Portal de Periódicos da CAPES

Transcriptional Activation of a Heat-shock Gene,lonD, of Myxococcus xanthus by a Two Component Histidine-Aspartate Phosphorelay System

2002; Elsevier BV; Volume: 277; Issue: 8 Linguagem: Inglês

10.1074/jbc.m110155200

1083-351X

Toshiyuki Ueki, Sumiko Inouye,

RNA and protein synthesis mechanisms

In vitrotranscription of lonD, a heat-shock gene fromMyxococcus xanthus, was stimulated in the presence of extract from heat-shocked cells. For this stimulation the upstream promoter region of lonD was found to be essential. Activation of lonD transcription was also observed when extract from non-heat-shocked cells was heat treated in vitro at 42 °C for 10 min. A DNA binding assay and footprinting analysis revealed that a factor(s) binds to the upstream region from −122 to −107 with respect to the transcription initiation site. This region was required for heat-shock induction oflonD expression both in vitro and in vivo. The lonD promoter-binding protein named HsfA was purified, and its gene was cloned. Analysis of the DNA sequence reveals that HsfA is a response regulator of the two-component system and shows high sequence similarity to the NtrC family or the enhancer-binding proteins. Upstream of hsfA, a gene encoding a histidine kinase was identified and named hsfB. HsfB was found to be autophosphorylated and able to phosphorylate HsfA. HsfA with HsfB activated in vitro transcription oflonD in a manner dependent on RNA polymerase containing SigA, the housekeeping sigma factor of M. xanthus. In vitrotranscription of lonD, a heat-shock gene fromMyxococcus xanthus, was stimulated in the presence of extract from heat-shocked cells. For this stimulation the upstream promoter region of lonD was found to be essential. Activation of lonD transcription was also observed when extract from non-heat-shocked cells was heat treated in vitro at 42 °C for 10 min. A DNA binding assay and footprinting analysis revealed that a factor(s) binds to the upstream region from −122 to −107 with respect to the transcription initiation site. This region was required for heat-shock induction oflonD expression both in vitro and in vivo. The lonD promoter-binding protein named HsfA was purified, and its gene was cloned. Analysis of the DNA sequence reveals that HsfA is a response regulator of the two-component system and shows high sequence similarity to the NtrC family or the enhancer-binding proteins. Upstream of hsfA, a gene encoding a histidine kinase was identified and named hsfB. HsfB was found to be autophosphorylated and able to phosphorylate HsfA. HsfA with HsfB activated in vitro transcription oflonD in a manner dependent on RNA polymerase containing SigA, the housekeeping sigma factor of M. xanthus. The major pathway of signal transduction required for response and adaptation to environmental changes in prokaryotes consists of the two-component His-Asp phosphorelay system (1Hoch J.A. Silhavy T.J. Two-component Signal Transduction. American Society for Microbiology, Washington, D. C.1995Crossref Google Scholar). This system basically utilizes two protein components, a sensor histidine kinase and a response regulator. Sensors typically contain a C-terminal transmitter module or a histidine kinase domain coupled to an N-terminal input domain. Response regulators typically contain an N-terminal receiver domain coupled to a C-terminal output domain. The mechanisms of transmitter-receiver communication involve phosphorylation and dephosphorylation reactions. Transmitters or histidine kinases have an autokinase activity that phosphorylates a specific histidine residue in the presence of ATP. The product phosphohistidine serves as a high energy intermediate for subsequent transfer of the phosphate group to a specific aspartate residue in the receiver domain. Response regulators become active upon receiving the phosphate group and generally function as transcription factors for cognate gene expression.Among various stress responses, the heat-shock response is the most extensively studied. Transcription of heat-shock genes is regulated in different fashions in bacteria (2Gross C.A. Neidhardt F.C. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 1382-1399Google Scholar, 3Hecker M. Schumann W. Volker U. Mol. Microbiol. 