Portal de Periódicos da CAPES

Identification of Endoglycan, a Member of the CD34/Podocalyxin Family of Sialomucins

2000; Elsevier BV; Volume: 275; Issue: 12 Linguagem: Inglês

10.1074/jbc.275.12.9001

1083-351X

Christopher M. Sassetti, Annemieke van Zante, Steven D. Rosen,

Cell Adhesion Molecules Research

CD34 and podocalyxin are structurally related sialomucins, which are expressed in multiple tissues including vascular endothelium and hematopoietic progenitors. These glycoproteins have been proposed to be involved in processes as diverse as glomerular filtration, inhibition of stem cell differentiation, and leukocyte-endothelial adhesion. Using homologies present in the cytoplasmic tails of these proteins, we have identified a novel member of this family, which we designate endoglycan. This protein shares a similar overall domain structure with the other family members including a sialomucin domain, but also possesses an extremely acidic amino-terminal region. In addition, endoglycan contains several potential glycosaminoglycan attachment sites and is modified with chondroitin sulfate. Endoglycan mRNA and protein were detected in both endothelial cells and CD34+ bone marrow cells. Thus, CD34, podocalyxin, and endoglycan comprise a family of sialomucins sharing both structural similarity and sequence homology, which are expressed by both endothelium and multipotent hematopoietic progenitors. While the members of this family may perform overlapping functions at these sites, the unique structural features of endoglycan suggest distinct functions for this molecule. CD34 and podocalyxin are structurally related sialomucins, which are expressed in multiple tissues including vascular endothelium and hematopoietic progenitors. These glycoproteins have been proposed to be involved in processes as diverse as glomerular filtration, inhibition of stem cell differentiation, and leukocyte-endothelial adhesion. Using homologies present in the cytoplasmic tails of these proteins, we have identified a novel member of this family, which we designate endoglycan. This protein shares a similar overall domain structure with the other family members including a sialomucin domain, but also possesses an extremely acidic amino-terminal region. In addition, endoglycan contains several potential glycosaminoglycan attachment sites and is modified with chondroitin sulfate. Endoglycan mRNA and protein were detected in both endothelial cells and CD34+ bone marrow cells. Thus, CD34, podocalyxin, and endoglycan comprise a family of sialomucins sharing both structural similarity and sequence homology, which are expressed by both endothelium and multipotent hematopoietic progenitors. While the members of this family may perform overlapping functions at these sites, the unique structural features of endoglycan suggest distinct functions for this molecule. high endothelial venule(s) acidic domain/IgG chimera endoglycan/IgG chimera expressed sequence tag glycosaminoglycan glutathione S-transferase human microvascular endothelial cell(s) hypoxanthine phosphoribosyltransferase human umbilical vein endothelial cell(s) O-sialoglycoprotein endopeptidase Dulbecco's phosphate-buffered saline reverse transcriptase polymerase chain reaction polyacrylamide gel electrophoresis Chinese hamster ovary base pair(s) kilobase pair(s) CD34 and podocalyxin are evolutionarily related glycoproteins, which share a similar overall domain structure as well as significant sequence homology. Structurally, the extracellular region of each of these molecules is dominated by an amino-terminal mucin-like domain, which is densely substituted with sialylated O-linked carbohydrates. This extensive glycosylation causes mucin domains to adopt an