Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Annexin A2 Is a C-terminal PCSK9-binding Protein That Regulates Endogenous Low Density Lipoprotein Receptor Levels

2008; Elsevier BV; Volume: 283; Issue: 46 Linguagem: Inglês

10.1074/jbc.m805971200

ISSN

1083-351X

Autores

Gaétan Mayer, Steve Poirier, Nabil G. Seidah,

Tópico(s)

Computational Drug Discovery Methods

Resumo

The proprotein convertase subtilisin/kexin-type 9 (PCSK9), which promotes degradation of the hepatic low density lipoprotein receptor (LDLR), is now recognized as a major player in plasma cholesterol metabolism. Several gain-of-function mutations in PCSK9 cause hypercholesterolemia and premature atherosclerosis, and thus, inhibition of PCSK9-induced degradation of the LDLR may be used to treat this deadly disease. Herein, we discovered an endogenous PCSK9 binding partner by Far Western blotting, co-immunoprecipitation, and pull-down assays. Following two-dimensional gel electrophoresis and mass spectrometry analysis, we demonstrated that PCSK9 binds to a ∼33-kDa protein identified as annexin A2 (AnxA2) but not to the closely related annexin A1. Furthermore, our functional LDLR assays and small hairpin RNA studies show that AnxA2 and the AnxA2·p11 complex could prevent PCSK9-directed LDLR degradation in HuH7, HepG2, and Chinese hamster ovary cells. Immunocytochemistry revealed that PCSK9 and AnxA2 co-localize at the cell surface, indicating a possible competition with the LDLR. Structure-function analyses demonstrated that the C-terminal cysteine-histidine-rich domain of PCSK9 interacts specifically with the N-terminal repeat R1 of AnxA2. Mutational analysis of this 70-amino acid-long repeat indicated that the RRTKK81 sequence of AnxA2 is implicated in this binding because its mutation to AATAA81 prevents its interaction with PCSK9. To our knowledge, this work constitutes the first to show that PCSK9 activity on LDLR can be regulated by an endogenous inhibitor. The identification of the minimal inhibitory sequence of AnxA2 should pave the way toward the development of PCSK9 inhibitory lead molecules for the treatment of hypercholesterolemia. The proprotein convertase subtilisin/kexin-type 9 (PCSK9), which promotes degradation of the hepatic low density lipoprotein receptor (LDLR), is now recognized as a major player in plasma cholesterol metabolism. Several gain-of-function mutations in PCSK9 cause hypercholesterolemia and premature atherosclerosis, and thus, inhibition of PCSK9-induced degradation of the LDLR may be used to treat this deadly disease. Herein, we discovered an endogenous PCSK9 binding partner by Far Western blotting, co-immunoprecipitation, and pull-down assays. Following two-dimensional gel electrophoresis and mass spectrometry analysis, we demonstrated that PCSK9 binds to a ∼33-kDa protein identified as annexin A2 (AnxA2) but not to the closely related annexin A1. Furthermore, our functional LDLR assays and small hairpin RNA studies show that AnxA2 and the AnxA2·p11 complex could prevent PCSK9-directed LDLR degradation in HuH7, HepG2, and Chinese hamster ovary cells. Immunocytochemistry revealed that PCSK9 and AnxA2 co-localize at the cell surface, indicating a possible competition with the LDLR. Structure-function analyses demonstrated that the C-terminal cysteine-histidine-rich domain of PCSK9 interacts specifically with the N-terminal repeat R1 of AnxA2. Mutational analysis of this 70-amino acid-long repeat indicated that the RRTKK81 sequence of AnxA2 is implicated in this binding because its mutation to AATAA81 prevents its interaction with PCSK9. To our knowledge, this work constitutes the first to show that PCSK9 activity on LDLR can be regulated by an endogenous inhibitor. The