cDNA Array Hybridization after Laser-Assisted Microdissection from Nonneoplastic Tissue
2002; Elsevier BV; Volume: 160; Issue: 1 Linguagem: Inglês
10.1016/s0002-9440(10)64352-0
ISSN1525-2191
AutoresLudger Fink, Stephanie Kohlhoff, Maria Magdalena Stein, Jörg Hänze, Norbert Weißmann, Frank Rose, Ercan Akkayagil, D Manz, Friedrich Grimminger, Werner Seeger, Rainer M. Bohle,
Tópico(s)RNA Research and Splicing
ResumoDifferential gene expression can be investigated effectively by cDNA arrays. Because tissue homogenates result inevitably in an average expression of a bulk of different cells, we aimed to combine mRNA profiling with cell-type-specific microdissection. Using a polymerase chain reaction (PCR)-based preamplification technique, the expression profile was shown to be preserved. We modified the existing protocol enabling to apply the total amount of extracted RNA from microdissected cells. A mean amplification factor of nearly 1000 allowed to reduce the demand of initial RNA to ∼10 ng. This technique was used to investigate intrapulmonary arteries from mouse lungs (∼500 cell equivalents). Using filters with 1176 spots, three independent experiments showed a high consistency of expression for the preamplified cDNAs. These profiles differed primarily from those of total lung homogenates. Additionally, in experimental hypoxia-induced pulmonary hypertension, amplified cDNA from intrapulmonary vessels of these lungs was compared to cDNA from vessels dissected from normoxic lungs. Validation by an alternative method was obtained by linking microdissection with real-time polymerase chain reaction (PCR). As suggested by the array data, nine selected genes with different factors of up-regulation were fully confirmed by the PCR technique. Thus, a rapid protocol is presented combining microdissection and array profiling that demands low quantities of initial RNA to assess reliably cell-type-specific gene regulation even within nonneoplastic complex tissues. Differential gene expression can be investigated effectively by cDNA arrays. Because tissue homogenates result inevitably in an average expression of a bulk of different cells, we aimed to combine mRNA profiling with cell-type-specific microdissection. Using a polymerase chain reaction (PCR)-based preamplification technique, the expression profile was shown to be preserved. We modified the existing protocol enabling to apply the total amount of extracted RNA from microdissected cells. A mean amplification factor of nearly 1000 allowed to reduce the demand of initial RNA to ∼10 ng. This technique was used to investigate intrapulmonary arteries from mouse lungs (∼500 cell equivalents). Using filters with 1176 spots, three independent experiments showed a high consistency of expression for the preamplified cDNAs. These profiles differed primarily from those of total lung homogenates. Additionally, in experimental hypoxia-induced pulmonary hypertension, amplified cDNA from intrapulmonary vessels of these lungs was compared to cDNA from vessels dissected from normoxic lungs. Validation by an alternative method was obtained by linking microdissection with real-time polymerase chain reaction (PCR). As suggested by the array data, nine selected genes with different factors of up-regulation were fully confirmed by the PCR technique. Thus, a rapid protocol is presented combining microdissection and array profiling that demands low quantities of initial RNA to assess reliably cell-type-specific gene regulation even within nonneoplastic complex tissues. Oligonucleotide and cDNA arrays allow an effective investigation of functional genomics.1Schena M Heller RA Theriault TP Konrad K Lachenmeier E Davis RW Microarrays: biotechnology's discovery platform for functional genomics.Trends Biotechnol. 