extended, rodlike structure (1.Li F. Erickson H.P. James J.A. Moore K.L. Cummings R.D. McEver R.P. J. Biol. Chem. 1996; 271: 6342-6348Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 2.Cyster J.G. Shotton D.M. Williams A.F. Embo J. 1991; 10: 893-902Crossref PubMed Scopus (238) Google Scholar). The mucin-like region is followed by a cysteine-containing and presumably globular domain. This domain may fold into an immunoglobulin-like structure as the positions of 2 of the cysteines are conserved in the C2 set of the immunoglobulin superfamily (3.Barclay A.N. Barkay M.L. Brown M.H. Beyers S.J. Somoza C. Williams A.F. The Leukocyte Antigen Facts Book. Academic Press Inc., San Diego1993Google Scholar). The cytoplasmic domains of these proteins are 73–76 amino acids in length and highly conserved between species orthologs. It is also in this region that the highest homology between CD34 and podocalyxin is found (4.Sassetti C. Tangemann K. Singer M.S. Kershaw D.B. Rosen S.D. J. Exp. Med. 1998; 187: 1965-1975Crossref PubMed Scopus (220) Google Scholar). CD34 is expressed by multipotent hematopoietic progenitors, but is lost during differentiation and is not present on mature hematopoietic cells (5.Andrews R.G. Singer J.W. Bernstein I.D. Blood. 1986; 67: 842-845Crossref PubMed Google Scholar, 6.Katz F.E. Tindle R. Sutherland D.R. Greaves M.F. Leukemia Res. 1985; 9: 191-198Crossref PubMed Scopus (155) Google Scholar, 7.Civin C.I. Strauss L.C. Brovall C. Fackler M.J. Schwartz J.F. Shaper J.H. J. Immunol. 1984; 133: 157-165PubMed Google Scholar). This property makes CD34 a useful marker for the identification and purification of progenitor cells. CD34+ cells isolated from bone marrow or cord blood are clinically important, since a small number of such cells are able to reconstitute hematopoiesis after myeloablative therapy (8.Krause D.S. Fackler M.J. Civin C.I. May W.S. Blood. 1996; 87: 1-13Crossref PubMed Google Scholar). Expression of CD34 in an immature hematopoietic cell line has been shown to inhibit its differentiation (9.Fackler M.J. Krause D.S. Smith O.M. Civin C.I. May W.S. Blood. 1995; 85: 3040-3047Crossref PubMed Google Scholar), suggesting that one possible function for CD34 is to maintain the undifferentiated phenotype of progenitor cells. The chicken ortholog of podocalyxin, known as thrombomucin, is also expressed on multipotent hematopoietic progenitors as well as thrombocytes (10.McNagny K.M. Pettersson I. Rossi F. Flamme I. Shevchenko A. Mann M. Graf T. J. Cell Biol. 1997; 138: 1395-1407Crossref PubMed Scopus (105) Google Scholar), and rat podocalyxin is found on platelets (11.Miettinen A. Solin M.L. Reivinen J. Juvonen E. Väisänen R. Holthöfer H. Am. J. Pathol. 1999; 154: 813-822Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Podocalyxin was originally described as the major sialoprotein on the podocytes of the kidney glomerulus. At this site, podocalyxin is concentrated on the interdigitating secondary foot processes of these cells, where it is thought to maintain the filtration slits between these processes via charge repulsion (12.Kerjaschki D. Sharkey D.J. Farquhar M.G. J. Cell Biol. 1984; 98: 1591-1596Crossref PubMed Scopus (389) Google Scholar). The importance of the podocyte's anionic character has been demonstrated by neutralization experiments using either polycations or desialylation. Either treatment disrupts the glomerular filter and induces proteinurea (13.Andrews P.M. Kidney Int. 1979; 15: 376-385Abstract Full Text PDF PubMed Scopus (59) Google Scholar, 14.Seiler M.W. Venkatachalam M.A. Cotran R.S. Science. 1975; 189: 390-393Crossref PubMed Scopus (169) Google Scholar). In addition to these sites, CD34 and podocalyxin are both broadly expressed on the luminal surface of vascular endothelium (15.Fina L. Molgaard H.V. Robertson D. Bradley N.J. Monaghan P. Delia D. Sutherland D.R. Baker M.A. Greaves M.F. Blood. 