Portal de Periódicos da CAPES

Ultraviolet A1 Radiation Induces Nitric Oxide Synthase-2 Expression in Human Skin Endothelial Cells in the Absence of Proinflammatory Cytokines

2001; Elsevier BV; Volume: 117; Issue: 5 Linguagem: Inglês

10.1046/j.0022-202x.2001.01502.x

1523-1747

Christoph V. Suschek, V. Kolb‐Bachofen, D. Bruch‐Gerharz, Hartmut Kleinert, Ulrich Förstermann,

Redox biology and oxidative stress

Skin exposure to ultraviolet radiation from sunlight causes erythema and edema formation as well as inflammatory responses. As some of these ultraviolet-induced effects are potentially mediated by nitric oxide synthases, we examined the role of cytokines and ultraviolet A1 radiation (340–400 nm) on the expression of the nitric oxide synthase-2 in endothelia of normal human skin biopsies during short-term organ culture as well as expression and activity of the nitric oxide synthase-2 in in vitro cell cultures of human dermal endothelial cells. Both, cytokine challenge (interleukin-1β + tumor necrosis factor-α + interferon-γ) but also ultraviolet A1 exposure (50 J per cm2) in the absence of cytokines led to the expression of nitric oxide synthase-2 in human skin organ cultures as shown by immunohistochemistry. Moreover, exposing human dermal endothelial cell cultures to proinflammatory cytokines but also to ultraviolet A1 radiation (6–24 J per cm2) in the absence of cytokines resulted in significant nitric oxide synthase-2 mRNA and protein expression as well as enzyme activity. Ultraviolet A1 irradiation of cytokine activated cells led to further increases in nitric oxide synthase-2 mRNA, protein expression, and enzyme activity. Moreover, a reporter gene assay using a human nitric oxide synthase-2 promoter construct provide evidence that ultraviolet A1, in the absence of cytokines, induces nitric oxide synthase-2 expression and activity, as previously shown for cytokines. Thus, the results presented here demonstrate for the first time that in dermal endothelia of human skin ultraviolet A1 radiation alone represents a proinflammatory stimulus sufficient to initiate nitric oxide synthase-2 expression as well as activity comparable with the respective response seen in the presence of proinflammatory cytokines. Skin exposure to ultraviolet radiation from sunlight causes erythema and edema formation as well as inflammatory responses. As some of these ultraviolet-induced effects are potentially mediated by nitric oxide synthases, we examined the role of cytokines and ultraviolet A1 radiation (340–400 nm) on the expression of the nitric oxide synthase-2 in endothelia of normal human skin biopsies during short-term organ culture as well as expression and activity of the nitric oxide synthase-2 in in vitro cell cultures of human dermal endothelial cells. Both, cytokine challenge (interleukin-1β + tumor necrosis factor-α + interferon-γ) but also ultraviolet A1 exposure (50 J per cm2) in the absence of cytokines led to the expression of nitric oxide synthase-2 in human skin organ cultures as shown by immunohistochemistry. Moreover, exposing human dermal endothelial cell cultures to proinflammatory cytokines but also to ultraviolet A1 radiation (6–24 J per cm2) in the absence of cytokines resulted in significant nitric oxide synthase-2 mRNA and protein expression as well as enzyme activity. Ultraviolet A1 irradiation of cytokine activated cells led to further increases in nitric oxide synthase-2 mRNA, protein expression, and enzyme activity. Moreover, a reporter gene assay using a human nitric oxide synthase-2 promoter construct provide evidence that ultraviolet A1, in the absence of cytokines, induces nitric oxide synthase-2 expression and activity, as previously shown for cytokines. Thus, the results presented here demonstrate for the first time that in dermal endothelia of human skin ultraviolet A1 radiation alone represents a proinflammatory stimulus sufficient to initiate nitric oxide synthase-2 expression as well as activity comparable with the respective response seen in the presence of proinflammatory cytokines. ultraviolet radiation A1 Nitric oxide (NO) and equal amounts of citrulline are synthesized from the guanidino nitrogen of L-arginine by nitric oxide synthases (NOS). This enzyme family comprises of two different subfamilies: two