1998; 16: 301-306Abstract Full Text Full Text PDF PubMed Scopus (686) Google Scholar They determine differential expression of a multitude of genes, using a systematic and comprehensive approach, and give an open-minded look at the field of research. This enables rapid elucidation of regulation modalities associated with special conditions and developmental states, revealing important candidate genes or gene clusters with impact on further basic research as well as clinical applications.2Bubendorf L Kolmer M Kononen J Koivisto P Mousses S Chen Y Mahlamaki E Schraml P Moch H Willi N Elkahloun AG Pretlow TG Gasser TC Mihatsch MJ Sauter G Kallioniemi OP Hormone therapy failure in human prostate cancer: analysis by complementary DNA and tissue microarrays.J Natl Cancer Inst. 1999; 91: 1758-1764Crossref PubMed Scopus (326) Google Scholar, 3Wang K Gan L Jeffery E Gayle M Gown AM Skelly M Nelson PS Ng WV Schummer M Hood L Mulligan J Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray.Gene. 1999; 229: 101-108Crossref PubMed Scopus (286) Google Scholar, 4Alizadeh AA Eisen MB Davis RE Ma C Lossos IS Rosenwald A Boldrick JC Sabet H Tran T Yu X Powell JI Yang L Marti GE Moore T Hudson Jr, J Lu L Lewis DB Tibshirani R Sherlock G Chan WC Greiner TC Weisenburger DD Armitage JO Warnke R Levy R Wilson W Grever MR Byrd JC Botstein D Brown PO Staudt LM Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling.Nature. 2000; 403: 503-511Crossref PubMed Scopus (8202) Google Scholar Moreover, understanding of the intercellular cross-talk within complex tissues is highly challenging because it may substantially differ from culture models. However, the application of tissue homogenates results inevitably in averaging of the expression of different cell types, and the expression profile of a specific cell type may be primarily masked or even lost because of the bulk of surrounding cells. To select cell types from complex tissues, microdissection techniques have been successfully used. Within a few years these techniques have become an accepted tool aiming to investigate complex tissues in a more detailed manner. They have been shown to isolate precisely single cells or cell clusters under optical control for use in several downstream applications for DNA, RNA, and protein analysis.5Sirivatanauksorn Y Drury R Crnogorac-Jurcevic T Sirivatanauksorn V Lemoine NR Laser-assisted microdissection: applications in molecular pathology.J Pathol. 1999; 189: 150-154Crossref PubMed Scopus (53) Google Scholar, 6Walch A Specht K Smida J Aubele M Zitzelsberger H Höfler H Werner M Tissue microdissection techniques in quantitative genome and gene expression analyses.Histochem Cell Biol. 2001; 115: 269-276PubMed Google Scholar, 7Fend F Raffeld M Laser capture microdissection in pathology.J Clin Pathol. 2000; 53: 666-672Crossref PubMed Scopus (202) Google Scholar In particular, the fragile mRNA can be obtained in a quality that is even suitable for construction of cDNA libraries or array hybridization. As the amount of RNA from microdissected material is often limited and not sufficient for hybridization, a preamplification technique has to be incorporated. This ideally results in an accurate amplification of all RNAs, thus representing the original mRNA pool and preserving the expression profile. The T7-based linear amplification8Van Gelder RN von Zastrow ME Yool A Dement WC Barchas JD Eberwine JH Amplified RNA synthesized from limited quantities of heterogeneous cDNA.Proc Natl Acad Sci USA. 1990; 87: 1663-1667Crossref PubMed Scopus (1043) Google Scholar, 9Crino PB Trojanowski JQ Dichter MA Eberwine J Embryonic neuronal markers in tuberous sclerosis: single-cell molecular pathology.Proc Natl Acad Sci USA. 1996; 93: 