1990; 75: 2417-2426Crossref PubMed Google Scholar, 16.Kershaw D.B. Beck S.G. Wharram B.L. Wiggins J.E. Goyal M. Thomas P.E. Wiggins R.C. J. Biol. Chem. 1997; 272: 15708-15714Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 17.Kerjaschki D. Poczewski H. Dekan G. Horvat R. Balzar E. Kraft N. Atkins R.C. J. Clin. Invest. 1986; 78: 1142-1149Crossref PubMed Scopus (69) Google Scholar). The function of these mucins on unactivated endothelium is not clear, but when properly glycosylated in high endothelial venules (HEV),1 -1 both can function as ligands for the leukocyte adhesion molecule, l-selectin (4.Sassetti C. Tangemann K. Singer M.S. Kershaw D.B. Rosen S.D. J. Exp. Med. 1998; 187: 1965-1975Crossref PubMed Scopus (220) Google Scholar, 18.Baumheter S. Singer M.S. Henzel W. Hemmerich S. Renz M. Rosen S.D. Lasky L.A. Science. 1993; 262: 436-438Crossref PubMed Scopus (591) Google Scholar). HEV are specialized postcapillary venules present in lymph nodes and Peyer's patches, which support the recruitment of blood-borne lymphocytes into the lymphoid tissue (19.Girard J.P. Springer T.A. Immunol. Today. 1995; 16: 449-457Abstract Full Text PDF PubMed Scopus (467) Google Scholar). The adhesion between lymphocytes and HEV is initiated by the lectin domain ofl-selectin binding to carbohydrates presented by specific endothelial ligands (20.Rosen S.D. Bertozzi C.R. Curr. Biol. 1996; 6: 261-264Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar). Since all of the biochemically defined HEV-expressed ligands for l-selectin are sialomucins (4.Sassetti C. Tangemann K. Singer M.S. Kershaw D.B. Rosen S.D. J. Exp. Med. 1998; 187: 1965-1975Crossref PubMed Scopus (220) Google Scholar,21.Puri K.D. Finger E.B. Gaudernack G. Springer T.A. J. Cell Biol. 1995; 131: 261-270Crossref PubMed Scopus (143) Google Scholar), it is likely that the ability of these structures to present multivalent carbohydrate ligands to the clustered lectin domains ofl-selectin is critical for the formation of a high avidity interaction. Thus, podocalyxin and CD34 are capable of promoting lymphocyte-endothelial adhesion when appropriate glycoforms are expressed by HEV, but these proteins are implicated in different specialized functions at other sites (i.e. anti-adhesion in the case of podocalyxin on podocytes, and inhibition of differentiation in the case of CD34 on hematopoietic cells). Therefore, these two related sialomucins appear to be multifunctional proteins whose function depends, at least in part, on tissue-specific glycosylation. Using homologies present in CD34 and podocalyxin, we have identified a third member of this gene family. This protein shares a similar overall structure with the other family members except for the presence of an extremely acidic amino-terminal domain. As is the case for CD34 and podocalyxin, this protein is detected in both endothelial cells and early hematopoietic progenitors. Due to its endothelial expression and extensive glycosylation, which includes a sialomucin domain and glycosaminoglycan chains, we propose the name endoglycan for this novel gene. We collectively refer to this gene family as the “CD34 family.” Rapid Screen human fetal brain cDNA library was purchased from Origene (Rockville, MD). 