constitutively expressed and calcium/calmodulin-dependent isoenzymes, the endothelial NOS-3 and the neuronal NOS-1 and an inducible and calcium-independent isoenzyme (NOS-2). Upon agonist stimulation, the constitutive, calcium-dependent enzymes generally produce short-lasting pulses (seconds to minutes) of NO. In contrast, NOS-2 once expressed following inducing challenges, synthesizes NO for comparatively long periods (days) of time (Förstermann et al., 1994Förstermann U. Closs E.I. Pollock J.S. Nakane M. Schwarz P. Gath I. Kleinert H. Nitric oxide synthase isoenzymes. Characterisation, purification, molecular cloning, and functions.Hypertension. 1994; 23: 1121-1131Crossref PubMed Scopus (962) Google Scholar). During inflammatory processes cytokines are known modulators of endothelial cell functions (Prober and Cotran, 1990Prober J.S. Cotran R.S. Cytokines and endothelial cell biology.Physiol Rev. 1990; 70: 427-451Crossref PubMed Scopus (1099) Google Scholar). One of the prominent effects that cytokines can exert on endothelial cells is the induction of the NOS-2 expression and ensuing high-output NO synthesis (Suschek et al., 1993Suschek C. Rothe H. Fehsel K. Enczmann J. Kolb-Bachofen V. Induction of a macrophage-like nitric oxide synthase in cultured rat aortic endothelial cells.J Immunol. 1993; 151: 3283-3291PubMed Google Scholar,Suschek et al., 1994Suschek C. Fehsel K. Kröncke K.D. Sommer A. Kolb-Bachofen V. Primary cultures of rat capillary endothelial cells: Constitutive and cytokine-inducible macrophage-like nitric oxide synthases are expressed and activities regulated by glucose concentration.Am J Pathol. 1994; 145: 485-695Google Scholar), serving local protection from infectious agents (Liew and Cox, 1991Liew F.Y. Cox F.E.G. Nonspecific defense mechanism: The role of nitric oxide.Immunol Today. 1991; 12: A17-A21Abstract Full Text PDF PubMed Scopus (295) Google Scholar), but also shown to be involved in immune-mediated local tissue destruction, e.g, as in autoimmune diabetes or in septic shock (Kröncke et al., 1998Kröncke K.D. Fehsel K. Kolb-Bachofen V. Inducible nitric oxide synthase in human diseases.Clin Exp Immunol. 1998; 113: 147-158https://doi.org/10.1046/j.1365-2249.1998.00648.xCrossref PubMed Scopus (471) Google Scholar). NOS-2-generated NO has been thought of as a toxic effector molecule usually, but more recently it was shown to act in immunoregulation (Kolb and Kolb-Bachofen, 1998Kolb H. Kolb-Bachofen V. Nitric oxide in autoimmune disease: Cytotoxic or regulatory mediator?.Immunol Today. 1998; 19: 556-561https://doi.org/10.1016/s0167-5699(98)01366-8Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar) and as a protective agent, e.g, against ultraviolet (UV) A1-induced apoptosis (Suschek et al., 1999Suschek C.V. Krischel V. Bruch-Gerharz D. Berendji D. Krutmann J. Kröncke K.D. Kolb-Bachofen V. Nitric oxide fully protects against UVA1-induced apoptosis in tight correlation with Bcl-2 up-regulation.J Biol Chem. 1999; 274: 6130-6137Crossref PubMed Scopus (150) Google Scholar). Prolonged exposure of the human skin to UV radiation can result in adverse effects, including erythema and edema formation, inflammation, premature aging, immune suppression, and skin cancer (Jagger, 1985Jagger J. Solar-UV Action on Living Cells. Praeger, New York1985Google Scholar;Grange, 1987Grange R.W. Acute effects of ultraviolet radiation in the skin.in: Fitzpatrick T.B. Eisen A.Z. Wolff K. Freedberg I.M. Austen K.E. Dermatology in General Medicine. McGraw-Hill, New York1987: 1451-1457Google Scholar). Erythema formation is the result of local increases in blood flow in both the superficial and deep vascular plexus of the dermis (Greaves, 1986Greaves M.W. Ultraviolet erythema: Causes and consequences.Curr Probl Dermatol. 1986; 15: 18-24Crossref PubMed Google Scholar). UV radiation-induced erythema were shown to be significantly reduced by inhibitors of NOS (Goldsmith et al., 1996Goldsmith P.C. Leslie T.A. Hayes N.A. Levell N.J. Dowd P.A. Foreman J.C. Inhibitors of nitric oxide synthase in human skin.J Invest Dermatol. 