14152-14157Crossref PubMed Scopus (169) Google Scholar was the first approach to be shown to generate a representative mRNA profile that allows to combine microdissection with array technology.10Luo L Salunga RC Guo H Bittner A Joy KC Galindo JE Xiao H Rogers KE Wan JS Jackson MR Erlander MG Gene expression profiles of laser-captured adjacent neuronal subtypes.Nat Med. 1999; 5: 117-122Crossref PubMed Scopus (646) Google Scholar, 11Ohyama H Zhang X Kohno Y Alevizos I Posner M Wong DT Todd R Laser capture microdissection-generated target sample for high-density oligonucleotide array hybridization.BioTechniques. 2000; 29: 530-536PubMed Google Scholar As the linear amplification is very time consuming and susceptible to various disturbances and even failures leading to RNA loss and degradation, a PCR-based technique was suggested.12Chenchik A Zhu YY Diachenko L Li R Hill J Siebert PD Generation and use of high-quality cDNA from small amounts of total RNA by SMART PCR.in: Siebert PD Larrick JW Gene cloning and analysis by RT-PCR. BioTechniques Books, Westborough1998: 305-319Google Scholar This approach uses the ability of reverse transcriptase to add nucleotides to the 3′ end of the cDNA strand and allows a second primer to add. Thus, cDNAs with defined 5′ and 3′ ends for PCR amplification are obtained (commercially available as SMART PCR; Clontech, Palo Alto, CA).13Franz O Bruchhaus II Roeder T Verification of differential gene transcription using virtual northern blotting.Nucleic Acids Res. 1999; 27: e3Crossref PubMed Google Scholar It was shown that high-, medium-, and low-abundance transcripts are amplified in a representative manner14Endege WO Steinmann KE Boardman LA Thibodeau SN Schlegel R Representative cDNA libraries and their utility in gene expression profiling.BioTechniques. 1999; 26: 542-550PubMed Google Scholar and that full-length cDNAs are provided.13Franz O Bruchhaus II Roeder T Verification of differential gene transcription using virtual northern blotting.Nucleic Acids Res. 1999; 27: e3Crossref PubMed Google Scholar, 15Hung HL Song F Gewirtz A A method for identifying differentially expressed genes in rare populations of primary human hematopoietic cells.Leukemia. 1999; 13: 295-297Crossref PubMed Scopus (15) Google Scholar Moreover, application of SMART-amplified cDNA to arrays resulted in a very high homology of the expression profile of several hundred genes when compared to unamplified cDNA16Spirin KS Ljubimov AV Castellon R Wiedoeft O Marano M Sheppard D Kenney MC Brown DJ Analysis of gene expression in human bullous keratopathy corneas containing limiting amounts of RNA.Invest Ophthalmol Vis Sci. 1999; 40: 3108-3115PubMed Google Scholar, 17Vernon SD Unger ER Rajeevan M Dimulescu IM Nisenbaum R Campbell CE Reproducibility of alternative probe synthesis approaches for gene expression profiling with arrays.J Mol Diagn. 2000; 2: 124-127Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar indicating that the relative proportions of the mRNAs were maintained. In intact mouse lungs, originating from control animals and those with pulmonary hypertension because of chronic hypoxia, we aimed to establish a rapid and reproducible protocol that allows a reliable mRNA profiling of intrapulmonary arteries containing a limited amount of microdissected cell profiles. Hereby, the application to nonneoplastic tissue required a special effort in precision because message regulation often varies in a smaller extent compared to tumors. Laser-assisted microdissection was used for isolation of the vessels that represent only a minor portion of the lung tissue. Using SMART PCR for preamplification, we modified the protocol to introduce the entire cDNA to PCR amplification and subsequent array hybridization. To