prior to transfection. HMEC were plated at a concentration of 50,000 cells/well in 24-well plates. Cells were transfected the following day with FuGENE 6 transfection reagent (Roche Molecular Biochemicals) as per manufacturer's instructions and as described previously (15Zhang F.X. Kirschning C.J. Mancinelli R. Xu X.P. Jin Y. Faure E. Mantovani A. Rothe M. Muzio M. Arditi M. J. Biol. Chem. 1999; 274: 7611-7614Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar, 24Faure E. Equils O. Sieling P.A. Thomas L. Zhang F.X. Kirschning C.J. Polentarutti N. Muzio M. Arditi M. J. Biol. Chem. 2000; 275: 11058-11063Abstract Full Text Full Text PDF PubMed Scopus (518) Google Scholar). Reporter genes for pCMV-β-galactosidase, ELAM-NF-κB-luciferase (0.4 μg), IRF-1/3X-GAS-luciferase and pCDNA3 empty vector (0.3–0.6 μg), Flag-tagged wild type human TLR4 (0.3 μg), human MD-2 cDNA (0.3 μg), or SOCS3 constructs were co-transfected as indicated in figure legend. After overnight transfection, cells were stimulated for 5 h with 50 ng/ml LPS, 10 ng/ml human IL-1β, 20 ng/ml TNF-α, or 40 ng/ml IFN-γ (R&D Systems). Cells were then lysed in 200 μl of reporter lysis buffer (Promega, Madison, WI), and luciferase activity was measured with a Promega firefly luciferase kit using a Wallac 1450 Microbeta liquid scintillation counter (PerkinElmer). Data shown are mean ± S.D. of three or more independent experiments and are reported as -fold induction over cells transfected with a control vector. Transfection efficiency was determined by assaying for β-galactosidase activity using a colorimetric method (Promega) as previously described (15Zhang F.X. Kirschning C.J. Mancinelli R. Xu X.P. Jin Y. Faure E. Mantovani A. Rothe M. Muzio M. Arditi M. J. Biol. Chem. 1999; 274: 7611-7614Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar). GenBank™ was searched for human MD-2 and yielded two accession numbers. The MD-2 gene is located on the minus strand of chromosome 8. Accession no. NT_008209 (contig) was used to identify 1 kb of sequence upstream of the start site, and AC009672was used to identify 2 kb of sequence upstream of the start site. The following primers were designed to amplify a 1013-bp sequence (–1kb) and a 2042-bp sequence (–2kb) upstream of the ATG start site: primer 1, GCTTTACAAATGCAAAGAGGATCAG (same primer for both –1kb and –2kb); –1kb = primer 2 reverse, CATGGCCTGTTAGGAATCTGGT; –2kb = primer 3 reverse, GGCTGCTAACCCTAAGCTATATCC. Human genomic DNA was used to amplify the respective sequences. PCR products were cloned into pCR 2.1 TOPO vector and inserts sequenced using M13 forward and reverse primers. After confirmation of the correct sequence, inserts were directionally cloned into the pGL3 basic luciferase reporter vector (Promega). Total RNA was isolated from T84 and HT-29 using a Qiagen kit (Valencia, CA) following manufacturer's instruction and treated with RNase-free DNase I. For RT reaction, the Moloney murine leukemia virus preamplification system (Invitrogen) was used. PCR amplification was performed with Taq polymerase (PerkinElmer, Foster City, CA) using two distinct set of primers and conditions. The first set of primers described amplifies short products of MD-2 and TLR4 (150 bp) and β-actin (300 bp), and the second set of primers and conditions amplifies longer products of MD-2 (422 bp) and TLR4 (548 bp) and GAPDH (983 bp). The shorter product increases the sensitivity for detection of these transcripts. The TLR4 oligonucleotide primers used for RT-PCR were described previously (24Faure E. Equils O. Sieling P.A. Thomas L. Zhang F.X. Kirschning C.J. Polentarutti N. Muzio M. Arditi M. J. Biol. Chem. 2000; 275: 11058-11063Abstract Full Text Full Text PDF PubMed Scopus (518) Google Scholar). The oligonucleotide primer sequences for MD-2 were kindly provided by Dr. Jesse C. Chow (Esai Research Institute, Wilmington, MA). GAPDH primers were obtained from CLONTECH (Palo Alto, CA) and used as per manufacturer's instructions. The TLR2, TLR4, and MD-2 RT-PCR fragments were purified and sequenced to confirm the identity of the