1996; 19: 417-428Crossref PubMed Scopus (493) Google Scholar, 4Narberhaus F. Mol. Microbiol. 1999; 31: 1-8Crossref PubMed Scopus (200) Google Scholar, 5Yura T. Kanemori M. Morita M.T. Storz G. Hengge-Aronis R. Bacterial Stress Responses. American Society for Microbiology, Washington, D. C.2000: 3-18Google Scholar). In Escherichia coli, RNA polymerase (RNAP) 1RNAPRNA polymeraseASammonium sulfateH-ASAS fraction prepared from heat-shocked cellsNH-ASAS fraction prepared from non-heat-shocked cellsRNAP/SigARNAP containing SigAORFopen reading frame 1RNAPRNA polymeraseASammonium sulfateH-ASAS fraction prepared from heat-shocked cellsNH-ASAS fraction prepared from non-heat-shocked cellsRNAP/SigARNAP containing SigAORFopen reading frame containing an alternative sigma factor, RpoH (ςH, ς32) recognizes promoters of most of heat-shock genes and initiates their transcription (2Gross C.A. Neidhardt F.C. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 1382-1399Google Scholar, 5Yura T. Kanemori M. Morita M.T. Storz G. Hengge-Aronis R. Bacterial Stress Responses. American Society for Microbiology, Washington, D. C.2000: 3-18Google Scholar). In addition to RpoH, RNAP containing RpoE (ςE, ς24) transcribes other heat-shock genes that are induced at higher temperature (50 °C) (2Gross C.A. Neidhardt F.C. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 1382-1399Google Scholar,5Yura T. Kanemori M. Morita M.T. Storz G. Hengge-Aronis R. Bacterial Stress Responses. American Society for Microbiology, Washington, D. C.2000: 3-18Google Scholar). Bacillus subtilis utilizes rather complex mechanisms for heat-shock response transcription. Heat-shock genes are classified into four groups (Class I–IV) (3Hecker M. Schumann W. Volker U. Mol. Microbiol. 1996; 19: 417-428Crossref PubMed Scopus (493) Google Scholar, 4Narberhaus F. Mol. Microbiol. 1999; 31: 1-8Crossref PubMed Scopus (200) Google Scholar). Class I and III genes are negatively regulated by the CIRCE element and HrcA, and in tandem repeated DNA sequences and CtsR, respectively. Class II genes are transcribed by RNAP containing an alternative sigma factor, SigB. The mechanism for transcription of Class IV genes is not known. Both RpoH-driven transcription and negative regulation by CIRCE and HrcA are found inBradyrhizobium japonicum (4Narberhaus F. Mol. Microbiol. 1999; 31: 1-8Crossref PubMed Scopus (200) Google Scholar). Furthermore, another type of negative regulation controls some heat-shock genes by ROSE, a DNA element of approximately 100 bp in length and a putative repressor (4Narberhaus F. Mol. Microbiol. 1999; 31: 1-8Crossref PubMed Scopus (200) Google Scholar).Myxococcus xanthus is a Gram-negative bacterium that can differentiate through fruiting body formation into spores upon starvation (6Dworkin M. Microbiol. Rev. 1996; 60: 70-102Crossref PubMed Google Scholar, 7Dworkin M. Kaiser D. Myxobacteria II. American Society for Microbiology, Washington, D. C.1993Google Scholar). It was found that M. xanthus contains at least eight sigma factor genes, sigA (8Inouye S. J. Bacteriol. 1990; 172: 80-85Crossref PubMed Google Scholar), sigB(9Apelian D. Inouye S. Genes Dev. 1990; 4: 1396-1403Crossref PubMed Scopus (39) Google Scholar), sigC (10Apelian D. Inouye S. J. Bacteriol. 1993; 175: 3335-3342Crossref PubMed Google Scholar), sigD (11Ueki T. Inouye S. Genes Cells. 1998; 3: 371-385Crossref PubMed Scopus (27) Google Scholar), sigE (12Ueki T. Inouye S. J. Mol. Microbiol. Biotechnol. 2001; 3: 287-293PubMed Google Scholar),rpoE1 (13Ward M.J. Lew H. Treuner-Lange A. Zusman D.R. J. Bacteriol. 1998; 180: 5668-5675Crossref PubMed Google Scholar), rpoN (14Keseler I.M. Kaiser D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1979-1984Crossref PubMed Scopus (49) Google Scholar), and carQ (15McGowan S.J. Gorham H.C. Hodgson D.A. Mol. Microbiol. 1993; 10: 713-735Crossref PubMed Scopus (64) Google Scholar). SigB, SigC, and SigE show sequence similarity to RpoH. However, they are not induced by heat-shock, and even the triple deletion of these genes does not affect production of heat-shock proteins by heat-shock (12Ueki T. Inouye S. J. Mol. Microbiol. Biotechnol. 2001; 3: 287-293PubMed Google Scholar).To understand heat-shock response transcription in M. xanthus, we first identified the lonD gene as a heat-shock gene. The lonD gene has been shown to be essential for M. xanthus fruiting body development (16Gill R.E. Karlok M. Benton D. J. Bacteriol. 