identification of the minimal inhibitory sequence of AnxA2 should pave the way toward the development of PCSK9 inhibitory lead molecules for the treatment of hypercholesterolemia. The proprotein convertase subtilisin kexin-like 9 (PCSK9) 4The abbreviations used are: PCSK9, proprotein convertase subtilisin kexin-like 9; aa, amino acid(s); mAb, monoclonal antibody; AnxA2; annexin A2; AnxA1, annexin A1; CHRD, cysteine-histidine-rich domain; PC, proprotein convertase; LDLR, low density lipoprotein receptor; VLDLR, very low density lipoprotein receptor; shRNA, small hairpin RNA; CHO, Chinese hamster ovary; EGFP, enhanced green fluorescent protein; HA, hemagglutinin; HRP, horseradish peroxidase; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; IPG, immobilized pH gradient; MS/MS, tandem mass spectrometry; PBS, phosphate-buffered saline. is the ninth member of a family of secretory serine proteinases known as the proprotein convertases (PCs) (1Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 928-933Crossref PubMed Scopus (934) Google Scholar, 2Seidah N.G. Mayer G. Zaid A. Rousselet E. Nassoury N. Poirier S. Essalmani R. Prat A. Int. J. Biochem. Cell Biol. 2008; 40: 1111-1125Crossref PubMed Scopus (280) Google Scholar). It is now recognized as a major candidate gene for the development of pharmacologically relevant inhibitors or silencers, because it induces an enhanced cellular degradation of the low density lipoprotein receptor (LDLR) in endosomes-lysosomes (3Benjannet S. Rhainds D. Essalmani R. Mayne J. Wickham L. Jin W. Asselin M.C. Hamelin J. Varret M. Allard D. Trillard M. Abifadel M. Tebon A. Attie A.D. Rader D.J. Boileau C. Brissette L. Chretien M. Prat A. Seidah N.G. J. Biol. Chem. 2004; 279: 48865-48875Abstract Full Text Full Text PDF PubMed Scopus (516) Google Scholar, 4Maxwell K.N. Breslow J.L. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 7100-7105Crossref PubMed Scopus (514) Google Scholar). An increased activity of PCSK9 would thus result in an up-regulation of the level of circulating LDL cholesterol, one of the major causes leading to atherosclerosis and coronary heart disease (5Cohen J.C. Boerwinkle E. Mosley Jr., T.H. Hobbs H.H. N. Engl. J. Med. 2006; 354: 1264-1272Crossref PubMed Scopus (2466) Google Scholar, 6Rader D.J. Daugherty A. Nature. 2008; 451: 904-913Crossref PubMed Scopus (396) Google Scholar). Indeed, the PCSK9 gene represents the third chromosomal locus of dominant familial hypercholesterolemia (7Abifadel M. Varret M. Rabes J.P. Allard D. Ouguerram K. Devillers M. Cruaud C. Benjannet S. Wickham L. Erlich D. Derre A. Villeger L. Farnier M. Beucler I. Bruckert E. Chambaz J. Chanu B. Lecerf J.M. Luc G. Moulin P. Weissenbach J. Prat A. Krempf M. Junien C. Seidah N.G. Boileau C. Nat. Genet. 2003; 34: 154-156Crossref PubMed Scopus (2222) Google Scholar), as was recently reconfirmed in two genome wide screens (8Kathiresan S. Melander O. Guiducci C. Surti A. Burtt N.P. Rieder M.J. Cooper G.M. Roos C. Voight B.F. Havulinna A.S. Wahlstrand B. Hedner T. Corella D. Tai E.S. Ordovas J.M. Berglund G. Vartiainen E. Jousilahti P. Hedblad B. Taskinen M.R. Newton-Cheh C. Salomaa V. Peltonen L. Groop L. Altshuler D.M. Orho-Melander M. Nat. Genet. 2008; 40: 189-197Crossref PubMed Scopus (1142) Google Scholar, 9Willer C.J. Sanna S. Jackson A.U. Scuteri A. Bonnycastle L.L. Clarke R. Heath S.C. Timpson N.J. Najjar S.S. Stringham H.M. Strait J. Duren W.L. Maschio A. Busonero F. Mulas A. Albai G. Swift A.J. Morken M.A. Narisu N. Bennett D. Parish S. Shen H. Galan P. Meneton P. Hercberg S. Zelenika D. Chen W.M. Li Y. Scott L.J. Scheet P.A. Sundvall J. Watanabe R.M. Nagaraja R. Ebrahim S. Lawlor D.A. Ben Shlomo Y. Davey-Smith G. Shuldiner A.R. Collins R. Bergman R.N. Uda M. Tuomilehto J. Cao A. Collins F.S. Lakatta E. Lathrop G.M. Boehnke M. Schlessinger D. Mohlke K.L. Abecasis G.R. Nat. Genet. 