96 pools of approximately 5000 clones each were screened by PCR using the following primers based on an EST corresponding to mouse endoglycan: sense,ATGAATTCGTGATCATTGGTGTCATCTGCTTCATCATCAT; antisense,ATGGATCCCACGTCCAGCGTGGGATTGTCGTG (all of the underlined sequences specified in this section were added for cloning purposes and are not present in the endoglycan cDNA). The same screen was then applied to 96 subpools of 100 clones, each derived from two of the positive pools, and then to individual clones from a positive subpool. In this way a partial clone was obtained, which corresponded to bases 227–2269 in the sequence of Fig. 1. This sequence was used to identify a human EST, which corresponded to bases 104–386. In order to obtain a full-length clone, the same fetal brain library was rescreened along with a human placenta library (Origene) using the following primers, which amplify the extreme 5′ end of the human EST sequence: sense, GCTGGGTCTGATGAGCCTGG; antisense, TAGTGTCTTCAATGGAACCTGC. Positive pools were then rescreened with the same antisense primer and a vector primer (vector primer 3, Origene) in order to identify the longest clone. Screening of subpools was performed, as above, resulting in isolation of a clone from the brain library with the sequence shown in Fig. 1. Multiple-tissue Northern blots were purchased from CLONTECH, hybridized with an endoglycan probe, stripped, and rehybridized with a β-actin probe. The endoglycan probe consisted of bases 1013–1525, which had been amplified from a cDNA clone by PCR using the following primers: sense, ATAGGATCCGAGCCTCTTCCCCACTGGCC; antisense,ATAGAATTCTCAGAGCGTGCCGTAGTCGCTGC. The β-actin probe was supplied with the blots. Randomly primed probes were labeled with [32P]dATP using a Strip-EZ DNA kit (Ambion, Austin, TX). Hybridization and washing was performed as recommended by the blot manufacturer. The final wash was performed in 0.1× SSC, 0.1% SDS at 50 °C. Blots were stripped using the Strip-EZ DNA kit (Ambion). HUVEC for Northern blot analysis were isolated from umbilical cords (San Francisco General Hospital) following published procedures (22.Jaffe E.A. Nachman R.L. Becker C.G. Minick C.R. J. Clin. Invest. 1973; 52: 2745-2756Crossref PubMed Scopus (6019) Google Scholar) except that collagenase A (Roche Molecular Biochemicals) was used. HUVEC were grown in EGM medium (Clonetics, Walkersville, MD), and mRNA was isolated using Oligotex Direct kit (Qiagen, Valencia, CA). 5 μg of mRNA was electrophoresed on a 1% agarose/formaldehyde gel and transferred to Hybond N+ filters (Amersham Pharmacia Biotech). Blots were hybridized as above with an endoglycan probe consisting of bases 1–592 that had been excised from the cDNA clone by restriction digestion with EcoRI and BamHI. HUVEC for RT-PCR experiments were purchased from Clonetics and grown according to the manufacturer's recommendations. Total RNA was prepared using RNAzol B (Tel-Test, Friendswood, TX). First-strand cDNA was prepared from 2 μg of RNA primed with random hexamers using AMV-RT (Life Technologies, Inc.). A 141-bp endoglycan cDNA fragment was amplified from HUVEC cDNA using the primers based on the murine endoglycan sequence given above. A 420-bp podocalyxin cDNA fragment was amplified using the following primers: sense,ATGAATTCGTGATCATTGGTGTCATCTGCTTCATCATCAT; antisense,ATGGATCCCACGTCCAGCGTGGGATTGTCGTG. 45 cycles of PCR were performed on cDNA corresponding to 20 ng of input RNA using Advantage cDNA polymerase (CLONTECH). Cryopreserved CD34+ bone marrow cells were purchased from Poietics (Gaithersburg, MD). cDNA was prepared from total RNA extracted from 50,000 cells, as above. A 519-bp endoglycan fragment and a 289-bp HPRT fragment were amplified using the following primers: for endoglycan, sense (ATAGGATCCGAGCCTCTTCCCCACTGGCC) and antisense (ATAGAATTCTCAGAGCGTGCCGTAGTCGCTGC); for HPRT, sense (CCTGCTGGATTACATCAAAGCACTG) and antisense (TCCAACACTTCGTGGGGTCCT). 