fragments. To quantify the level of mRNA expression, RT-PCR products run on a 1% ethidium bromide-stained agarose gel were analyzed on an AlphaImager 2000 densitometer (Alpha Innotech Corp.). AlphaEase software (Alpha Innotech Corp.) was used to compare density of products when corrected for intensity of GAPDH or β-actin expression and -fold induction of expression over unstimulated cells (Table I).Table IRT-PCR primer sequences and PCR conditionsGeneForward primerReverse primerConditionsSize of productbpTLR4 (short)GCTTCTTGCTGGCTGCATAAGAAATGGAGGCACCCCTTC32 cycles at 94 °C for 45 s, 60 °C for 45 s, and 72 °C for 60 s150MD-2 (short)GCAGAGCTCTGAAGGGAGAGACTGGTTGGTGTAGGATGACATCC32 cycles at 94 °C for 45 s, 60 °C for 45 s, and 72 °C for 60 s150β-ActinGGCTACAGCTTCACCACCACGGCCAGACAGCAGTGTGTTGGC35 cycles at 94 °C for 45 s, 58 °C for 45 s, and 72 °C for 60 s300TLR4TGGATACGTTTCCTTATAAGGAAATGGAGGCACCCCTTC38 cycles at 95 °C for 45 s, 54 °C for 45 s, and 72 °C for 1 min548MD-2GAAGCTCAGAAGCAGTATTGGGTCGGTTGGTGTAGGATGACAAACTCC35 cycles at 94 °C for 45 s, 55 °C for 45 s, and 72 °C for 45 s422 Open table in a new tab For TLR4 Western blots, T84 cells were lysed in IP lysis buffer containing 50 mm Hepes, pH 7.9, 250 mm NaCl, 20 mmβ-glycerophosphate, 2 mm dithiothreitol, 1 mmsodium orthovanadate, 1% Nonidet P-40, 1:100 Protease Inhibitor Set III (Calbiochem). Protein concentration was determined using a colorimetric assay Bio-Rad DC protein assay. A total of 55 μg of protein was analyzed on a 10% Tris-HCl polyacrylamide gel (Bio-Rad). Proteins were transferred to nitrocellulose membranes and stained with Ponceau S to verify equal protein loading. Membranes were blocked in 5% milk, 0.1% Tween 20 in Tris-buffered saline for 2–3 h at 4 °C, incubated overnight at 4 °C with anti-human TLR4 antibody (Santa Cruz) (1:250) followed by a 1-h incubation at room temperature with anti-rabbit horseradish peroxidase (1:2000), developed by Lumiglo (Cell Signaling), and exposed to radiographic film. For human IL-8 ELISA, 10,000 cells/well were plated in 96-well plates. Cells were treated with 50 ng/ml LPS, 40 ng/ml IFN-γ, or 20 ng/ml TNF-α for 18 h and supernatants harvested for measurement of IL-8. IL-8 ELISA (BD PharMingen) were performed as per manufacturer's instructions. Fold increase in IL-8 production was derived by calculating the difference between cytokine-stimulated IL-8 production and cytokine-stimulated plus LPS-mediated IL-8 production. This difference was then divided by LPS-dependent IL-8 production alone. Frozen sections derived from human intestinal resections were obtained under the auspices of Cedars-Sinai Medical Center IRB 1465. The tissue used for this study included uninvolved areas of intestine from patients with inflammatory bowel disease or colon cancer. Slides were gently fixed in 100% ethanol followed by a light hematoxylin and eosin staining. An Arcturus laser capture microscope was used to microdissect the tissue. Briefly, intestinal epithelial cells were identified based on appearance and location, microdissected, and captured on a microcentrifuge cap. Lamina propria was separately microdissected and captured from each intestinal specimen. Photo documentation was obtained before and after dissection. Total RNA was made by incubating cells at −80 °C overnight in lysis buffer containing 50 mm Tris-HCl, pH 8.0, 100 mm NaCl, 5 mm MgCl2, 0.5% Triton X-100, 1 mm dithiothreitol, and 1000 units/ml RNase inhibitor. After lysis and centrifugation, total RNA was followed directly by reverse transcription using random hexamers and Superscript II (Invitrogen). The cDNA generated was amplified as described above, with the exception that 38 cycles were used for amplification. Student's t tests, standard deviation, and standard errors were performed using the statistics package within Microsoft Excel. p values were considered statistically significant when <0.05. We have described our findings in three intestinal epithelial cell lines with respect to the expression and function of TLR4 and MD-2 (17Abreu M.T. Vora P. Faure E. Thomas L.S. Arnold E.T. Arditi M. J. Immunol. 