2008; 40: 161-169Crossref PubMed Scopus (1330) Google Scholar) and a liver-specific screen (10Schadt E.E. Molony C. Chudin E. Hao K. Yang X. Lum P.Y. Kasarskis A. Zhang B. Wang S. Suver C. Zhu J. Millstein J. Sieberts S. Lamb J. Guhathakurta D. Derry J. Storey J.D. Avila-Campillo I. Kruger M.J. Johnson J.M. Rohl C.A. van Nas A. Mehrabian M. Drake T.A. Lusis A.J. Smith R.C. Guengerich F.P. Strom S.C. Schuetz E. Rushmore T.H. Ulrich R. PLoS. Biol. 2008; 6: e107Crossref PubMed Scopus (787) Google Scholar). Both gain and loss of function mutations have been reported for PCSK9 resulting in hyper- and hypocholesterolemia, respectively (11Seidah N.G. Prat A. J. Mol. Med. 2007; 85: 685-696Crossref PubMed Scopus (136) Google Scholar). PCSK9 transgenic and knock-out mice recapitulated these phenotypes (12Rashid S. Curtis D.E. Garuti R. Anderson N.N. Bashmakov Y. Ho Y.K. Hammer R.E. Moon Y.A. Horton J.D. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 5374-5379Crossref PubMed Scopus (566) Google Scholar, 13Zaid A. Roubtsova A. Essalmani R. Marcinkiewicz J. Chamberland A. Hamelin J. Tremblay M. Jacques H. Jin W. Davignon J. Seidah N.G. Prat A. Hepatology. 2008; 48: 646-654Crossref PubMed Scopus (326) Google Scholar). Following autocatalytic cleavage, PCSK9 exits the endoplasmic reticulum complexed with its prosegment and is efficiently secreted (1Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 928-933Crossref PubMed Scopus (934) Google Scholar). This secreted form can be internalized into endosomes via cell surface binding in an LDLR-dependent manner (14Nassoury N. Blasiole D.A. Tebon O.A. Benjannet S. Hamelin J. Poupon V. McPherson P.S. Attie A.D. Prat A. Seidah N.G. Traffic. 2007; 8: 718-732Crossref PubMed Scopus (205) Google Scholar) and is able to degrade the cell surface LDLR (15Cameron J. Holla O.L. Ranheim T. Kulseth M.A. Berge K.E. Leren T.P. Hum. Mol. Genet. 2006; 15: 1551-1558Crossref PubMed Scopus (226) Google Scholar). Alternatively, PCSK9 may enter endosomes directly from the Golgi (16Park S.W. Moon Y.A. Horton J.D. J. Biol. Chem. 2004; 279: 50630-50638Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar, 17Maxwell K.N. Fisher E.A. Breslow J.L. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 2069-2074Crossref PubMed Scopus (316) Google Scholar). PCSK9 co-localizes with LDLR in early and late endosomes (14Nassoury N. Blasiole D.A. Tebon O.A. Benjannet S. Hamelin J. Poupon V. McPherson P.S. Attie A.D. Prat A. Seidah N.G. Traffic. 2007; 8: 718-732Crossref PubMed Scopus (205) Google Scholar). It was also demonstrated that the C-terminal Cys-His-rich domain (CHRD) and the prosegment of PCSK9 are critical for the co-localization of PCSK9 and the LDLR (14Nassoury N. Blasiole D.A. Tebon O.A. Benjannet S. Hamelin J. Poupon V. McPherson P.S. Attie A.D. Prat A. Seidah N.G. Traffic. 2007; 8: 718-732Crossref PubMed Scopus (205) Google Scholar). The zymogen proPCSK9 is autocatalytically converted into an inactive prosegment·PCSK9 complex in the endoplasmic reticulum (1Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 928-933Crossref PubMed Scopus (934) Google Scholar, 3Benjannet S. Rhainds D. Essalmani R. Mayne J. Wickham L. Jin W. Asselin M.C. Hamelin J. Varret M. Allard D. Trillard M. Abifadel M. Tebon A. Attie A.D. Rader D.J. Boileau C. Brissette L. Chretien M. Prat A. Seidah N.G. J. Biol. Chem. 2004; 279: 48865-48875Abstract Full Text Full Text PDF PubMed Scopus (516) Google Scholar), and so far the only PCSK9 substrate known is itself. PCSK9 is the sole PC that is secreted as a catalytically inhibited prosegment·PC