35 cycles of PCR were performed on cDNA corresponding to 2000 input cells. The resulting DNA was electrophoresed on 1% agarose and visualized with ethidium bromide. IgG fusion proteins were constructed by PCR amplification of bases 9–1511 (EG/IgG) or 9–638 (AD/IgG) of human endoglycan, bases 262–1127 of human CD34, or bases 551–1531 of human podocalyxin. The following primers were used: endoglycan sense (ATAGCTAGCGGCACGAGGACCATGGGC), EG/IgG antisense (ATATGATCAACTTACCTGTGTCGCTGCGCACCTGGCTGG), AD/IgG antisense (ATATGATCAACTTACCTGTAAAGTCACGGACCTGAGGC), CD34 sense (ATAAAGCTTCTGGTCCGCAGGGGCGCGC) and antisense (ATAAAGCTTACTTACCTGTGGTCTTTTGGGAATAGCTC), and podocalyxin sense (ATATCTAGACTGAGGCGACGACACGATGC) and antisense (ATAGGATCCACTTACCTGTGCGGTCCTCGGCCTCCTCC) (underlined sequence contains restriction sites and a 3′ splice donor site). These fragments were cloned into the XbaI and BamHI sites of pEF-BOS (23.Mizushima S. Nagata S. Nucleic Acids Res. 1990; 18: 5322Crossref PubMed Scopus (1499) Google Scholar). A cDNA fragment encoding the Fc domain of human IgG1 containing the 5′ splice acceptor site (excised from pIg (24.Simmons D.L. Hartley D.A. Cellular Interactions in Development: A Practical Approach. IRL Press, Oxford1993: 93-127Google Scholar), with BamHI and NotI) was cloned 3′ of the endoglycan fragments into BamHI and SalI sites. The control IgG construct was made by amplifying the Igκ-signal peptide (bases 837–1013 of pSec-Tag2A, Invitrogen, Carlsbad, CA) with the following primers: sense (ATATCTAGACCCACTGCTTACTGGCTTATCG) and antisense (ATAGGATCCACTTACCTGTGCTCGGTACCAAGCTTCGTACG), and cloning this fragment into the XbaI and BamHI sites upstream of the human IgG Fc cDNA in pEF-BOS. COS-7 cells were transfected with these plasmids using LipofectAMINE (Life Technologies, Inc.). After transfection, cells were cultured in Opti-MEM (Life Technologies, Inc.) supplemented with 2 mml-glutamine, 100 units/ml penicillin, 100 μg/ml streptomycin, and 200 μCi of Na235SO4 (ICN, Costa Mesa, CA) for 48 h. 1 mm4-methylumbelliferyl-β-d-xyloside (Sigma) in Me2SO (0.1% final concentration) was added to the “β-d-xyloside”-treated cells. Fusion proteins were isolated by incubating aliquots of conditioned medium with 10 μl of protein A-Sepharose (Repligen, Cambridge, MA) for 2 h at 4 °C. Precipitates were washed with PBS, eluted with SDS-PAGE sample buffer containing 1% 2-mercaptoethanol, boiled for 3 min, and electrophoresed on 7.5% SDS-polyacrylamide gels. Gels were stained with Gel Code Blue (Pierce), destained, incubated with Fluorohance (Research Products International Corp, Mount Prospect, IL) for 30 min, and dried for fluorography. HUVEC (Clonetics) were grown to ∼75% confluence in two 180-cm2 flasks as recommended. Cells were then washed with PBS and cultured for 16 h in sulfate-free Dulbecco's modified Eagle's medium containing 2% dialyzed fetal calf serum (Life Technologies, Inc.), 10 ng/ml epidermal growth factor, 1 μg/ml hydrocortisone, 12 μg/ml bovine brain extract (Clonetics), 100 μg/ml streptomycin, 100 units/ml penicillin, and 2 mCi of Na235SO4. Labeled cells were washed with PBS and lysed in PBS containing 2% Triton X-100, 5 mmEDTA, and “Complete” protease inhibitor mixture (Roche Molecular Biochemicals). Lysates were centrifuged at 14,000 × gfor 10 min and precleared by incubation with protein A-Sepharose for 30 min at 4 °C. Aliquots of the supernatant were then incubated at 4 °C for 2 h with protein A-Sepharose, which had been bound with 5 μg of affinity-purified anti-endoglycan antibody or normal rabbit IgG (Sigma). 