validate differential gene expression measured by cDNA arrays, the results were verified by a second independent technique based on microdissection in combination with relative mRNA quantitation by real-time PCR.18Fink L Seeger W Ermert L Hanze J Stahl U Grimminger F Kummer W Bohle RM Real-time quantitative RT-PCR after laser-assisted cell picking.Nat Med. 1998; 4: 1329-1333Crossref PubMed Scopus (525) Google Scholar All animal experiments were approved by the local authorities (Regierungspräsidium Giessen, no. II25.3-19c20-151Schena M Heller RA Theriault TP Konrad K Lachenmeier E Davis RW Microarrays: biotechnology's discovery platform for functional genomics.Trends Biotechnol. 1998; 16: 301-306Abstract Full Text Full Text PDF PubMed Scopus (686) Google Scholar GI20/10-Nr.22/2000). Male BALB/cAnNCrlBR mice (20 to 22 g; Charles River, Sulzfeld, Germany) were exposed to normobaric hypoxia [inspiratory O2 fraction (FiO2) 0.10] in a ventilated chamber. The level of hypoxia was held constant by an autoregulatory control unit (O2 controller model 4010; Labotect, Göttingen, Germany), supplying either nitrogen or oxygen. Excess humidity in the recirculating system was prevented by condensation in a cooling system. CO2 was continuously removed by soda lime. Mice exposed to normobaric normoxia were kept in a similar chamber at an FiO2 of 0.21. After 21 days, the animals were intraperitoneally anesthetized with 180 mg of sodium pentobarbital/kg body weight. A cannula was inserted into the trachea by tracheostomy, a midline sternotomy was performed, and the lungs were flushed via a catheter in the pulmonary artery with Krebs Henseleit buffer (125.0 mmol/L NaCl, 4.3 mmol/L KCl, 1.1 mmol/L KH2PO4, 2.4 mmol/L CaCl2, 1.3 mmol/L MgCl2, and 13.32 mmol/L glucose) at a pressure of 20 cm H2O at room temperature. It was equilibrated with a gas mixture of 1% O2, 5.3% CO2, balanced N2. NaHCO3 was adjusted to result in a constant pH range of 7.37 to 7.40. During perfusion of the lungs the buffer was allowed to drain freely from a catheter in the left ventricle. Once the effluent was clear of blood, 800 μl of prewarmed TissueTek (Sakura Finetek, Zoeterwoude, The Netherlands) were instilled into the airways via the tracheal cannula. After ligation of the trachea, the lungs were excised and immediately frozen in liquid nitrogen. Preparation of the hypoxic animals was continuously performed in the hypoxic environment. The right ventricular wall was trimmed from the left ventricle plus septum to calculate the ratio of right ventricle wall/(left ventricle plus septum) of the dried heart tissue. Right heart hypertrophy after 21 days of hypoxia was additionally ascertained by separate experiments including normoxic and hypoxic animals. Data were compared by a paired t-test. In separate experiments pulmonary artery pressure was measured in an in situ isolated lung preparation. Mice were deeply anesthetized intraperitoneally with sodium pentobarbital and anti-coagulated with heparin (1000 U/kg) by intravenous injection. After placing on a heated table (37°C), animals were intubated via tracheostoma and ventilated with room air (300 μl tidal volume, 90 breaths/min, and 3 cmH2O positive end-expiratory pressure). Midsternal thoracotomy was followed by insertion of catheters into the pulmonary artery and left atrium. Using a peristaltic pump (ISM834A V2.10; Ismatec, Glattbrugg, Switzerland), buffer perfusion via the pulmonary artery was started at 4°C and a flow of 0.2 ml/min. The buffer contained 120 mmol/L NaCl, 4.3 mmol/L KCl, 1.1 mmol/L KH2PO4, 2.4 mmol/L CaCl2, 1.3 mmol/L MgCl2, and 2.4 g/L of glucose as well as 5% (w/v) hydroxyethylamylopectin (molecular weight, 200,000). NaHCO3 was adjusted to result in a constant pH range of 7.37 to 