complex (1Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 928-933Crossref PubMed Scopus (934) Google Scholar, 3Benjannet S. Rhainds D. Essalmani R. Mayne J. Wickham L. Jin W. Asselin M.C. Hamelin J. Varret M. Allard D. Trillard M. Abifadel M. Tebon A. Attie A.D. Rader D.J. Boileau C. Brissette L. Chretien M. Prat A. Seidah N.G. J. Biol. Chem. 2004; 279: 48865-48875Abstract Full Text Full Text PDF PubMed Scopus (516) Google Scholar, 18McNutt M.C. Lagace T.A. Horton J.D. J. Biol. Chem. 2007; 282: 20799-20803Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). Accordingly, the enhanced degradation of the LDLR (3Benjannet S. Rhainds D. Essalmani R. Mayne J. Wickham L. Jin W. Asselin M.C. Hamelin J. Varret M. Allard D. Trillard M. Abifadel M. Tebon A. Attie A.D. Rader D.J. Boileau C. Brissette L. Chretien M. Prat A. Seidah N.G. J. Biol. Chem. 2004; 279: 48865-48875Abstract Full Text Full Text PDF PubMed Scopus (516) Google Scholar, 4Maxwell K.N. Breslow J.L. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 7100-7105Crossref PubMed Scopus (514) Google Scholar, 16Park S.W. Moon Y.A. Horton J.D. J. Biol. Chem. 2004; 279: 50630-50638Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar), very low density lipoprotein receptor (VLDLR), and ApoER2 (19Poirier S. Mayer G. Benjannet S. Bergeron E. Marcinkiewicz J. Nassoury N. Mayer H. Nimpf J. Prat A. Seidah N.G. J. Biol. Chem. 2008; 283: 2363-2372Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar) in endosomes/lysosomes (14Nassoury N. Blasiole D.A. Tebon O.A. Benjannet S. Hamelin J. Poupon V. McPherson P.S. Attie A.D. Prat A. Seidah N.G. Traffic. 2007; 8: 718-732Crossref PubMed Scopus (205) Google Scholar) induced by PCSK9 does not seem to require its catalytic activity (18McNutt M.C. Lagace T.A. Horton J.D. J. Biol. Chem. 2007; 282: 20799-20803Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 20Li J. Tumanut C. Gavigan J.A. Huang W.J. Hampton E.N. Tumanut R. Suen K.F. Trauger J.W. Spraggon G. Lesley S.A. Liau G. Yowe D. Harris J.L. Biochem. J. 2007; 406: 203-207Crossref PubMed Scopus (50) Google Scholar). This intriguing twist in the function of this convertase is supported by the crystal structure of PCSK9, which revealed an extended tight binding complex of the enzyme and its inhibitory prosegment (21Cunningham D. Danley D.E. Geoghegan K.F. Griffor M.C. Hawkins J.L. Subashi T.A. Varghese A.H. Ammirati M.J. Culp J.S. Hoth L.R. Mansour M.N. McGrath K.M. Seddon A.P. Shenolikar S. Stutzman-Engwall K.J. Warren L.C. Xia D. Qiu X. Nat. Struct. Mol. Biol. 2007; 14: 413-419Crossref PubMed Scopus (366) Google Scholar). This complex binds the epidermal growth factor-like domain A of the LDLR (22Zhang D.W. Lagace T.A. Garuti R. Zhao Z. McDonald M. Horton J.D. Cohen J.C. Hobbs H.H. J. Biol. Chem. 2007; 282: 18602-18612Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar, 23Kwon H.J. Lagace T.A. McNutt M.C. Horton J.D. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 1820-1825Crossref PubMed Scopus (319) Google Scholar), with increasing strength at acidic pHs similar to those of endosomes/lysosomes (21Cunningham D. Danley D.E. Geoghegan K.F. Griffor M.C. Hawkins J.L. Subashi T.A. Varghese A.H. Ammirati M.J. Culp J.S. Hoth L.R. Mansour M.N. McGrath K.M. Seddon A.P. Shenolikar S. Stutzman-Engwall K.J. Warren L.C. Xia D. Qiu X. Nat. Struct. Mol. Biol. 2007; 14: 413-419Crossref PubMed Scopus (366) Google Scholar), leading to its degradation by resident hydrolases. The wide interest in developing a specific PCSK9 inhibitor/silencer led to the proposal of multiple approaches. One of these depends on the identification of inhibitors/modulators of the PCSK9-LDLR interaction (23Kwon H.J. Lagace T.A. McNutt M.C. Horton J.D. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 1820-1825Crossref PubMed Scopus (319) Google Scholar). However, focusing only on the site of the PCSK9-LDLR interaction may be too restrictive. Indeed, natural point mutations of PCSK9 in remote domains also result in either hyper- or hypo-cholesterolemia (11Seidah N.G. Prat A. J. Mol. Med. 2007; 85: 685-696Crossref PubMed Scopus (136) Google Scholar), even though they are not implicated in the direct interaction of the catalytic domain with the LDLR/epidermal growth factor-like domain A (23Kwon H.J. Lagace T.A. McNutt M.C. Horton J.D. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 2008; 105: 1820-1825Crossref PubMed Scopus (319) Google Scholar). These include the hypercholesterolemic mutants S127R (prosegment) and H553R (CHRD) as well as the hypocholesterolemic variants R46L (prosegment) and Q554E (CHRD), resulting in gain or loss of function of PCSK9, respectively (7Abifadel M. Varret M. Rabes J.P. Allard D. Ouguerram K. Devillers M. Cruaud C. Benjannet S. Wickham L. Erlich D. Derre A. Villeger L. Farnier M. Beucler I. Bruckert E. Chambaz J. Chanu B. Lecerf J.M. Luc G. Moulin P. Weissenbach J. Prat A. Krempf M. Junien C. Seidah N.G. Boileau C. Nat. Genet. 2003; 34: 154-156Crossref PubMed Scopus (2222) Google Scholar, 11Seidah N.G. Prat A. J. Mol. Med. 2007; 85: 685-696Crossref PubMed Scopus (136) Google Scholar, 24Hampton E.N. Knuth M.W. Li J. Harris J.L. Lesley S.A. Spraggon G. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 14604-14609Crossref PubMed Scopus (115) Google Scholar, 25Kotowski I.K. Pertsemlidis A. Luke A. Cooper R.S. Vega G.L. Cohen J.C. Hobbs H.H. Am. J. Hum. Genet. 2006; 78: 410-422Abstract Full Text Full Text PDF PubMed Scopus (445) Google Scholar). It was therefore possible that endogenous modulators of PCSK9 function on LDLR may exist, which could specifically interact with the prosegment, the catalytic domain, or the CHRD. Accordingly, we set up a Far Western screen to identify such a modulator(s) in cell line extracts. Our extended analysis revealed that such a protein does exist in certain cells and that it interacts specifically with the CHRD, resulting in a loss of function, i.e. decreased ability of PCSK9 to enhance the degradation of LDLR. Herein, we describe the identification and properties of this endogenous PCSK9 modulator, as well as its domain that interacts with the CHRD. Expression Constructs—Human PCSK9 and mutant cDNAs and domains thereof were cloned, with or without a C-terminal V5 tag, into pIRES2-EGFP vector (Clontech) as previously described (3Benjannet S. Rhainds D. Essalmani R. Mayne J. Wickham L. Jin W. Asselin M.C. Hamelin J. Varret M. Allard D. Trillard M. Abifadel M. Tebon A. Attie A.D. Rader D.J. Boileau C. Brissette L. Chretien M. Prat A. Seidah N.G. J. Biol. Chem. 2004; 279: 48865-48875Abstract Full Text Full Text PDF PubMed Scopus (516) Google Scholar, 26Benjannet S. Rhainds D. Hamelin J. Nassoury N. Seidah N.G. J. Biol. Chem. 2006; 281: 30561-30572Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). The cDNAs coding for mouse PC5A-V5 (27Nour N. Basak A. Chretien M. Seidah N.G. J. Biol. Chem. 2003; 278: 2886-2895Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) and pCi-hLDLR (3Benjannet S. Rhainds D. Essalmani R. Mayne J. Wickham L. Jin W. Asselin M.C. Hamelin J. Varret M. Allard D. Trillard M. Abifadel M. Tebon A. Attie A.D. Rader D.J. Boileau C. Brissette L. Chretien M. Prat A. Seidah N.G. J. Biol. Chem. 2004; 279: 48865-48875Abstract Full Text Full Text PDF PubMed Scopus (516) Google Scholar) were previously reported. The cDNA encoding for p11-YFP was kindly provided by Dr Volker Gerke (Institute of Medical Biochemistry, University of Muenster, Germany). Wild