Portal de Periódicos da CAPES

Cyclooxygenase-2 in testes of infertile men: evidence for the induction of prostaglandin synthesis by interleukin-1β

2010; Elsevier BV; Volume: 94; Issue: 5 Linguagem: Inglês

10.1016/j.fertnstert.2010.01.039

1556-5653

María Eugenia Matzkin, Artur Mayerhofer, Soledad Paola Rossi, Betina González, Candela R. González, Silvia I. González-Calvar, Claudio Terradas, Roberto Ponzio, Elisa Puigdomènech, Oscar Levalle, Ricardo Saúl Calandra, Mónica Beatriz Frungieri,

Reproductive Physiology in Livestock

As we previously reported, testes of men suffering from hypospermatogenesis and germ cell arrest or Sertoli cell-only syndrome show a major increase in the number of macrophages expressing interleukin-1β (IL-1β) and abundant expression of cyclooxygenase-2 (COX-2), the inducible isoform of the key enzyme in the biosynthesis of prostaglandins (PGs), in Leydig cells. In the present study we report [1] a positive correlation between IL-1β levels and COX-2 expression in testes of infertile patients, [2] the induction of COX-2 by IL-1β in mouse Leydig cells (TM3) and human macrophages (THP-1), and therefore [3] evidence for an IL-1β-dependent induction of testicular inflammatory states. As we previously reported, testes of men suffering from hypospermatogenesis and germ cell arrest or Sertoli cell-only syndrome show a major increase in the number of macrophages expressing interleukin-1β (IL-1β) and abundant expression of cyclooxygenase-2 (COX-2), the inducible isoform of the key enzyme in the biosynthesis of prostaglandins (PGs), in Leydig cells. In the present study we report [1] a positive correlation between IL-1β levels and COX-2 expression in testes of infertile patients, [2] the induction of COX-2 by IL-1β in mouse Leydig cells (TM3) and human macrophages (THP-1), and therefore [3] evidence for an IL-1β-dependent induction of testicular inflammatory states. Interleukin-1β (IL-1β) is a proinflammatory cytokine secreted by macrophages (MACs) (1Driscoll K.E. Macrophage inflammatory proteins: biology and role in pulmonary inflammation.Exp Lung Res. 1994; 20: 473-490Crossref PubMed Scopus (268) Google Scholar, 2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). In spite of its immune privileged status, the testis is not isolated from the immune system. Therefore, locally produced cytokines, as well as those in the general circulation, have the potential to exert effects at the testicular level (3Hedger M.P. Meinhardt A. Cytokines and the immune-testicular axis.J Reprod Immunol. 2003; 58: 1-26Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). We have previously reported that human testicular MACs express IL-1β, and that the number of MACs is significantly increased in testicular biopsies of men with cases of idiopathic infertility revealing Sertoli cell-only (SCO) syndrome or severe hypospermatogenesis and germ cell arrest (GA) (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). It has been reported that IL-1β stimulates cyclooxygenase-2 (COX-2), the inducible isoform of the key enzyme in the biosynthesis of prostaglandins (PGs), in some tissues and cells such as granulosa–luteal cells and Leydig cell progenitors (4Narko K. Ritvos O. Ristimäki A. Induction of cyclooxygenase-2 and prostaglandin F2alpha receptor expression by interleukin-1beta in cultured human granulosa–luteal cells.Endocrinology. 1997; 138: 3638-3644Crossref PubMed Scopus (72) Google Scholar, 5Walch L. Morris P.L. Cyclooxygenase 2 pathway mediates IL-1beta regulation of IL-1alpha, -1beta, and IL-6 mRNA levels in Leydig cell progenitors.Endocrinology. 