1996; 106: 113-118Crossref PubMed Scopus (87) Google Scholar) demonstrating a direct or indirect involvement of NO in the regulation of the local UV-induced response of normal human skin (Bruch-Gerharz et al., 1998aBruch-Gerharz D. Ruzicka T. Kolb Bachofen V. Nitric oxide and its implications in skin homeostasis and disease – a review.Arch Dermatol Res. 1998; 290: 643-651Crossref PubMed Scopus (82) Google Scholar). This study examined the effects of UVA1 radiation (340–400 nm) and cytokines on the expression of the NOS-2 in specimens of normal human skin maintained in organ culture as well as expression and activity of the NOS-2 in human dermal endothelial cells (HUDEC). Data presented show that UVA1 radiation can initiate endothelial NOS-2 promoter activity and NOS-2 expression to a degree comparable with proinflammatory cytokine challenge. HUDEC (two separate batches) were purchased from PromoCell (Heidelberg, Germany) and were maintained for up to six passages in endothelial cell basal medium supplemented with 15% fetal bovine serum (FBS) 2 mM L-glutamine, 2 mM L-arginine, 100 µg streptomycin per ml, 100 U penicillin per ml, 250 ng amphotericin B per ml, but without hydrocortisone, epidermal growth factor, and endothelial cell growth supplement. The human cell line A549/8 was from ATCC (American Type Culture Collection, Rockville, MD) and was grown in Dulbecco's modified Eagle's medium/10% FBS. Examining the effects of UVA1 on NOS-2 induction, HUDEC or A549/8 cells were irradiated with nontoxic doses of 3, 6, 12, 18, and 24 J per cm2 UVA1. The appearance of apoptotic cell death could be observed after irradiation with UVA1 at intensities > 28 J per cm2. It is known that during UVA1 irradiation of human skin, only 20–50% of the light penetrate the epidermis and reach the dermal vasculature (Bruls et al., 1984aBruls W.A. Slaper H. van der Leun J.C. Berrens L. Transmission of human epidermis and stratum corneum as a function of thickness in the ultraviolet and visible wavelengths.Photochem Photobiol. 1984; 40: 485-494Crossref PubMed Scopus (390) Google Scholar;Meunier, 1999Meunier L. Ultraviolet light and dendritic cells.Eur J Dermatol. 1999; 9: 269-275PubMed Google Scholar). Thus, we calculated that 50 J per cm2 represent a nontoxic dose of UVA1 radiation sufficient for NOS-2 induction in vessel endothelia in human skin specimens. Examining the effects of cytokines, with skin organ cultures we used a combination of interleukin (IL)-1β, tumor necrosis factor (TNF)-α (1000 U per ml each), and 200 U per ml interferon (IFN)-γ that was found to be effective in NOS-2 induction in primary human keratinocytes (Bruch-Gerharz et al., 1996Bruch-Gerharz D. Fehsel K. Suschek C. Michel G. Ruzicka T. Kolb-Bachofen V. A proinflammatory activity of interleukin-8 in human skin: Expression of the inducible nitric oxide synthase in psoriatic lesions and cultured keratinocytes.J Exp Med. 1996; 184: 2007-2012Crossref PubMed Scopus (155) Google Scholar). With HUDEC, we used a combination of IL-1β, TNF-α, and/or IFN-γ (500 U per ml each) that was previously shown to be effective in rat endothelial cells as well as HUDEC (Suschek et al., 1993Suschek C. Rothe H. Fehsel K. Enczmann J. Kolb-Bachofen V. Induction of a macrophage-like nitric oxide synthase in cultured rat aortic endothelial cells.J Immunol. 1993; 151: 3283-3291PubMed Google Scholar;Hoffmann et al., 1999Hoffmann G. Schobersberger W. Rieder J. et al.Human dermal microvascular endothelial cells express inducible nitric oxide synthase in vitro.J Invest Dermatol. 1999; 112: 387-390https://doi.org/10.1046/j.1523-1747.1999.00505.xCrossref PubMed Scopus (17) Google Scholar). For the sake of comparability, exactly the same cytokines were used with the NOS-2-promoter transfected A549/8 cells. Human skin specimens were derived from mammoplastic surgery (Department of Plastic Surgery, Florence Nightingale Hospital, Düsseldorf, Germany), cut into 4 mm squares and placed in 24-well culture plates with RPMI/20% FBS supplemented with 0.1 mg penicillin per ml, 0.1 mg streptomycin per ml, and 0.25 µg amphotericin B per ml. Skin specimens were incubated for 24 h with cytokines or irradiated with UVA1 (50 J per cm2) and cultured for 24 h. Specimens were then embedded in Tissue-Tek (Reichert-Jung, Vienna, Austria) and snap frozen in liquid nitrogen for immunohistochemical characterization. Experiments with HUDEC, were performed with cells from passages 2 to 6. Endothelial cells (1 × 105) were cultured in 24-well tissue culture plates. Resident or cytokine activated HUDEC were then irradiated with UVA1 at doses indicated. Viability of endothelial cells was routinely controlled at the beginning and end of each experiment by neutral red staining (Finter, 1969Finter N.B. Dye uptake methods of assessing viral cytopathogenicity and their application to interferon assays.J Gen Virol. 