50 μg/ml heparin (Sigma) was included in the precipitation to prevent nonspecific interactions with labeled heparan sulfate proteoglycans. Precipitates were then washed with PBS containing 0.2% Triton X-100. For enzyme digestions, labeled glycoproteins bound to protein A-Sepharose were incubated for 2 h at 37 °C in 100 μl of PBS containing 0.1% Triton X-100 and different combinations of the following: 200 milliunits of chondroitinase ABC, 10 milliunits of heparinase I, 10 milliunits of heparinase III (Seikagaku America Inc, Ijamsville, MD), and 3 μl ofO-sialoglycoprotein endopeptidase (Cedarlane Labs Ltd., Hornby, Ontario, Canada). Precipitates were washed once more and electrophoresed as above. A fusion protein consisting of the predicted extracellular domain of endoglycan (bases 9–1511) fused to glutathione S-transferase (GST; bases 258–917 of pGEX-2T vector, Amersham Pharmacia Biotech) was constructed in the PEAK10 vector (Edge Biosystems, Gaithersburg, MD). The endoglycan fragment was amplified by PCR using the following primers: sense (ATAAAGCTTGGCACGAGGACCATGGGC) and antisense (ATAGATATCGCGGAGCCCCTGGGCACCAGGTCGCTGCGCACCTGGCTGG), and cloned into the HindIII and EcoRV sites. The GST cDNA was amplified using: sense (ATACACGTGGACGATGACGATAAGATGTCCCCTGTACTAGGTTATTGGAA) and antisense (ATAGCGGCCGCTCAATCCGATTTTGGAGGATGGTC), and cloned into the PmlI and NotI sites. (Underlined sequences contain restriction sites and encode protease cleavage sites) The fusion protein was produced in PEAK-Rapid cells (derived from human embryonic kidney) as recommended by the manufacturer. The secreted fusion protein was bound to glutathione-agarose (Sigma), washed with PBS, and eluted with 5 mm reduced glutathione (Sigma) in PBS. The eluate was concentrated with a Centricon 30 microconcentrator (Amicon, Beverly, MA) and used to immunize two rabbits (Research Genetics, Huntsville, AL). Antibodies were affinity-purified by chromatography on a column of endoglycan/GST fusion protein coupled to cyanogen bromide-activated Sepharose (Sigma) according to standard procedures (25.Harlow E. Lane D. Using Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1999Google Scholar). A cDNA encoding the AD/IgG fusion protein was transfected into COS-7 cells with LipofectAMINE, and cells were cultured in Opti-MEM (Life Technologies, Inc.) supplemented with glutamine, penicillin, and streptomycin. The conditioned medium was centrifuged at 20,000 × g for 15 min at 4 °C, and Tris, pH 8.0, and sodium azide were added to final concentrations of 50 mm and 0.02%, respectively. This material was bound to a protein A-Sepharose column, which was then washed with PBS and eluted with 100 mm triethylamine. The eluate was neutralized with 1/10 volume of 3 m Tris, pH 6.8, and concentrated in a Centricon 30 microconcentrator (Amicon). 45 μg of purified protein was subjected to 7.5% SDS-PAGE, electroblotted onto Problott (Applied Biosystems, Foster City, CA), and stained with Coomassie Brilliant Blue. The predominant 70-kDa band was excised and subjected to Edman degradation analysis. CHO cells expressing individual members of the CD34 family members were created by transfection with each cDNA using LipofectAMINE. Human endoglycan cDNA (bases 1–2081) or human podocalyxin cDNA (bases 235–1858) were transfected using the PEAK10 vector (Edge Biosystems). Human CD34 cDNA (bases 262–1350) in the pRK5 vector (26.Eaton D.L. Wood W.I. Eaton D. Hass P.E. Hollingshead P. Wion K. Mather J. Lawn R.M. Vehar G.A. Gorman C. Biochemistry. 