type human annexin A2 (AnxA2) (ATCC MGC-2257) and annexin A1 (AnxA1) (ATCC MGC-5095) were purchased from ATCC and subcloned into NheI/SacI-digested pIRES2-EGFP vector. An HA epitope (YPYDVPDYA) was fused by PCR mutagenesis at the C terminus of both AnxA1 and AnxA2. All of the oligonucleotides used in the various AnxA2 constructions are listed in supplemental Table S1. Two-steps PCRs were performed on AnxA2 cDNA to introduce point mutations (77RRTKK → AATAK; 77RRTKK → AATAA; 77RRTKKELASALK → 77AATAAELASALA; and 80KKELA → GKPLD) or amino acid (aa) deletions (Δ2–24, aa 2–24; ΔR1, aa 37–108; ΔR2, aa 109–192; ΔR3, aa 193–268; and ΔR4, aa 269–339) into pIRES2-AnxA2-EGFP vector (supplemental Table S1). In addition, using PCR, the AnxA2 segment aa 49–75 was swapped with the corresponding AnxA1 segment aa 58–84 (AnxA2 (aa 49–75) > AnxA1 (aa 58–84)). Purified PCR fragments were digested with the appropriate restriction enzymes and subcloned into the corresponding digested pIRES2-AnxA2-HA-EGFP vector. All of the final cDNA constructs were verified by DNA sequencing. RNA Interference—To silence human AnxA2, a 29-mer pRS-shRNA was used: (sh3, GCATCAGCACTGAAGTCAGCCTTATCTGG) (Origene). The control pRS-shGFP vector (shCtl) contained a noneffective 29-mer shGFP cassette. Quantitative Real Time PCR—Quantitative real time PCR analysis of RNA preparations was performed as previously described (13Zaid A. Roubtsova A. Essalmani R. Marcinkiewicz J. Chamberland A. Hamelin J. Tremblay M. Jacques H. Jin W. Davignon J. Seidah N.G. Prat A. Hepatology. 2008; 48: 646-654Crossref PubMed Scopus (326) Google Scholar, 28Dubuc G. Chamberland A. Wassef H. Davignon J. Seidah N.G. Bernier L. Prat A. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 1454-1459Crossref PubMed Scopus (526) Google Scholar). Briefly, each cDNA sample was submitted to two PCR amplifications: one for normalizing the ribosomal-S protein gene (S14 for human and S16 for mouse cDNAs) and the other for the gene of interest, each in triplicate. The Mx3500P system from Stratagene was used to perform and analyze the quantitative real time PCRs, using S14 or S16 amplifications as normalizers (28Dubuc G. Chamberland A. Wassef H. Davignon J. Seidah N.G. Bernier L. Prat A. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 1454-1459Crossref PubMed Scopus (526) Google Scholar). Cell Culture and Transfections—HepG2, HuH7, COS-1, BSC40, and HEK293 cell lines were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum (Invitrogen), whereas CHO-K1 and CHO-K1 mutant Pgsd-677 cells that lack heparan sulfate proteoglycans (29Mayer G. Hamelin J. Asselin M.C. Pasquato A. Marcinkiewicz E. Tang M. Tabibzadeh S. Seidah N.G. J. Biol. Chem. 2008; 283: 2373-2384Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar) were grown in Ham's F-12 medium/Dulbecco's modified Eagle's medium (50:50) with 10% fetal bovine serum. Y1 mouse adrenal cells were grown in F12K medium with 15% horse serum and 2.5% fetal bovine serum. All of the cells were maintained at 37 °C under 5% CO2. At 80–90% confluence, HuH7 and CHO-K1 cells were transiently transfected with Lipofectamine 2000 (Invitrogen), HEK293 cells were transfected with Effectene (Qiagen), and HepG2 cells were transfected with FuGENE HD (Roche Applied Science). Twenty-four hours after transfection, the cells were washed and incubated in serum-free medium, containing or not exogenous conditioned medium and/or purified proteins, as indicated in the figure legends, for an additional 20 h before medium collection and cell lysis. For analysis of the various AnxA2 mutants in HEK293 cells, 24 h post-transfection the cells were washed and then incubated for another 24 h in complete medium containing 50 μm of the proteasome inhibitor acetyl-Leu-Leu-Norleucinal (Calbiochem). Stable transfectants of shRNA-AnxA2 were obtained in HuH7 cells following puromycin selection. Antibodies and Purified Proteins—The rabbit polyclonal antibody against PCSK9 was raised in-house as described (14Nassoury N. Blasiole D.A. Tebon O.A. Benjannet S. Hamelin J. Poupon V. McPherson P.S. Attie A.D. Prat A. Seidah N.G. Traffic. 