1969; 5: 419-425Crossref Google Scholar) and trypan blue exclusion. To generate A549/8 cells stably transfected with a construct containing a 16 kb fragment of the human NOS-2 promoter cloned in front of a luciferase reporter gene cells were transfected by lipofection with DOTAP according to the manufacturer's recommendations using 4.5 mg of pNOS2(16)Luc (de Vera et al., 1996de Vera M.E. Shapiro R.A. Nüssler A.K. et al.Transcriptional regulation of human inducible nitric oxide synthase (NOS2) gene by cytokines: Initial analysis of the human NOS2 promoter.Proc Natl Acad Sci USA. 1996; 93: 1054-1059Crossref PubMed Scopus (352) Google Scholar) and 0.5 mg of pRc-CMV (Invitrogen (Karlsruhe, Germany); containing a neomycin resistance gene). The transfected cells were selected by G 418 treatment (1 mg per ml). Different cell clones were analyzed for luciferase activity and checked for integration of the transfected DNA by polymerase chain reaction (PCR). Resident or cytokine activated (IL-1β, TNF-α, IFN-γ, IL-1β + TNF-α, IL-1β + IFN-γ, TNF-α + IFN-γ or cytokine mix consisting of all three cytokines) A549/8 cells were irradiated with 18 J per cm2 UVA1. Extracts (200 µl) were prepared 12 h later using the luciferase assay lysis buffer. The luciferase activities of the extracts (diluted 1: 50 in lysis buffer) were determined using the Luciferase Assay System and normalized to the number of cells in the respective probes determined immediately prior to lysis by measuring neutral red uptake. Relative NOS-2-promoter activity is given in percent of controls (resident stable transfected A549/8 cells = 100%). Cryostat sections from skin specimens (7 µm) were fixed with 0.2% glutaraldehyde. Blocking of unspecific binding was performed with 0.5% bovine serum albumin in Tris-buffered saline for 30 min. Endothelium was characterized using the anti-von Willebrand factor anti-serum or monoclonal antibodies anti-CD31, anti-CD34, or anti-ecNOS. Additionally, sections from cytokine-activated skin specimens as well as skin specimens irradiated with UVA1 (50 J per cm2) were incubated with a monoclonal antibody anti-NOS-2. As secondary antibodies peroxidase-conjugated goat anti-rabbit or goat anti-mouse IgG were used and visualized after reaction with diaminobenzidine and hydrogen peroxide For immunocytochemistry of HUDEC, these were grown to subconfluency on sterile glass coverslips. Cells were washed with phosphate-buffered saline and fixed with acetone at -20°C for 10 min. Blocking of unspecific binding, endothelial cell characterization, and NOS-2-specific staining was performed as described above. HUDEC confirmed the expected positive phenotype for von Willebrand factor, CD31, CD34, and ecNOS (data not shown). Labeling experiments also showed that the cell cultures consisted of pure endothelial cells, as the respective staining patterns with the endothelial specific markers were found in all cells (data not shown). After 24 h of incubation, nitrite concentrations in culture supernatants was determined using the Griess reaction as modified byWood et al., 1990Wood K.S. Buga G.M. Byrns R.E. Ignarro L.J. Vascular smooth muscle-derived relaxing factor (MDRF) and its close similarity to nitric oxide.Biochem Biophys Res Commun. 1990; 170: 80-87Crossref PubMed Scopus (157) Google Scholar and NaNO2 as standard. Total cellular RNA was prepared from cytokine-stimulated or resident endothelial cells or from UVA1 irradiated resident or cytokine-activated cells and was used for cDNA synthesis with dT16 oligonucleotides as primer. Reverse transcription was carried out at 42°C for 60 min. The cDNA was then used as a template for PCR using oligonucleotides and cycle profiles shown in Table I. Using the NOS-2 primer oligonucleotides, we obtained a 393 bases long NOS-2-specific amplification product. It exhibits a 100% homology to the human cDNA sequence of exons 8–11 as revealed by sequence analysis (data not shown). An aliquot of each