1986; 25: 8343-8347Crossref PubMed Scopus (205) Google Scholar) was cotransfected with empty PEAK10 vector. CHO transfectants were selected with puromycin (Edge Biosystems), and individual clones were screened for expression by flow cytometry. Cells (CHO or HUVEC) were removed from culture dishes by treatment with 0.6 mm EDTA in PBS (without Ca2+ and Mg2+) for 20 min at room temperature. For staining with rabbit antibodies, cells were incubated with 10 μg/ml affinity-purified anti-endoglycan antibody or normal rabbit IgG (Sigma) in PBS containing 1% bovine serum albumin (Sigma), 2% normal goat serum, and 0.2% sodium azide (staining buffer). Cells were washed and stained with 10 μg/ml fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Zymed Laboratories Inc., South San Francisco, CA) in staining buffer. Staining with mouse monoclonal antibodies to CD34 (clone 581, Immunotech, Westbrooke, ME) or podocalyxin (clone PHM5, provided by Dr. Robert Atkins, Monash Medical Center, Victoria, Australia) was identical except the staining buffer contained 2% normal rabbit serum instead of goat serum, and fluorescein isothiocyanate-conjugated rabbit anti-mouse IgG (Zymed Laboratories Inc.) was used as a secondary reagent. Cryopreserved CD34-positive bone marrow cells were purchased from Poietics and stained as above, except the staining buffer contained 2% mouse serum and 2% human serum, and phycoerythrin-conjugated anti-CD34 (clone 581; Caltag, South San Francisco, CA) or mouse IgG1 (Caltag) were used. Peripheral blood was obtained by venipuncture and stained as above. Leukocyte subsets were identified with fluorochrome-conjugated antibodies to CD14, CD19, CD4, and CD8 (Caltag) and αIIbβ3 (Immunotech). All samples were analyzed on a FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ). Specimens of human foreskin were obtained from the Department of Pediatrics, University of California, San Francisco and frozen in OCT embedding medium (Miles Inc., Elkhart, IN). 10-μm frozen sections were cut and fixed in 1% paraformaldehyde for 20 min. Endogenous peroxidase activity was then quenched with 0.3% hydrogen peroxide in methanol for 20 min. Sections were blocked with PBS containing 1% goat serum and 1% human serum (staining buffer). Anti-endoglycan and anti-PECAM (monoclonal antibody 2148, Chemicon, Temecula, CA) antibodies were used at 1 μg/ml in staining buffer. Bound antibodies were detected with Cy 3-conjugated goat anti-rabbit IgG and Cy 2-conjugated goat anti-mouse IgG (Jackson Immunoresearch, West Grove, PA) in staining buffer. Normal rabbit IgG (Caltag) or mouse IgG1 (Zymed Laboratories Inc.) were used as controls. The highest sequence homology between CD34 and podocalyxin occurs in the cytoplasmic domains of these proteins. In order to identify additional members of this gene family, we searched (tblastx) (27.Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (71456) Google Scholar) the GenBank expressed sequence tag (EST) library using the peptide sequence of the cytoplasmic domain of human podocalyxin as a probe. Several overlapping mouse EST sequences were identified encoding a peptide sequence that was 44% identical to a 113-amino acid region encompassing the transmembrane and cytoplasmic domains of podocalyxin. In order to obtain a full-length human cDNA corresponding to this gene, PCR primers were designed based on the available mouse sequence, which would be predicted to amplify a product corresponding to the human ortholog of this gene but not to the two known family members. This approach took advantage of the observation that the transmembrane domains of CD34 and podocalyxin differ from each other, but are highly conserved between species orthologs (16.Kershaw D.B. Beck S.G. Wharram B.L. Wiggins J.E. Goyal M. Thomas P.E. Wiggins R.C. J. Biol. Chem. 1997; 272: 15708-15714Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 28.Brown J. Greaves M.F. Molgaard H.V. Int. Immunol. 1991; 3: 175-184Crossref PubMed Scopus (146) Google Scholar, 29.Simmons D.L. Satterthwaite A.B. Tenen D.G. Seed B. J. Immunol. 