7.40. In parallel with the onset of artificial perfusion, ventilation was changed from room air to a mixture of 5.3% CO2, 21.0% O2, balanced N2. After rinsing the lungs with ≥20 ml of buffer, the perfusion circuit was closed for recirculation (total system volume, 13 ml) and left atrial pressure was set at 2.0 mm Hg. Meanwhile, the flow was slowly increased from 0.2 to 2 ml/min and the entire system heated to 37°C. Pressures in pulmonary artery and left atrium were registered via transducers. The given pulmonary artery pressure values were taken after an initial steady state period of 20 minutes. Data were recorded from normoxic mice and from mice after 21 days of chronic hypoxia and analyzed by a paired t-test. Microdissection was performed as described in detail previously.19Fink L Stahl U Ermert L Kummer W Seeger W Bohle RM Rat porphobilinogen deaminase gene: a pseudogene-free internal standard for laser-assisted cell picking.BioTechniques. 1999; 26: 510-516PubMed Google Scholar, 20Fink L Kinfe T Seeger W Ermert L Kummer W Bohle RM Immunostaining for cell picking and real-time mRNA quantitation.Am J Pathol. 2000; 157: 1459-1466Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar In brief, cryosections (6 μm) from lung tissue were mounted on glass slides. After hemalaun staining for 45 seconds, the sections were subsequently immersed in 70% and 96% ethanol and stored in 100% ethanol until use. Not more than 10 sections were prepared at once to restrict the storage time. Intrapulmonary arteries with a diameter of 250 to 500 μm were selected and microdissected under optical control using the Laser Microbeam System (P.A.L.M., Bernried, Germany). Afterward, the vessel profiles were isolated by a sterile 30-gauge needle. Needles with adherent vessels were transferred into a reaction tube containing 200 μl of RNA lysis buffer (Figure 1). Lysis buffer for mRNA extraction consisted of 4 mol/L of guauidine thiocyanate (GTC), 25 mmol/L of Na3 citrate, 0.5% sarcosyl, and 0.72% β-mercaptoethanol. After incubation for 10 minutes at room temperature, 20 μl of 2 mol/L NaAc, 220 μl of phenol (pH 4.3), and 60 μl of chloroform/isoamylalcohol (24:1) were added. The samples were vortexed and centrifuged for 15 minutes at 4°C. The aqueous layer was collected, 1 μl of glycogen (1 mg/ml) added, and afterward precipitated with 200 μl of isopropanol. Samples were frozen for 1 hour at −20°C and centrifuged for 15 minutes. The pellets were washed with 75% ethanol and air-dried. After resuspension in 10 μl of H20, DNase digestion (1 U, 30 minutes, 37°C; Ambion, Austin, TX) was performed. Afterward, extraction was repeated and RNA was diluted in 4 μl of H2O. Total RNA was reverse-transcribed using the SMART PCR cDNA Synthesis Kit (Clontech) with slight modifications. Four μl of total RNA, 1 μl of cDNA Synthesis (CDS) Primer (diluted to a concentration of 5 μmol/L), and 1 μl of SMART II oligonucleotide (diluted to a concentration of 5 μmol/L) were mixed and incubated at 70°C for 8 minutes. After short spinning, 2 minutes on ice and 2 minutes at 42°C, a master mix containing 2 μl of 5× buffer, 1 μl dithiothreitol (20 mmol/L), 1 μl dNTP (10 mmol/L) and 0.5 μl RNase H− Moloney murine leukemia virus reverse transcriptase (PowerScript, Clontech) was added and incubated at 42°C for 1 hour. Afterward, cDNA was mixed with 38.5 μl of TE buffer (10 mmol/L Tris, pH 7.6, 1 mmol/L ethylenediaminetetraacetic acid) and purified by the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). Therefore, 250 μl of buffer PB were added to the cDNA to load a column. According to the manufacturer's protocol, the columns were washed once. For elution, 45 μl of elution buffer (10 mmol/L Tris, pH 8.5) were applied to the center of the column, incubated for 