2002; 143: 3276-3283Crossref PubMed Scopus (40) Google Scholar). Because we reported that COX-2 is not detected in normal human testes but is expressed in testicular biopsies from infertile patients (6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar), in the present study we extended our previous works in this line of research and further investigated the IL-1β system in human testicular MACs and Leydig cells, its correlation with COX-2 expression, and the potential action of IL-1β on PG synthesis.For the evaluation of human testicular biopsies from adult men (27–40 years old) with GA (n = 6) and SCO syndrome (n = 6), the Institutional Review Board (IRB) approval was obtained from the local Ethics Committees of Munich University (Germany), Durand Hospital (Buenos Aires, Argentina), and the Institute of Biology and Experimental Medicine, CONICET (Buenos Aires, Argentina). All participants granted written informed consent.The TM3 cells (American Tissue Culture Collection [ATCC], Riversville, MD), derived from immature mouse Leydig cells and THP-1 cells (ATCC) derived from an acute monocytic leukemia, were cultured in F12- Dulbecco's modified Eagle's medium (DMEM) (Sigma Chemical, St Louis, MO) supplemented with 5% horse serum and 2.5% fetal calf serum (FCS; Invitrogen Corporation, Carlsbad, CA) and RPMI1640 medium supplemented with 10% FCS and 0.05 mM 2-mercaptoethanol (Sigma Chemical), respectively. The THP-1 cells were differentiated into MACs with 30 nM of phorbol myristate acetate (Sigma Chemical) during 18 hours.Polyclonal rabbit anti-COX-2 serum (Oxford Biomedical Research, Oxford, United Kingdom; 1:200), monoclonal mouse anti-IL-1β antibody (R&D Systems, Inc., Minneapolis, MN; 1:100), monoclonal mouse anti-human CD68 antibody (DAKO, Hamburg, Germany; 1:100), polyclonal rabbit anti-3β-hydroxysteroid dehydrogenase (3βHSD) serum (1:2,000), and the avidin-biotin-peroxidase system (Vector Lab, CA), were used for immunohisto/cytochemistry.The laser capture microdissection and pressure catapulting (LMPC) technology developed by P.A.L.M. GmbH (Bernried, Germany) was used to microdissect CD68 and COX-2 immunoreactive cells from human testicular biopsies, as previously described (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar).Total RNA was extracted from human testicular biopsies, cells isolated by LMPC and TM3/THP-1 cells, using the TRIzol reagent (Invitrogen), Purescript kit (Biozym, Hessisch Oldenburg, Germany), and QIAGEN RNeasy mini kit (QIAGEN Inc., Valencia, MO), respectively. The reverse transcriptase (RT) reaction was performed using dN6 random primers, followed by polymerase chain reaction (PCR) amplification (6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar). When required, a second PCR amplification using nested primers was also assayed. Semiquantitative PCR studies were performed using oligonucleotide primers for CD68 (first set: 5′-TGAACCCCAACAAAACC and 5′-GAGAGCAGGTCGAGGTG; heminested set: 5′-GTGCCCATCCCCACCTG and 5′-GAGAGCAGGTCGAGGTG), CD163 (first set: 5′-TGTAGCGGGAGAGTGGAA and 5′-CTGAGCAGGTCACTCCAG; nested set: 5′-TAATGGCTGGAGCATGGA and 5′-CAAAGAGCTGACTCATTC), tryptase (first set: 5′-TGCTGGAGCTGGAGGAGC and 5′-AGGTGCCATTCACCTTGC; nested set: 5′-GTGCTGGGTCACTGGCTG and 5′-CCCGCACACAGCATGTC), chymase (first set: 5′-AGGAGAAAGCCAGCCTGA and 5′-ATGCAGATTTTGTCTTCC; nested set: 5′-CTGGCTGTGGGGACACTC and 5′-ATTGCCCACACACAGCTG), StAR (set: 5′-TGGAGAGGCTCTATGAAGAGC and 5′-GCCACGTAAGTTTGGTCTTAG), COX-2 (first set: 5′-TGTATGTATGAGTGTGGGA and 5′-GGCTTCCCAGCTTTTGTA; nested set: 5′-CTTACCCACTTCAAGGGA and 5′-GCCATAGTCAGCATTGTAAG), IL-1β (first set: 5′-CTGAAAGCTCTCCACCTC and 5′-CGCTTTTCCATCTTCTTCA; nested set: 5′-ACAAGTGGTATTCTCCATG and 5′-TCCACACTCTCCAGCTG), IL-1RI (first set: 5′-CTCCAGGATTCATCAGCA and 5′-GACCCATTCCACTTCCAGTA; nested set: 