1992; 148: 267-271PubMed Google Scholar, 30.Kershaw D.B. Thomas P.E. Wharram B.L. Goyal M. Wiggins J.E. Whiteside C.I. Wiggins R.C. J. Biol. Chem. 1995; 270: 29439-29446Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Thus, one primer was based on sequence in the predicted transmembrane domain and the other was based on a region in the cytoplasmic tail, which is conserved between this protein and podocalyxin (HDNPTLDV, see Fig. 8). These primers amplified the same sized product from mouse and human cDNA libraries and were used to screen a human fetal brain cDNA library by the strategy described under “Experimental Procedures.” One full-length and one partial clone (bases 227–2269) were obtained and sequenced (Fig. 1). The full-length cDNA contains a single open reading frame, encoding a protein of 605 amino acids, followed by a 3′-untranslated region of 322 bp and a poly(A) tail. The start codon identified is in a strong context for translation initiation (31.Kozak M. Mamm. Genome. 1996; 7: 563-574Crossref PubMed Scopus (757) Google Scholar) and is followed by a hydrophobic region of 32 amino acids, which satisfies the criteria for a cleavable signal peptide (32.Nielsen H. Engelbrecht J. Brunak S. von Heijne G. Protein Eng. 1997; 10: 1-6Crossref PubMed Scopus (4942) Google Scholar). Hydropathy analysis (33.Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17296) Google Scholar) of the derived amino acid sequence predicted a single transmembrane domain of 25 residues near the carboxyl terminus. Overall, the cDNA encodes a type I transmembrane protein with a similar domain structure to CD34 and podocalyxin. The 80-amino acid cytoplasmic domain is similar in length to the other family members (73 for CD34 and 76 for podocalyxin) and shares significant homology with both (58% identity with human podocalyxin and 33% with human CD34). The 500-amino acid extracellular region contains a membrane-proximal, cysteine-containing and presumably globular domain. This domain is similar to those found in the other family members, except that only three cysteines are present as compared with six and four in CD34 and podocalyxin, respectively. Amino-terminal to this structure is a domain of 156 amino acids, which contains 36% serine, threonine, and proline. This is twice the average content of these residues in human proteins (34.Doolittle R.F. Of Urfs and Orfs. University Science Books, Mill Valley, CA1986Google Scholar) and is characteristic of mucin-like domains. At the amino terminus of the predicted protein is a highly acidic domain of 161 amino acids (after signal peptide cleavage), which contains 30% acidic residues and is not found in the other family members. This domain is particularly rich in glutamate, containing three polyglutamate tracts of 5–11 residues. Inspection of the sequence revealed many potential sites for post-translational modification (Fig. 1). In addition to the denseO-linked carbohydrate expected to be present in the mucin-like domain, four potential sites of N-linked carbohydrate addition are present. The two tyrosines in the acidic amino-terminal domain are potential sites of sulfation (35.Bundgaard J.R. Vuust J. Rehfeld J.F. J. Biol. Chem. 1997; 272: 21700-21705Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Six serine-glycine and two serine-alanine pairs, which are potential glycosaminoglycan attachment sites (36.Esko J.D. Zhang L. Curr. Opin. Struct. Biol. 1996; 6: 663-670Crossref PubMed Scopus (154) Google Scholar), are distributed throughout the extracellular region. Intracellularly, two potential sites for casein kinase II phosphorylation ((S/T)XX(D/E)) are found. The product of this cDNA will be referred to as endoglycan, based on the characterization provided below. Northern blots containing poly(A)+ RNA from different human tissues were probed with a fragment of the endoglycan cDNA. A major 2.5-kb band was detected in several tissues. This mRNA was most prominent in brain but was a