reaction was subjected to electrophoresis on 1.8% agarose gels. Bands were visualized by ethidium bromide staining. Densitometric analysis of the amplification products was performed on digital images using the KODAK 1D software (KODAK, Stuttgart, Germany).Table IOligonucleotide sequences and cycle profiles used in reverse transcription–PCRProductSequence (5′→3′)BasesGenBank accession no.Product size (bases)Human NOS-2senseTGCCAGATGGCAGCATCAGA1021–1040L09210393anti-senseTTTCCAGGCCCATTCTCCTGC1394–1413Human GAPDHsenseCAACTACATGGTTTACATGTTCC153–175M17851416anti-senseGGACTGTGGTCATGAGTCCT549–568ProductCycle profilesHuman NOS-240 × (30′′ 90°C, 60′′ 58°C, 60′′ 72°C) + 5′ 72°CHuman GAPDH25 × (30′′ 90°C, 30′′ 60°C, 30′′ 72°C) + 5′ 72°C Open table in a new tab Endothelial cells (7 × 106 each), treated as indicated were then washed, lyzed (Novex, San Diego, CA), scraped from the dishes, transferred to a microcentrifuge tube, boiled for 5 min, subjected to gel electrophoresis (50 µg protein per well) in 10% sodium dodecyl sulfate–polyacrylamide gels, and transferred to nitrocellulose membranes. Incubations of the blots were: 1 h with blocking buffer (2% bovine serum albumin, 5% nonfat milk powder, 0.1% Tween 20 in phosphate-buffered saline buffer), 1 h with a 1: 1000 dilution of the anti-NOS-2 antibody, washed, 1 h with a 1: 2000 dilution of the secondary horseradish peroxidase conjugated rabbit anti-mouse IgG antibody, incubated for 5 min in ECL reagent (Pierce, Rockford, IL), placed into a plastic bag and exposed to an enhanced autoradiographic film. To control for equal loading of total protein in all lanes, blots were also stained with a 1:2000 solution of the mouse anti-α-tubulin antibody and a secondary horseradish peroxidase conjugated goat anti-mouse IgG antibody (diluted 1:2000 prior to use). Recombinant human IL-1β, IFN-γ, and TNF-α were obtained from HBT (Leiden, the Netherlands) and Genzyme (Cambridge, MA), L-glutamine, L-arginine, streptomycin, penicillin, amphotericin B, Neutral Red (3% solution), type I collagen, collagenase (from Clostridium histolyticum), and rabbit anti-human von Willebrand factor anti-serum, and monoclonal antibody anti-α-tubulin from Sigma (Deisenhofen, Germany), the monoclonal antibodies anti-CD31 and anti-CD34 from Dako (Glostrup, Denmark), the monoclonal antibodies anti-NOS-2 and anti-ecNOS from Transduction Laboratories (Lexington, KT), peroxidase-conjugated porcine anti-rabbit IgG from DAKO (Hamburg, Germany), and peroxidase-conjugated goat anti-mouse IgG from Zymed Laboratories (San Francisco, CA), trypsin, ethylenediamine tetraacetic acid, FBS (endotoxin free), RPMI-1640 (endotoxin free), Dulbecco's modified Eagle's medium, the oligo dT16 primer, Geneticin G 418, DOTAP, Luciferase Assay System, and Taq-polymerase from Boehringer Mannheim (Mannheim, Germany) or Gibco Laboratories (Eggenstein, Germany), 3,3′-diaminobenzidine from Serva GmbH (Heidelberg, Germany), medium and supplements for HUDEC cultures from Promo Cell GmbH. The UVA1 source (4000 W lamp emitting the UVA1 spectrum from 340 to 400 nm) as well as the dosimeter was purchased from Sellas Medizinische Geräte (Gevelsberg, Germany). The NOS-2 inhibitor L-N5-(1-Iminoethyl)-ornithin was a kind gift from Boehringer Mannheim. LPS concentrations of RPMI 1640/FBS plus cytokines were below 0.1 ng per ml. Data are given as the arithmetical mean ± SD. Significances were calculated using Student's t test (two-tailed for independent samples). In organ cultures of normal human skin specimens aliquots were either incubated with proinflammatory cytokines as indicated for 24 h or exposed to UVA1 radiation (50 J per cm2) and then cultured for 24 h without any additions. Samples were snap frozen and cryostat sections were stained for NOS-2 protein expression. As shown in Figure 1, cytokine challenge rendered the vessel-lining dermal endothelia strongly positive for NOS-2 protein. Vessel endothelia of UVA1-irradiated skin specimens also exhibited the same positive signals, whereas sham-treated resident and nonirradiated controls were essentially negative. Next, we examined whether UVA1 irradiation in vitro would lead to NOS-2 expression in HUDEC cultures. Resident cells were irradiated with UVA1 at intensities indicated and after an additional culture period of 24 h NOS-2 mRNA and protein expression was determined by reverse transcription–PCR, immunocyto chemistry, or western blot technique, respectively. As shown in Figure 2, UVA1 irradiation (3–24 J per cm2) at and above 6 J per cm2 led to the induction of NOS-2 mRNA and NOS-2 protein expression. As a positive control, cytokine incubation of HUDEC (IL-1β + TNF-α + IFN-γ, 500 U per ml each) led to NOS-2 mRNA and NOS-2 protein expression as reported previously (Hoffmann et al., 1999Hoffmann G. Schobersberger W. Rieder J. et al.Human dermal microvascular endothelial cells express inducible nitric oxide synthase in vitro.J Invest Dermatol. 