2001; 167: 1609-1617Crossref PubMed Scopus (600) Google Scholar). Our finding of low TLR4 expression by intestinal epithelial cells is corroborated by a recent study demonstrating that intestinal epithelial cells from normal human intestinal biopsies express low levels of TLR4 by immunohistochemistry (19Cario E. Podolsky D.K. Infect. Immun. 2000; 68: 7010-7017Crossref PubMed Scopus (1077) Google Scholar). To assess the level of MD-2 expression by primary human intestinal epithelial cells, we utilized laser capture microscopy to microdissect intestinal epithelial cells and separate these from lamina propria cells from five distinct colonic resections (Fig. 1 A). Using RT-PCR to examine the expression of TLR4 and MD-2, we found that both colonic epithelial cells and lamina propria-derived cells express a low level of TLR4 (Fig. 1 B). By contrast, our data demonstrate that MD-2 is not expressed in normal colonic epithelial cells but is found in some samples of lamina propria-derived cells (Fig. 1 B). These data support the hypothesis that the intestinal epithelium normally down-regulates expression of TLR4 and MD-2. TLR4 and MD-2 expression is low in intestinal epithelial cells compared with human dermal endothelial cells. IFN-γ has recently been shown to stimulate TLR4 expression in endothelial cells (35Faure E. Thomas L., Xu, H. Medvedev A. Equils O. Arditi M. J. Immunol. 2001; 166: 2018-2024Crossref PubMed Scopus (408) Google Scholar) and HL-60 monocytic cells (36Mita Y. Dobashi K. Nakazawa T. Mori M. Br. J. Haematol. 2001; 112: 1041-1047Crossref PubMed Scopus (17) Google Scholar) but not in murine macrophages (37Wang T. Lafuse W.P. Zwilling B.S. J. Immunol. 2000; 165: 6308-6313Crossref PubMed Scopus (92) Google Scholar, 38Matsuguchi T. Musikacharoen T. Ogawa T. Yoshikai Y. J. Immunol. 2000; 165: 5767-5772Crossref PubMed Scopus (251) Google Scholar). TLR4 expression is increased in intestinal epithelial cells in patients with inflammatory bowel disease (19Cario E. Podolsky D.K. Infect. Immun. 2000; 68: 7010-7017Crossref PubMed Scopus (1077) Google Scholar). Because inflammatory bowel disease is associated with increased mucosal production of the Th1 cytokines IFN-γ and TNF-α, we hypothesized that these cytokines regulated expression of TLR4 and its co-receptor MD-2 in intestinal epithelial cells (39Papadakis K.A. Targan S.R. Gastroenterology. 2000; 119: 1148-1157Abstract Full Text Full Text PDF PubMed Scopus (331) Google Scholar, 40Plevy S.E. Landers C.J. Prehn J. Carramanzana N.M. Deem R.L. Shealy D. Targan S.R. J. Immunol. 1997; 159: 6276-6282PubMed Google Scholar). We tested this hypothesis by exposing T84, a crypt-like intestinal epithelial cell line (41Madara J.L. Dharmsathaphorn K. J. Cell Biol. 1985; 101: 2124-2133Crossref PubMed Scopus (327) Google Scholar), and HT-29 cells, a colonocyte-like intestinal epithelial cell line, to the cytokines IFN-γ, TNF-α, or a combination of the two and evaluated expression of messenger RNA for TLR4 and MD-2 by RT-PCR (Fig. 2 A). With respect to TLR4 expression (Fig. 2 A, top panels), IFN-γ and TNF-α modestly increased TLR4 expression, which was highest at 24 h in HT-29 cells and 6 h in T84 cells. MD-2 expression by contrast (Fig. 2 A, middle panels) was primarily regulated by IFN-γ in both IEC lines. IL-1β, which potently induces IL-8 secretion by CaCo-2 cells, had no effect on TLR4 expression (data not shown). Expression of TLR4 protein was subsequently evaluated by Western blotting in T84 cells (Fig. 2 C). As expected, resting T84 cells do not have detectable TLR4 protein. TNF-α treatment of T84 cells permits a low level of TLR4 detection. In summary, Th1 cytokines differentially regulate the expression of TLR4 and MD-2 in intestinal epithelial cells in vitro. The relative absence of TLR4 protein expression suggests that mRNA expression may not be directly correlated with protein expression. Viral gastroenteritis is associated with increased production of IFN-α by dendritic cells in the gut-associated lym
Referência(s)