5′-CTTGTGTGCCCTTATCTG and 5′-TGCTCTTCAGCCACATTC), IL-1RII (first set: 5′-GGAATACAACATCACTAGGA and 5′-TTGTGACTGGATCAAAAATC; heminested set: 5′-CCTGTGATCATTTCTCCC and 5′-TTGTGACTGGATCAAAAATC), IL-1Ra (first set: 5′-GCAAGATGCAAGCCTTCA and 5′-GTCTTCCTGGAAGTAGAA; nested set: 5′-TAACCAGAAGACCTTCTA and 5′-TGTGCAGAGGAACCATCC), and β-actin (set: 5′-GGATGCAGAAGGAGATCA and 5′-CTAGAAGCATTTGCGGTG). Quantitative PCR reactions were conducted using SYBR Green PCR Master Mix, the ABI PRISM 7500 sequence detector System (Applied Biosystems, Foster City, CA), and oligonucleotide primers for COX-2 (5′- CTGGCGCTCAGCCATACAG and 5′- CACTCATACATACACCTCGGT), IL-1β (5′-TCCCCAGCCCTTTTGTTGA and 5′-TAGAACCAAATGTGGCCGTG), and β-actin (5′- TCCCTGGAGAAGAGCTACGA and 5′-AGGAAGGAAGGCTGGAAGAG).Immunoblottings were performed using a rabbit polyclonal anti-COX-2 antiserum (Cayman Chemical, Ann Arbor, MI; 1:250), a rabbit polyclonal anti-human IL-1β antiserum (Cell Signaling Technology Inc., Beverly, MA; 1:500), and a mouse monoclonal anti-actin antibody (Calbiochem, La Jolla, CA; 1:5,000) (7Matzkin M.E. Gonzalez-Calvar S.I. Mayerhofer A. Calandra R.S. Frungieri M.B. Testosterone induction of prostaglandin-endoperoxide synthase 2 expression and prostaglandin F(2alpha) production in hamster Leydig cells.Reproduction. 2009; 138: 163-175Crossref PubMed Scopus (19) Google Scholar).The PGD2 and PGF2α levels in the incubation media from TM3 and THP-1 cells, as well as the concentration of IL-1β in human testes, were assayed using commercially available kits (Cayman Chemical).Cells immunoreactive for CD68, a classic MAC marker, were isolated from human testicular biopsies of infertile men by LMPC. Subsequent semiquantitative PCR analyses revealed the expression of IL-1β, its receptor IL-1RI, and COX-2 (Fig. 1A ). In addition to MACs, we found another cell population from the interstitial compartment strongly stained with the antibody against COX-2 that shows characteristic features of Leydig cells. By LMPC and semiquantitative PCR studies, we demonstrated that these cells express IL-1β, IL-1RI, and StAR, a specific Leydig cell marker (Fig. 1B). Indeed, additional experiments showed immunohistochemical colocalization of COX-2 and 3β-HSD expression in all Leydig cells (data not shown). The lack of amplification of the antagonist receptor Ra and the scavenger receptor IL-1RII (Fig. 1A, B) might be due to methodological limitations of the LMPC/semiquantitative PCR techniques used in our studies, together with a low expression of those genes in the interstitial compartment of the male gonad (8Rozwadowska N. Fiszer D. Jedrzejczak P. Kosicki W. Kurpisz M. Interleukin-1 superfamily genes expression in normal or impaired human spermatogenesis.Genes Immun. 2007; 8: 100-107Crossref PubMed Scopus (22) Google Scholar).Semiquantitative PCR and quantitative PCR assays showed a positive correlation between COX-2 messenger RNA (mRNA) expression and IL-1β mRNA expression in GA and SCO syndrome (r = 0.87 and 0.93 for semiquantitative PCR and quantitative PCR, respectively, P<.05). In addition, the expression of COX-2 protein by immunoblotting and the testicular IL-1β concentration in human testicular biopsies from infertile patients showed a correlation coefficient value of 0.69 (P<.05). We failed to identify IL-1β protein by immunoblotting, probably due to the low testicular IL-1β concentration (range between 100 and 1,000 fg/mg protein) or a low sensitivity of the antibody used.Because of the obvious ethical limitations, we have no access to normal testes. Nevertheless, our previous studies performed in archival paraffin blocks of human testicular biopsies showing normal morphology, failed to detect expression of COX-2 by