2 minutes, and centrifuged. To improve the recovery, this step was repeated using the first eluate again. From the eluted cDNA (∼44 μl), 2 μl were separated for further determination of the amplification factor. For the PCR-based amplification, the remaining 42 μl of cDNA were mixed with 5 μl of 10× buffer, 1 μl PCR primer (10 μmol/L), 1 μl dNTP (10 mmol/L), and 1 μl Advantage 2 polymerase mix. PCR conditions were 95°C for 1 minute, followed by 19 cycles with 95°C for 15 seconds, 65°C for 30 seconds, and 68°C for 3 minutes. The resulting PCR product was purified using the QIAquick columns as described above. Forty-four μl of elution buffer were applied twice for elution and 2 μl were separated for determination of the amplification factor. All incubations were performed with a GeneAmp 2400 PCR cycler (PE Applied Biosystems, Foster City, CA). For array hybridization, we used nylon filters with 1176 spotted cDNA (Mouse 1.2 II Atlas cDNA Arrays, Clontech). The purified PCR product was labeled with α-32P dATP using the Atlas SMART Probe Amplification Kit (Clontech). Forty-two μl of PCR product and 1 μl of CDS primer were heated at 95°C for 8 minutes. After 2 minutes at 50°C, a master mix containing 6 μl of 10× labeling buffer, 5 μl of dNTP (without dATP), 4 μl of α-32P dATP (Amersham Pharmacia Biotech, Freiburg, Germany), and 1 μl of Klenow enzyme were added, mixed, and incubated for 30 minutes. Reaction was stopped by applying 2 μl of 0.5-mol/L ethylenediaminetetraacetic acid. Labeled DNA was purified by QIAquick columns as described above, eluted twice with 100 μl of elution buffer, and resulted in ∼5 to 8 × 106 cpm. Afterward, array hybridization was performed according to the protocol. Filters with32P-labeled PCR product were incubated at 68°C overnight. They were washed three times in 500 ml of 2× standard saline citrate and 1% sodium dodecyl sulfate at 68°C for 30 minutes. Finally, they were wrapped in plastic and exposed to an imaging plate (Fuji Photo Film, Tokyo, Japan) in lead sheathing. The film was read with a phosphorimaging system (BAS RPI 1000, Fuji Photo Film). Analysis was performed using the AtlasImage 1.5/2.0 software (Clontech). Global normalization was calculated by the sum method. For both arrays, differences of signal intensity minus background were added for all values over background. Afterward, normalization coefficient was determined by calculating the ratio of array 1 sum and array 2 sum. After normalization, background was substracted, ratio threshold was set at 2, and difference threshold was set at 550. Based on the following equation, we used comparative quantitation (ΔCT). Real-time PCR was performed by the Sequence Detection System 7700 (PE Applied Biosystems). AoNo=K × 2(CT,N-CT,A)where Ao is initial number of cDNA copies after amplification; No is the initial number of nonamplified cDNA copies; CT,A is the threshold cycle of amplified PCR product; CT,N is the threshold cycle of nonamplified cDNA; and K is constant. Applying either 2 μl of nonamplified cDNA or 2 μl of amplified PCR product, 25 μl Universal Master Mix (Applied Biosystems), porphobilinogen deaminase (PBGD) forward primer and reverse primer (Table 1) in a final concentration of 900 nmol/L and hybridization probe (Table 1) in a final concentration of 200 nmol/L were mixed in an end volume of 50 μl. Cycling conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, and 61°C for 60 seconds.Table 1Sequences, Amplicon Sizes, and Position of Primers (and Probe)Primer nameSequencePositionPBGD (M28663, M28664); amplicon size: 135 bpFP (M28663)5′GGTACAAGGCTTTCAGCATCGC3′103-82RP (M28664)5′ATGTCCGGTAACGGCGGC3′505-522Probe (M28664; M28663)5′CCAGCTGGCTCTTACGGGTGCCCAC3′2510-2490; 55-52Procollagen 1 α1 subunit (U08020); amplicon