2007; 8: 718-732Crossref PubMed Scopus (205) Google Scholar). Other antibodies used were a rabbit polyclonal V5-antibody (Sigma), an unconjugated or horseradish peroxidase (HRP)-conjugated mouse monoclonal anti-V5 (mAb V5 or mAb V5-HRP; Invitrogen), goat anti-LDLR (human) (R & D Systems), HRP-conjugated mouse anti-His (Qiagen), anti-HA (Roche Applied Science), monoclonal anti-HA-Alexa Fluor 488 (Invitrogen), and mouse anti-AnxA2 (human) (BD Biosciences). Purified CHRD-His was produced in-house, purified PCSK9-His6 was a kind gift from Bristol-Myers Squibb, and purified AnxA2-His6 and AnxA1-His6 were purchased from EMD Biosciences. Cell Lysis and Subcellular Fractionation—Mouse tissues and cells were lysed in ice cold radioimmune precipitation assay buffer (50 mm Tris-HCl, pH 7.8, 150 mm NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) containing a mixture of protease inhibitors (Roche Applied Science). For crude membrane preparations and subcellular fractionation, COS-1 cells were homogenized in 10 mm Tris-HCl, pH 7.4, 1 mm EDTA, 200 mm sucrose, and a protease inhibitor mixture. The homogenate was centrifuged at 720 × g for 10 min at 4 °C to remove nuclei and cell debris. The resulting supernatant S1 was centrifuged at 15,000 × g for 10 min at 4 °C. The pellet P1, containing organelles such as lysosomes and mitochondria, was solubilized in radioimmune precipitation assay buffer, and the supernatant S2 was centrifuged at 100,000 × g for 75 min at 4 °C (SW40 rotor and Beckman ultracentrifuge). The resulting crude P2 cell membrane pellet was solubilized in radioimmune precipitation assay, and the soluble supernatant S3 was kept for Far Western blot analysis. Quantitation of protein concentration was effected by the Bradford protein assay. The supernatant S3 (3 μg of protein) was analyzed by SDS-PAGE and compared with 30-μg protein loads from other subcellular fractions. Far Western Blot Assays—Lysates (20–30 μg of protein), media, or purified AnxA2-His6 were heated in reducing or nonreducing Laemmli sample buffer, resolved by SDS-PAGE on 8% glycine gels, and electrotransferred onto nitrocellulose membranes (GE Healthcare). Following 1 h of incubation in 5% skim milk in Tris-buffered saline, 0.1% Tween (TBST), the membranes where incubated with conditioned medium of CHO-K1 cells overexpressing either an empty vector (pIRES-V5), PC5A-V5, CHRD-V5, pIRES-D374Y, PCSK9-V5, or its V5-tagged mutants or incubated with purified AnxA2-His6 for 3 h at room temperature. The membranes were then washed in TBST and incubated with the HRP-conjugated anti-V5 or anti-His antibodies and revealed by enhanced chemiluminescence (GE Healthcare). For competition experiments, 10 μg of His-tagged PCSK9 or CHRD were added to the PCSK9-V5 medium before Far Western blotting. For PCSK9 binding requirements with the ∼33-kDa protein, 1 m NaCl, 10 mg/ml heparin, 1 m NaCl + 10 mg/ml heparin, or 100 mm EDTA were added to the PCSK9-V5 conditioned medium used for Far Western blotting. Immunoprecipitation and Western Blot Assays—For immunoprecipitation cell lysates were incubated overnight at 4 °C with anti-V5-agarose beads (Sigma) and washed five times with cold lysis buffer. Following addition of reducing Laemmli sample, solubilized proteins were revealed by Western blot or separated by SDS-PAGE (8%) and stained by