immunohistochemistry and in addition, a significantly lower amount of testicular MACs expressing IL-1β was detected compared with that found in infertile testes (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar). The lack of differences observed in either COX-2 or IL-1β expression among biopsies revealing GA and SCO syndrome (data not shown) could result from the similar MAC number detected in testes from both pathological groups (GA: 365.75 ± 21.5 MACs/mm2 vs. SCO syndrome: 378.00 ± 97.5 MACs/mm2) together with a potential stimulatory effect of IL-1β on interstitial COX-2 expression.Physiological studies cannot be performed on human testicular biopsies. To our knowledge, there are no human Leydig cell lines available and there are no accessible MACs cell lines derived from human testes. Therefore, non-human TM3 Leydig cells and non-testicular THP-1 MACs that express COX-2, IL-1β, IL-1RI, IL-1RII, and Ra (data not shown) were used to further characterize the interactions between the IL-1β system and COX-2/PGs. After 30 minutes, 3 hours (data not shown), and 6 hours (Fig. 1C) of incubation in the presence of IL-1β (10 and 50 ng/mL; Sigma Chemical), the expression of COX-2 protein and the production of PGD2 and PGF2α were significantly induced in TM3 and THP-1 cells (Fig. 1C). It is important to mention that reports from our group describe the modulation of testicular T production by PGD2 and PGF2α (9Schell C. Frungieri M.B. Albrecht M. Gonzalez-Calvar S.I. Köhn F.M. Calandra R.S. et al.A prostaglandin D2 system in the human testis.Fertil Steril. 2007; 88: 233-236Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 10Frungieri M.B. Gonzalez-Calvar S.I. Parborell F. Albrecht M. Mayerhofer A. Calandra R.S. Cyclooxygenase-2 and prostaglandin F2 alpha in Syrian hamster Leydig cells: inhibitory role on luteinizing hormone/human chorionic gonadotropin-stimulated testosterone production.Endocrinology. 2006; 147: 4476-4485Crossref PubMed Scopus (51) Google Scholar). In addition, the actions of PGs and their receptors have been described in Sertoli cells, germ cells, sperm, and fibroblasts of the wall of the seminiferous tubules (6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar, 11Cooper D.R. Carpenter M.P. Sertoli-cell prostaglandin synthesis. Effects of (follitropin) differentiation and dietary vitamin E.Biochem J. 1987; 241: 847-855PubMed Google Scholar, 12Moskovitz B. Munichor M. Levin D.R. Effect of diclofenac sodium (Voltaren) and prostaglandin E2 on spermatogenesis in mature dogs.Eur Urol. 1987; 13: 393-396PubMed Google Scholar).Not only IL-1β, but also IL-1α, interacts with the IL-1RI receptor (3Hedger M.P. Meinhardt A. Cytokines and the immune-testicular axis.J Reprod Immunol. 2003; 58: 1-26Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). This cytokine is produced by Sertoli cells (13Gérard N. Syed V. Bardin W. Genetet N. Jégou B. Sertoli cells are the site of interleukin-1α synthesis in rat testis.Mol Cell Endocrinol. 1991; 82: R13-R16Crossref PubMed Scopus (104) Google Scholar), spermatocytes, spermatids (14Haugen T.B. Landmark B.F. Josefsen G.M. Hansson V. Högset A. The mature form of interleukin-1α is constitutively expressed in immature male germ cells from rat.Mol Cell Endocrinol. 