size: 124 bpFP5′CCAAGGGTAACAGCGGTGAA3′1253-1272RP5′CCTCGTTTTCCTTCTTCTCCG3′1376-1356Procollagen 1 α2 subunit (X58251); amplicon size: 113 bpFP5′TGTTGGCCCATCTGGTAAAGA3′1412-1432RP5′CAGGGAATCCGATGTTGCC3′1524-1506Procollagen 3 α1 subunit (X52046); amplicon size: 92 bpFP5′TCAAGTCTGGAGTGGGAGG3′17600-17621RP5′TCCAGGATGTCCAGAAGAACCA3′19252-19231Carbonic anhydrase 3 (M27796); amplicon size: 101 bpFP5′GACGGGAGAAAGGCGAGTTC3′532-551RP5′CAGGCATGATGGGTCAAAGTG3′632-612Matrix gamma-carboxyglutamate protein (D00613); amplicon size: 101 bpFP5′GTGGCGAGCTAAAGCCCAA3′165-183RP5′CGTAGCGCTCACACAGCTTG3′265-246Non-muscle myosin light chain 3 (U04443); amplicon size: 101 bpFP5′CTTTGAGCACTTCCTGCCCA3′168-187RP5′CCTTCCTTGTCAAACACACGAA3′269-248Serine proteinase inhibitor 3 (U25844); amplicon size: 82 bpFP5′TCCTGCCTCAAGTTCTATGAAGC3′398-420RP5′TGTTGATGTGCTGTCGGGAC3′479-460Cytochrome b-245 α polypeptide (M31775); amplicon size: 101 bpFP5′TTTCGGCGCCTACTCTATCG3′48-67RP5′TCTGTCCACATCGCTCCATG3′148-129AXL receptor tyrosine kinase (X63535); amplicon size: 101 bpFP5′AGTCACAGGACACAGCTCC3′473-493RP5′AGGTGGTGACTCCCTTGGC3′573-555The primer/(probe) sets work under identical PCR-cycling conditions to obtain simultaneous amplification in the same run. Sequences were taken from GeneBank, Accession numbers are given. Open table in a new tab The primer/(probe) sets work under identical PCR-cycling conditions to obtain simultaneous amplification in the same run. Sequences were taken from GeneBank, Accession numbers are given. In analogy, preservation of the expression profile was investigated by determination of the amplification factor for the four genes PBGD, tumor necrosis factor-α, cyclooxygenase 2 (COX2), and tissue factor. Preparation and PCR conditions were identical to those described before, primer/probe sets are given elsewhere.21Hölschermann H Bohle RM Schmidt H Zeller H Fink L Stahl U Grimm H Tillmanns H Haberbosch W Hirudin reduces tissue factor expression and attenuates graft arteriosclerosis in rat cardiac allografts.Circulation. 2000; 102: 357-363Crossref PubMed Scopus (33) Google Scholar, 22Grandel U Fink L Blum A Heep M Buerke M Kraemer HJ Mayer K Bohle RM Seeger W Grimminger F Sibelius U Endotoxin-induced myocardial tumor necrosis factor-alpha synthesis depresses contractility of isolated rat hearts: evidence for a role of sphingosine and cyclooxygenase-2-derived thromboxane production.Circulation. 2000; 102: 2758-2764Crossref PubMed Scopus (116) Google Scholar The above-mentioned equation was also used for relative mRNA quantitation by real-time PCR. The target gene was normalized to an internal standard gene. Therefore, PBGD mRNA was used, an ubiquitously as well as consistently expressed standard gene that is free of pseudogenes. For cDNA synthesis, reagents and incubation steps were applied as described.18Fink L Seeger W Ermert L Hanze J Stahl U Grimminger F Kummer W Bohle RM Real-time quantitative RT-PCR after laser-assisted cell picking.Nat Med. 1998; 4: 1329-1333Crossref PubMed Scopus (525) Google Scholar The reactions were set up with the SYBR Green PCR Core Reagents (Applied Biosystems) according to the manufacturer's protocol. Using the oligonucleotide primer pairs given in Table 1, for each gene 1 μl of the concerning primers (final concentration, 200 nmol/L) and 2 μl of cDNA were added to a final volume of 50 μl. Cycling conditions were 95°C for 6 minutes, followed by 45 cycles of 95°C for 20 seconds, 58°C for 30 seconds, and 73°C for 30 seconds. Because of the nonselective dsDNA binding of the SYBR Green, gel electrophoresis was performed to confirm the exclusive amplification of the expected PCR product. To investigate the preservation of the mRNA expression profile during the cDNA preamplification procedure, extracted mRNA from lungs treated with lipopolysaccharide and interferon-γ20Fink L Kinfe T Seeger W Ermert L Kummer W Bohle RM Immunostaining for cell picking and real-time mRNA quantitation.Am J Pathol. 