1999; 112: 387-390https://doi.org/10.1046/j.1523-1747.1999.00505.xCrossref PubMed Scopus (17) Google Scholar). Combination of UVA1 irradiation with subsequent cytokine challenge (Figure 3 and Table II) resulted in strongly augmented increases of NOS-2 mRNA (2-fold), protein (2.5-fold), and nitrite levels in culture supernatants (1.9- or 1.5-fold) as compared with cultures that were irradiated only or cytokine challenged only.Table IINitrite formation in culture supernatants of HUDEC after UVA1 and/or cytokine challengeHUDEC nitrite (nM)HUDEC + L-NIO nitrite (nM)Resident370 ± 100180 ± 130UVA1700 ± 110ap < 0.001 as compared with resident cells.110 ± 100cp < 0.001 as compared with the respective cultures in the absence of L-NIO.IL-1β + TNF-α880 ± 140ap < 0.001 as compared with resident cells.140 ± 110cp < 0.001 as compared with the respective cultures in the absence of L-NIO.IL-1β + TNF-α + UVA11300 ± 210bp < 0.001 as compared with UVA1-irradiated or cytokine-activated cells.70 ± 120cp < 0.001 as compared with the respective cultures in the absence of L-NIO.Resident or cytokine-activated (500 U IL-1β per ml + 500 U TNF-α per ml) HUDEC (1 × 105) cultured in 24-well tissue culture plates in the presence or absence of the NOS-inhibitor N5-iminoethyl-L-ornithine (L-NIO, 0.25 mM) were irradiated with UVA1 (18 J per cm2).After 24 h of incubation nitrite a stable reaction product of NO was measured in culture supernatants using the Griess reaction. Values represent the mean ± SEM of three to six individual experiment.a p < 0.001 as compared with resident cells.b p < 0.001 as compared with UVA1-irradiated or cytokine-activated cells.c p < 0.001 as compared with the respective cultures in the absence of L-NIO. Open table in a new tab Resident or cytokine-activated (500 U IL-1β per ml + 500 U TNF-α per ml) HUDEC (1 × 105) cultured in 24-well tissue culture plates in the presence or absence of the NOS-inhibitor N5-iminoethyl-L-ornithine (L-NIO, 0.25 mM) were irradiated with UVA1 (18 J per cm2).After 24 h of incubation nitrite a stable reaction product of NO was measured in culture supernatants using the Griess reaction. Values represent the mean ± SEM of three to six individual experiment. The results described above may implicate a direct NOS-2 induction by UVA1 radiation in the absence of cytokines. We therefore tested the effects of UVA1 (18 J per cm2) on the NOS-2 promoter activity using the human A549/8 cell line stably transfected with a human NOS-2 promoter luciferase reporter gene construct Figure 4. UVA1 irradiation of cells in the absence of cytokines, increased NOS-2 promoter activity by a factor of 2. Incubation with any combination of two cytokines (500 U per ml each) led to identical increases in luciferase activity, whereas incubation with single cytokines (500 U per ml each) had no effects. A combination of UVA1 plus any of the single cytokines did not increase the response seen with UVA1 alone. In contrast, UVA1 irradiation in combination with the presence of two cytokines strongly augmented NOS-2 promoter activity by a factor of approximately 5 when compared with sham treatment or by a factor of 2.5 when compared with UVA1 alone, or two cytokines alone. Maximal NOS-2 promoter activity was achieved after incubation with three cytokines and here UVA1 irradiation did not lead to further increases in luciferase activity. Thus, UVA1 radiation will initiate NOS-2 promoter activity in the absence of exogenous cytokines and may maximize cytokine-induced NOS-2 promoter activity. With the results in this study we show that the induction of NOS-2 expression represents a local response of dermal cells to UVA1 irradiation in the absence of any additional exogenous proinflammatory stimuli. It had been shown previously that UVA1 will penetrate the epidermis reaching the dermal vasculature (Bruls et al., 1984bBruls W.A. van Weelden H. van der Leun J.C. Transmission of UV-radiation through human epidermal layers as a factor influencing the minimal erythema dose.Photochem Photobiol. 