1994; 105: R19-R23Crossref PubMed Scopus (64) Google Scholar), and testicular MACs (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). The expression of COX2 protein in TM3 and THP-1 cells showed a significant increase after 30 minutes of incubation in the presence of IL-1α (10 and 50 ng/mL; PeproTech, Rocky Hill, NJ), without apparent changes at longer incubation times (3 and 6 hours) (data not shown).In conclusion, our current findings show the existence of an IL-1β system in MACs and Leydig cells of the human testis, and provide insights into how this system could participate in the induction of COX-2 expression and PG synthesis and therefore, in the development of local inflammation that might further deteriorate testicular function in patients with GA and SCO syndrome. Nevertheless, whether the testicular network formed by IL-1β, COX-2, and PGs has a biological relevance in the pathogenesis or maintenance of infertility states and therefore, a potential therapeutic value as targets in future strategies designed for the treatment of fertility disorders, remains to be further investigated. Interleukin-1β (IL-1β) is a proinflammatory cytokine secreted by macrophages (MACs) (1Driscoll K.E. Macrophage inflammatory proteins: biology and role in pulmonary inflammation.Exp Lung Res. 1994; 20: 473-490Crossref PubMed Scopus (268) Google Scholar, 2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). In spite of its immune privileged status, the testis is not isolated from the immune system. Therefore, locally produced cytokines, as well as those in the general circulation, have the potential to exert effects at the testicular level (3Hedger M.P. Meinhardt A. Cytokines and the immune-testicular axis.J Reprod Immunol. 2003; 58: 1-26Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). We have previously reported that human testicular MACs express IL-1β, and that the number of MACs is significantly increased in testicular biopsies of men with cases of idiopathic infertility revealing Sertoli cell-only (SCO) syndrome or severe hypospermatogenesis and germ cell arrest (GA) (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). It has been reported that IL-1β stimulates cyclooxygenase-2 (COX-2), the inducible isoform of the key enzyme in the biosynthesis of prostaglandins (PGs), in some tissues and cells such as granulosa–luteal cells and Leydig cell progenitors (4Narko K. Ritvos O. Ristimäki A. Induction of cyclooxygenase-2 and prostaglandin F2alpha receptor expression by interleukin-1beta in cultured human granulosa–luteal cells.Endocrinology. 1997; 138: 3638-3644Crossref PubMed Scopus (72) Google Scholar, 5Walch L. Morris P.L. Cyclooxygenase 2 pathway mediates IL-1beta regulation of IL-1alpha, -1beta, and IL-6 mRNA levels in Leydig cell progenitors.Endocrinology. 2002; 143: 3276-3283Crossref PubMed Scopus (40) Google Scholar). Because we reported that COX-2 is not detected in normal human testes but is expressed in testicular biopsies from infertile patients (6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar), in the present study we extended our previous works in this line of research and further investigated the IL-1β system in human testicular MACs and Leydig cells, its correlation with COX-2 expression, and the potential action of IL-1β on PG synthesis. For the evaluation of human testicular biopsies from adult men (27–40 years old) with GA (n = 6) and SCO syndrome (n = 6), the Institutional Review Board (IRB) approval was obtained from the local Ethics Committees of Munich University (Germany), Durand Hospital (Buenos Aires, Argentina), and the Institute of Biology and Experimental Medicine, CONICET (Buenos Aires, Argentina). All participants granted written informed consent. The TM3 cells (American Tissue Culture Collection [ATCC], Riversville, MD), derived from immature mouse Leydig cells and THP-1 cells (ATCC) derived from an acute monocytic leukemia, were cultured in F12- Dulbecco's modified Eagle's medium (DMEM) (Sigma Chemical, St Louis, MO) supplemented with 5% horse serum and 2.5% fetal calf serum (FCS; Invitrogen Corporation, Carlsbad, CA) and RPMI1640 medium supplemented with 10% FCS