2000; 157: 1459-1466Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar was diluted to amounts comparable to microdissected material. Afterward, preamplification was performed using SMART PCR. The generated PCR product as well as the unamplified cDNA then underwent real-time quantitative PCR. To test the impact of preamplification on different amounts of initial mRNA copy numbers, four genes were selected representing different levels of mRNA expression. Tumor necrosis factor-α was seen to be a highly expressed gene after lipopolysaccharide/interferon-γ stimulation, PBGD and COX2 were moderately expressed, and tissue factor expression was very low. When comparing the ratios of cDNA amplified by 15 cycles to preamplified status, consistency of the amplification step for all genes was noted (Table 2).Table 2Maintenance of the Expression Profile after PCR-Based AmplificationPBGDTNF-αCOX2Tissue factorMean amplification factor39.5628.8029.1835.08SEM14.7012.408.2412.37RNA from a lipopolysaccharide and interferon-γ-stimulated lung was diluted. Aliquots were amplified by SMART PCR (15 cycles). Four genes representative for the total mRNA pool were selected. Using real-time PCR, ratios of amplified PCR product to original cDNA were calculated. These mean amplification factors ± SEM from three independent experiments are given. Among one another, they varied markedly by less than a factor of 2. Open table in a new tab RNA from a lipopolysaccharide and interferon-γ-stimulated lung was diluted. Aliquots were amplified by SMART PCR (15 cycles). Four genes representative for the total mRNA pool were selected. Using real-time PCR, ratios of amplified PCR product to original cDNA were calculated. These mean amplification factors ± SEM from three independent experiments are given. Among one another, they varied markedly by less than a factor of 2. Microdissection of lung vessels was performed to isolate 30 to 40 vessel profiles corresponding to ∼500 cell equivalents (Figure 1). RNA was extracted, transcribed to cDNA, and applied to PCR-based amplification. In preliminary experiments undertaken for the gene that first reached the plateau phase (PBGD), we noted that amplification of more than 22 cycles did not result in a further increase of PCR product. Thus, we stopped the preamplification after cycle 19 to ascertain analytic conditions within the exponential phase of PCR. After RNA extraction of the microdissected vessels, we routinely determined the factor of amplification obtained by SMART PCR. Therefore, 2 μl of cDNA were separated from the purified cDNA (=1/22 of the original cDNA) as were 2 μl of the purified DNA (1/22 of total PCR product) after 19 PCR cycles. Both were subjected to real-time PCR. The mean threshold cycle of the original purified cDNA amounted to 33.68 ± 0.37 (mean ± SEM; n = 14). Comparing the threshold cycle after amplification to the nonamplified cDNA, an amplification factor of 882 ± 144 (mean ± SEM; n = 14) was calculated for PBGD mRNA. Real-time PCR for PBGD mRNA also allowed assessment of the full-length transcription of this mRNA and thus predicted the quality and integrity of multiplied DNA. In the used primer/probe system (Table 1) one primer was positioned in exon 1 at the start codon so that only completely transcribed mRNA is measured. First, RNA from homogenized lung tissue as well as PCR-preamplified cDNA from microdissected vessels were applied to prespotted membranes. The expression profiles were found to differ completely (Figure 2). Although the filter with vessel RNA
Referência(s)