1984; 39: 63-67Crossref PubMed Scopus (69) Google Scholar;Meunier, 1999Meunier L. Ultraviolet light and dendritic cells.Eur J Dermatol. 1999; 9: 269-275PubMed Google Scholar). Thus, NOS-2 expression in skin endothelia is likely to represent a relevant event contributing to erythema formation after sunlight exposure or UVA1 irradiation (Goldsmith et al., 1996Goldsmith P.C. Leslie T.A. Hayes N.A. Levell N.J. Dowd P.A. Foreman J.C. Inhibitors of nitric oxide synthase in human skin.J Invest Dermatol. 1996; 106: 113-118Crossref PubMed Scopus (87) Google Scholar). Additionally, we show that proinflammatory cytokines will induce dermal endothelial NOS-2 expression in situ in human skin specimens. The data presented here, especially those obtained with reporter gene assays all prove a direct induction of NOS-2 gene expression by UVA1 irradiation at levels comparable with a mixture of proinflammatory cytokines. Previous studies on UVA1-induced modulation of gene expression, performed with fibroblasts or keratinocytes, had demonstrated a dominant involvement of the transcription factors NF-κB (Vile et al., 1995Vile G.F. Tanew Ilitschew A. Tyrrell R.M. Activation of NF-kappa B in human skin fibroblasts by the oxidative stress generated by UVA1 radiation.Photochem Photobiol. 1995; 62: 463-468Crossref PubMed Scopus (131) Google Scholar), AP-1 (Soriani et al., 2000Soriani M. Hejmadi V. Tyrrell R.M. Modulation of c-jun and c-fos transcription by UVB and UVA1 radiations in human dermal fibroblasts and KB cells.Photochem Photobiol. 2000; 71: 551-558Crossref PubMed Scopus (31) Google Scholar), and AP-2 (Grether-Beck et al., 1997Grether-Beck S. Buettner R. Krutmann J. Ultraviolet A. radiation-induced expression of human genes: molecular and photobiological mechanisms.Biol Chem. 1997; 378: 1231-1236PubMed Google Scholar). Unfortunately, to date, nothing is known about the effects of UVA1 radiation on the activation of NOS-2-relevant transcription factors. Although AP-2 binding sites are present on the NOS-2 promoter, 5′-deletion and mutation analysis gave no evidence for a role in NOS-2-activity regulation. On the other hand, mutation analysis of the NOS-2 promoter construct also used in this study, clearly demonstrated several NF-κB binding sites far upstream and confirmed that inducibility requires NF-κB binding sites upstream of -4.7 kb (de Vera et al., 1996de Vera M.E. Shapiro R.A. Nüssler A.K. et al.Transcriptional regulation of human inducible nitric oxide synthase (NOS2) gene by cytokines: Initial analysis of the human NOS2 promoter.Proc Natl Acad Sci USA. 1996; 93: 1054-1059Crossref PubMed Scopus (352) Google Scholar;Nunokawa et al., 1996Nunokawa Y. Oikawa S. Tanaka S. Human inducible nitric oxide synthase gene is transcriptionally regulated by nuclear factor-κB dependent mechanism.Biochem Biophys Res Commun. 1996; 223: 347-352https://doi.org/10.1006/bbrc.1996.0897Crossref PubMed Scopus (79) Google Scholar;Taylor et al., 1998Taylor B.S. de Vera M.E. Ganster R.W. et al.Multiple NF-κB enhancer elements regulate cytokine induction of the human inducible nitric oxide synthase gene.J Biol Chem. 1998; 273: 15148-15156Crossref PubMed Scopus (361) Google Scholar). Intracellular production of reactive oxygen intermediates as a result of UVA1 exposure is a generally accepted pathway (McCormick et al., 1976McCormick J.P. Fisher J.R. Pachlatko J.P. Eisenstark A. Characterization of a cell-lethal tryptophan photooxidation product: Hydrogen peroxide.Science. 1976; 191: 468-469Crossref PubMed Scopus (148) Google Scholar;Cunningham et al., 1985Cunningham M.L. Johnson J.S. Giovanazzi S.M. Peak M.J. Photosensitized production of superoxide anion by monochromatic (290–405 nm) ultraviolet irradiation of NADH and NADPH coenzymes.Photochem Photobiol. 1985; 42: 125-128Crossref PubMed Scopus (126) Google Scholar;Tyrrell and Pidoux, 1989Tyrrell R.M. Pidoux M. Singlet oxygen involvement in the inactivation of cultured human fibroblasts by UVA1 (334 nm, 365 nm) and near-visible (405 nm) radiation.Photochem Photobiol. 