and 0.05 mM 2-mercaptoethanol (Sigma Chemical), respectively. The THP-1 cells were differentiated into MACs with 30 nM of phorbol myristate acetate (Sigma Chemical) during 18 hours. Polyclonal rabbit anti-COX-2 serum (Oxford Biomedical Research, Oxford, United Kingdom; 1:200), monoclonal mouse anti-IL-1β antibody (R&D Systems, Inc., Minneapolis, MN; 1:100), monoclonal mouse anti-human CD68 antibody (DAKO, Hamburg, Germany; 1:100), polyclonal rabbit anti-3β-hydroxysteroid dehydrogenase (3βHSD) serum (1:2,000), and the avidin-biotin-peroxidase system (Vector Lab, CA), were used for immunohisto/cytochemistry. The laser capture microdissection and pressure catapulting (LMPC) technology developed by P.A.L.M. GmbH (Bernried, Germany) was used to microdissect CD68 and COX-2 immunoreactive cells from human testicular biopsies, as previously described (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar). Total RNA was extracted from human testicular biopsies, cells isolated by LMPC and TM3/THP-1 cells, using the TRIzol reagent (Invitrogen), Purescript kit (Biozym, Hessisch Oldenburg, Germany), and QIAGEN RNeasy mini kit (QIAGEN Inc., Valencia, MO), respectively. The reverse transcriptase (RT) reaction was performed using dN6 random primers, followed by polymerase chain reaction (PCR) amplification (6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar). When required, a second PCR amplification using nested primers was also assayed. Semiquantitative PCR studies were performed using oligonucleotide primers for CD68 (first set: 5′-TGAACCCCAACAAAACC and 5′-GAGAGCAGGTCGAGGTG; heminested set: 5′-GTGCCCATCCCCACCTG and 5′-GAGAGCAGGTCGAGGTG), CD163 (first set: 5′-TGTAGCGGGAGAGTGGAA and 5′-CTGAGCAGGTCACTCCAG; nested set: 5′-TAATGGCTGGAGCATGGA and 5′-CAAAGAGCTGACTCATTC), tryptase (first set: 5′-TGCTGGAGCTGGAGGAGC and 5′-AGGTGCCATTCACCTTGC; nested set: 5′-GTGCTGGGTCACTGGCTG and 5′-CCCGCACACAGCATGTC), chymase (first set: 5′-AGGAGAAAGCCAGCCTGA and 5′-ATGCAGATTTTGTCTTCC; nested set: 5′-CTGGCTGTGGGGACACTC and 5′-ATTGCCCACACACAGCTG), StAR (set: 5′-TGGAGAGGCTCTATGAAGAGC and 5′-GCCACGTAAGTTTGGTCTTAG), COX-2 (first set: 5′-TGTATGTATGAGTGTGGGA and 5′-GGCTTCCCAGCTTTTGTA; nested set: 5′-CTTACCCACTTCAAGGGA and 5′-GCCATAGTCAGCATTGTAAG), IL-1β (first set: 5′-CTGAAAGCTCTCCACCTC and 5′-CGCTTTTCCATCTTCTTCA; nested set: 5′-ACAAGTGGTATTCTCCATG and 5′-TCCACACTCTCCAGCTG), IL-1RI (first set: 5′-CTCCAGGATTCATCAGCA and 5′-GACCCATTCCACTTCCAGTA; nested set: 5′-CTTGTGTGCCCTTATCTG and 5′-TGCTCTTCAGCCACATTC), IL-1RII (first set: 5′-GGAATACAACATCACTAGGA and 5′-TTGTGACTGGATCAAAAATC; heminested set: 5′-CCTGTGATCATTTCTCCC and 5′-TTGTGACTGGATCAAAAATC), IL-1Ra (first set: 5′-GCAAGATGCAAGCCTTCA and 5′-GTCTTCCTGGAAGTAGAA; nested set: 5′-TAACCAGAAGACCTTCTA and 5′-TGTGCAGAGGAACCATCC), and β-actin (set: 5′-GGATGCAGAAGGAGATCA and 5′-CTAGAAGCATTTGCGGTG). Quantitative PCR reactions were conducted using SYBR Green PCR Master Mix, the ABI PRISM 7500 sequence detector System (Applied Biosystems, Foster City, CA), and oligonucleotide primers for COX-2 (5′- CTGGCGCTCAGCCATACAG and 5′- CACTCATACATACACCTCGGT), IL-1β (5′-TCCCCAGCCCTTTTGTTGA and 5′-TAGAACCAAATGTGGCCGTG), and β-actin (5′- TCCCTGGAGAAGAGCTACGA and 5′-AGGAAGGAAGGCTGGAAGAG). Immunoblottings were performed using a rabbit polyclonal anti-COX-2 antiserum (Cayman Chemical, Ann Arbor, MI; 1:250), a rabbit polyclonal anti-human IL-1β antiserum (Cell Signaling Technology Inc., Beverly, MA; 1:500), and a mouse monoclonal anti-actin antibody (Calbiochem, La Jolla, CA; 1:5,000) (7Matzkin M.E. Gonzalez-Calvar S.I. Mayerhofer A. Calandra R.S. Frungieri M.B. Testosterone induction of prostaglandin-endoperoxide synthase 2 expression and prostaglandin F(2alpha) production in hamster Leydig cells.Reproduction. 