Coomassie Blue for band excision and mass spectrometry. As control for the immunoprecipitation, antigens complexed with the anti-V5-agarose beads were eluted with the V5 peptide (50 μm, Sigma), separated by SDS-PAGE (8%), and revealed by Western blotting with the anti-V5-HRP antibody. Western blotting experiments were made on samples that were reduced in Laemmli buffer, heated, and resolved on 8% glycine SDS-PAGE gels. Separated proteins were then electrotransferred onto nitrocellulose and probed with HRP-conjugated anti-V5 or anti-HA tags or with primary antibodies. Bound primary antibodies were detected with corresponding species-specific HRP-labeled secondary antibodies and revealed by enhanced chemiluminescence. Quantitation of band intensity was done with the ImageJ software version 1.37 (Wayne Rasband, National Institutes of Health, Bethesda, MD). Two-dimensional Gel Electrophoresis and Mass Spectrometry—Two-dimensional gel electrophoresis was performed according to protocols from Ref. 30Gorg A. Obermaier C. Boguth G. Harder A. Scheibe B. Wildgruber R. Weiss W. Electrophoresis. 2000; 21: 1037-1053Crossref PubMed Scopus (1647) Google Scholar. COS-1 cells were lysed in 7 m urea, 2 m thiourea, 2% CHAPS, 0.5% immobilized pH gradient (IPG) buffer (carrier ampholyte mixture; GE Healthcare), and 0.002% bromphenol blue. The protein concentration was estimated by the Bradford assay and adjusted to 0.6 μg/ml with the lysis buffer. 40 mm dithiothreitol was then added, and the cell lysates were kept rotating at 4 °C for 60 min. The samples (200 μl) were loaded onto broad pH range (pH 3–10) IPG gel strips (GE Healthcare), and the first dimension isolelectric focusing separation was achieved using an Ettan IPGphor II system (GE Healthcare). For the second dimension SDS-PAGE separation, IPG strips were equilibrated for 15 min in the SDS equilibration buffer (6 m urea, 75 mm Tris-HCl, pH 8.8, 29.3% glycerol, 2% SDS, 0.002% bromphenol blue) containing 10 mg/ml dithiothreitol and an additional 15 min in the SDS equilibration buffer containing 25 mg/ml iodoacetamide and applied to 12% SDS gels. The gels were then either stained in Coomassie Blue or transferred on nitrocellulose and processed for Far Western blotting with PCSK9-V5. The signal obtained at ∼33 kDa in the Far Western blot was used to establish the position of the band to be excised for mass spectrometry analysis. For protein identification by liquid chromatography-MS/MS, the bands or spots of interest were cut out from the gel and digested with trypsin (0.1 μg) for 60 min at 58 °C. The peptides were extracted from the gel at room temperature, and the supernatants were transferred into a 96-well plate and then completely dried in a vacuum centrifuge. Before the analysis, the peptides were dissolved under agitation for 15 min in 13 μl of formic acid 0.1%, then sonicated for 5 min, and centrifuged at 2,000 rpm for 1 min. Analysis of the peptide mixture was done by liquid chromatography-MS/MS using a LTQ Orbitrap mass spectrometer configured with an on-line NanoLC-two-dimensional high performance liquid chromatography system (Eksigent, Dublin, CA). Protein identification was obtained from the MS/MS spectra using Mascot analysis software (Matrix Science). Hexa-His Pulldown Assay—20 μg of purified AnxA2-His6 or AnxA1-His6 or no proteins (for negative control) were immobilized onto a cobalt chelate resin (Thermo Scientific). The resin was then washed several times with 40 mm immidazole and incubated overnight at 4 °C with 800 μl of conditioned medium from PCSK9-V5-transfected CHO-K1 cells containing 40 mm immidazole. The resin was then washed several times with immidazole (40 mm), heated in reducing Laemmli sample

Referência(s)