1989; 49: 407-412Crossref PubMed Scopus (149) Google Scholar) and NOS-2 expression is sensitive to the cellular redox state (Adcock et al., 1995Adcock I.M. Brown C.R. Kwon O. Barnes P.J. Oxidative stress induces NFκB DNA binding and inducible NOS mRNA in human epithelial cells.Biochem Biophys Res Commun. 1995; 199: 1518-1524https://doi.org/10.1006/bbrc.1994.1403Crossref Scopus (244) Google Scholar). Thus, UVA1-induced oxidative stress and subsequent activation of NF-κB (Forman and Cadenas, 1997Forman H.J. Cadenas E. Oxidative Stress and Signal Transduction. Chapman & Hall, New York1997Crossref Google Scholar), may represent the inducing event for NOS-2 expression (Murphy, 1999Murphy W.J. Transcriptional regulation of the genes encoding nitric oxide synthase.in: Laskin J.D. Laskin D.L. Cellular and Molecular Biology of Nitric Oxide. Marcel Dekker, New York1999: 1-56Google Scholar); however, our findings of UVA1-mediated increases in cytokine-induced NOS-2 expression or activity are not fully compatible with NF-κB activation as the sole UVA1-induced events, because the cytokine mixture also uses NF-κB activation among others. Reactive oxygen species-mediated c-Jun/c-Fos (AP-1) activation (Torres and Forman, 2000Torres M. Forman H.J. Nitric oxide, oxidative stress, and signal transduction.in: Ignarro L.J. Nitric Oxide: Biology and Pathobiology. Academic Press, San Diego2000: 329-342Crossref Google Scholar), was recently shown to enhance NOS-2 expression and activity strongly (Marks-Konczalik et al., 1998Marks-Konczalik J. Chu S.C. Moss J. Cytokine-mediated transcriptional induction of the human inducible nitric oxide synthase gene requires both activator protein 1 and nuclear factor κB-binding sites.J Biol Chem. 1998; 273: 22201-22208Crossref PubMed Scopus (283) Google Scholar), and thus AP-1 may represent a candidate of UVA1/reactive oxygen species-sensitive transcription factors. The involvement of AP-1 in NOS-2 induction, however, remains controversial and a suppressive activity for the NOS-2 promoter has also been reported (Kleinert et al., 1998Kleinert H. Wallerath T. Fritz G. Ihrig-Biedert I. Rodriguez-Pascual F. Geller D.A. Förstermann U. Cytokine induction of NO synthase II in human DLD-1 cells: Roles of JAK-STAT, AP-1 and NF-κB-signaling pathways.Br J Pharmacol. 1998; 125: 193-201Crossref PubMed Scopus (123) Google Scholar). In conclusion, the data in this study demonstrated that UVA1 radiation can initiate endothelial NOS-2 expression in the endothelia of human skin or in cultures of microvascular HUDEC, a response that is comparable with the expression achieved by proinflammatory cytokines. NOS-2 expression occurs in keratinocytes of psoriatic skin (Kolb-Bachofen et al., 1994Kolb-Bachofen V. Fehsel K. Michel G. Ruzicka T. Epidermal keratinocyte expression of inducible nitric oxide synthase in skin lesions of psoriasis vulgaris.Lancet. 1994; 344: 139Abstract PubMed Scopus (75) Google Scholar;Bruch-Gerharz et al., 1996Bruch-Gerharz D. Fehsel K. Suschek C. Michel G. Ruzicka T. Kolb-Bachofen V. A proinflammatory activity of interleukin-8 in human skin: Expression of the inducible nitric oxide synthase in psoriatic lesions and cultured keratinocytes.J Exp Med. 1996; 184: 2007-2012Crossref PubMed Scopus (155) Google Scholar) and in the skin vasculature of patients with atopic dermatitis, and allergic contact dermatitis (Rowe et al., 1997Rowe A. Farrell A.M. Bunker C.B. Constitutive endothelial and inducible nitric oxide synthase in inflammatory dermatoses.Br J Dermatol. 1997; 136: 18-23Crossref PubMed Scopus (94) Google Scholar). Thus, this response may represent a key signal in regulating local dermal functions during inflammation after various environmental challenges (Bruch-Gerharz et al., 1998aBruch-Gerharz D. Ruzicka T. Kolb Bachofen V. Nitric oxide and its implications in skin homeostasis and disease – a review.Arch Dermatol Res. 1998; 290: 643-651Crossref PubMed Scopus (82) Google Scholar). We thank Christa-Maria Wilkens-Roth, Ulla Lammersen, and Marija Lenzen for technical assistance, and Martha Turken for photographic assistance. This study was supported by a grant from the Deutsche Forschungsgemeinschaft, SFB 503A3, to V.K.-B.