2009; 138: 163-175Crossref PubMed Scopus (19) Google Scholar). The PGD2 and PGF2α levels in the incubation media from TM3 and THP-1 cells, as well as the concentration of IL-1β in human testes, were assayed using commercially available kits (Cayman Chemical). Cells immunoreactive for CD68, a classic MAC marker, were isolated from human testicular biopsies of infertile men by LMPC. Subsequent semiquantitative PCR analyses revealed the expression of IL-1β, its receptor IL-1RI, and COX-2 (Fig. 1A ). In addition to MACs, we found another cell population from the interstitial compartment strongly stained with the antibody against COX-2 that shows characteristic features of Leydig cells. By LMPC and semiquantitative PCR studies, we demonstrated that these cells express IL-1β, IL-1RI, and StAR, a specific Leydig cell marker (Fig. 1B). Indeed, additional experiments showed immunohistochemical colocalization of COX-2 and 3β-HSD expression in all Leydig cells (data not shown). The lack of amplification of the antagonist receptor Ra and the scavenger receptor IL-1RII (Fig. 1A, B) might be due to methodological limitations of the LMPC/semiquantitative PCR techniques used in our studies, together with a low expression of those genes in the interstitial compartment of the male gonad (8Rozwadowska N. Fiszer D. Jedrzejczak P. Kosicki W. Kurpisz M. Interleukin-1 superfamily genes expression in normal or impaired human spermatogenesis.Genes Immun. 2007; 8: 100-107Crossref PubMed Scopus (22) Google Scholar). Semiquantitative PCR and quantitative PCR assays showed a positive correlation between COX-2 messenger RNA (mRNA) expression and IL-1β mRNA expression in GA and SCO syndrome (r = 0.87 and 0.93 for semiquantitative PCR and quantitative PCR, respectively, P<.05). In addition, the expression of COX-2 protein by immunoblotting and the testicular IL-1β concentration in human testicular biopsies from infertile patients showed a correlation coefficient value of 0.69 (P<.05). We failed to identify IL-1β protein by immunoblotting, probably due to the low testicular IL-1β concentration (range between 100 and 1,000 fg/mg protein) or a low sensitivity of the antibody used. Because of the obvious ethical limitations, we have no access to normal testes. Nevertheless, our previous studies performed in archival paraffin blocks of human testicular biopsies showing normal morphology, failed to detect expression of COX-2 by immunohistochemistry and in addition, a significantly lower amount of testicular MACs expressing IL-1β was detected compared with that found in infertile testes (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar). The lack of differences observed in either COX-2 or IL-1β expression among biopsies revealing GA and SCO syndrome (data not shown) could result from the similar MAC number detected in testes from both pathological groups (GA: 365.75 ± 21.5 MACs/mm2 vs. SCO syndrome: 378.00 ± 97.5 MACs/mm2) together with a potential stimulatory effect of IL-1β on interstitial COX-2 expression. Physiological studies cannot be performed on human testicular biopsies. To our knowledge, there are no human Leydig cell lines available and there are no accessible MACs cell lines derived from human testes. Therefore, non-human TM3 Leydig cells and non-testicular THP-1 MACs that express COX-2, IL-1β, IL-1RI, IL-1RII, and Ra (data not shown) were used to further characterize the interactions between the IL-1β system and COX-2/PGs. After 30 minutes, 3 hours (data not shown), and 6 hours (Fig. 1C) of incubation in the presence of IL-1β (10 and 50 ng/mL; Sigma Chemical), the expression of COX-2 protein and the production of PGD2 and PGF2α were significantly induced in TM3 and THP-1 cells (Fig. 1C). It is important to mention that reports from our group describe the modulation of testicular T production by PGD2 and PGF2α (9Schell C. Frungieri M.B. Albrecht M. Gonzalez-Calvar S.I. Köhn F.M. Calandra R.S. et al.A prostaglandin D2 system in the human testis.Fertil Steril. 2007; 88: 233-236Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 10Frungieri M.B. Gonzalez-Calvar S.I. Parborell F. Albrecht M. Mayerhofer A. Calandra R.S. Cyclooxygenase-2 and prostaglandin F2 alpha in Syrian hamster Leydig cells: inhibitory role on luteinizing hormone/human chorionic gonadotropin-stimulated testosterone production.Endocrinology. 2006; 147: 4476-4485Crossref PubMed Scopus (51) Google Scholar). In addition, the actions of PGs and their receptors have been described in Sertoli cells, germ cells, sperm, and fibroblasts of the wall of the seminiferous tubules (6Frungieri M.B. Weidinger S. Meineke V. Köhn F.M. Mayerhofer A. Proliferative action of mast-cell tryptase is mediated by PAR2, COX2, prostaglandins, and PPARgamma: possible relevance to human fibrotic disorders.Proc Natl Acad Sci U S A. 2002; 99: 15072-15077Crossref PubMed Scopus (215) Google Scholar, 11Cooper D.R. Carpenter M.P. Sertoli-cell prostaglandin synthesis. Effects of (follitropin) differentiation and dietary vitamin E.Biochem J. 1987; 241: 847-855PubMed Google Scholar, 12Moskovitz B. Munichor M. Levin D.R. Effect of diclofenac sodium (Voltaren) and prostaglandin E2 on spermatogenesis in mature dogs.Eur Urol. 1987; 13: 393-396PubMed Google Scholar). Not only IL-1β, but also IL-1α, interacts with the IL-1RI receptor (3Hedger M.P. Meinhardt A. Cytokines and the immune-testicular axis.J Reprod Immunol. 2003; 58: 1-26Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). This cytokine is produced by Sertoli cells (13Gérard N. Syed V. Bardin W. Genetet N. Jégou B. Sertoli cells are the site of interleukin-1α synthesis in rat testis.Mol Cell Endocrinol. 1991; 82: R13-R16Crossref PubMed Scopus (104) Google Scholar), spermatocytes, spermatids (14Haugen T.B. Landmark B.F. Josefsen G.M. Hansson V. Högset A. The mature form of interleukin-1α is constitutively expressed in immature male germ cells from rat.Mol Cell Endocrinol. 1994; 105: R19-R23Crossref PubMed Scopus (64) Google Scholar), and testicular MACs (2Frungieri M.B. Calandra R.S. Lustig L. Meineke V. Köhn F.M. Vogt H.J. et al.Number, distribution pattern, and identification of macrophages in the testes of infertile men.Fertil Steril. 2002; 78: 298-306Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). The expression of COX2 protein in TM3 and THP-1 cells showed a significant increase after 30 minutes of incubation in the presence of IL-1α (10 and 50 ng/mL; PeproTech, Rocky Hill, NJ), without apparent changes at longer incubation times (3 and 6 hours) (data not shown). In conclusion, our current findings show the existence of an IL-1β system in MACs and Leydig cells of the human testis, and provide insights into how this system could participate in the induction of COX-2 expression and PG synthesis and therefore, in the development of local inflammation that might further deteriorate testicular function in patients with GA and SCO syndrome. Nevertheless, whether the testicular network formed by IL-1β, COX-2, and PGs has a biological relevance in the pathogenesis or maintenance of infertility states and therefore, a potential therapeutic value as targets in future strategies designed for the treatment of fertility disorders, remains to be further investigated. Polyclonal rabbit anti-3β-hydroxysteroid dehydrogenase serum was kindly provided by Prof. Dr. J. I, Mason, University of Edinburgh, Scotland.