1993; 175: 4538-4544Crossref PubMed Google Scholar, 17Tojo N. Inouye S. Komano T. J. Bacteriol. 1993; 175: 4545-4549Crossref PubMed Google Scholar). Using the lonD gene, we have purified a DNA-binding protein specific to the lonD promoter. This DNA-binding protein belongs to the NtrC family or enhancer-binding proteins. Subsequent analysis revealed that a histidine kinase is also involved inlonD expression.EXPERIMENTAL PROCEDURESBacterial Strains and Growth ConditionsM. xanthus DZF1 was grown in CYE liquid medium (18Campos J.M. Geisselsoder J., Jr. J. Mol. Biol. 1978; 119: 167-178Crossref PubMed Scopus (175) Google Scholar).E. coli JM83 (19Vieria J. Messing J. Gene (Amst.). 1982; 19: 259-268Crossref PubMed Scopus (3770) Google Scholar) was used as a recipient strain for transformation and grown at 37 °C in LB medium (20Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972Google Scholar) supplemented with 50 μg/ml proper antibiotics when necessary. E. coliBL21(DE3) (21Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (5987) Google Scholar) was used as a recipient strain for transformation to overexpress genes cloned in pET24b and grown at 37 °C in LB medium supplemented with 50 μg/ml kanamycin.Preparation of AS FractionsM. xanthus DZF1 cells were grown in CYE liquid medium at 30 °C. Exponentially growing cells (Klett units of 80) at 30 °C were heat-shocked at 42 °C for 10 min. Cell extracts were prepared as described by Gross et al. (22Gross C.A. Engbaek F. Flammang T. Burgess R. J. Bacteriol. 1976; 128: 382-389Crossref PubMed Google Scholar). The step (iv) extracts were diluted by 5-fold and precipitated by ammonium sulfate (40–65%). The precipitates were suspended in the buffer containing 10 mm Tris-HCl (pH 8.0), 10% glycerol, 0.1 mmEDTA, 0.1 mm dithiothreitol, protease inhibitors (Roche), and 0.1 m KCl. This extract is referred to as AS fraction.In Vitro TranscriptionTwo different templates contain the lonD promoter region from the −346 base to the +96 base (plonD346) and from −41 to +96 (plonD41) for in vitro transcription analysis. Thein vitro transcription reaction was carried out in buffer (50 mm Tris-HCl (pH 8.0), 10 mmMgCl2, 50 mm KCl, 0.1 mm EDTA, 0.1 mm dithiothreitol, 25 μg/ml bovine serum albumin, 25 μm NTPs, and 0.5 unit/μl RNase inhibitor (Roche)) containing 0.5 mg/ml plasmid DNA templates in a 40-μl total volume. The reaction buffer was first incubated at 30 °C for 10 min. Then 2 mg/ml AS fraction was added, and incubation was continued for an additional 15 min. When purified proteins were used, HsfB was first incubated in the buffer supplemented with 1 mm ATP for 2 min at 30 °C, then HsfA was added and incubated for 5 min at 30 °C; RNAP containing SigA was added, and incubation was continued for another 15 min at 30 °C. The reaction was stopped by the addition of 40 μl of stop solution (1 m ammonium acetate, 40 mm EDTA, and 0.4 mg/ml tRNA). The mixtures were extracted with phenol/chloroform/isoamyl alcohol, and transcripts were precipitated with ethanol. Transcripts were resuspended in distilled water and analyzed by primer extension analysis as described previously (11Ueki T. Inouye S. Genes Cells. 1998; 3: 371-385Crossref PubMed Scopus (27) Google Scholar).DNA Binding Assay and Footprinting AnalysisPlasmid plonD(346–42) containing the lonD promoter region from the −346 base to the −42 base was prepared for the DNA binding assay. The DNA fragments were prepared by digesting plonD(346–42) with proper enzymes and purified with 5% polyacrylamide gel. The enzymes used for each experiment are described in the text or figure legends. The DNA fragments were labeled with [α-32P]dCTP by Klenow fragment.DNA binding assays were performed in 10 μl of the reaction mixture containing 10 mm Tris-HCl (pH 8.0), 50 mm KCl, 1 mm dithiothreitol, 10 μg/ml bovine serum albumin, 10% glycerol, 1 μg of double-stranded poly(dI·dC) (Amersham Biosciences, Inc.), 1 ng of 32P-labeled DNA fragments, and 50 μg of extracts. The mixture was incubated at 30 °C for 10 min and loaded onto a 5% polyacrylamide; binding patterns were analyzed by autoradiography. Footprinting was carried out by using 1,10-phenanthroline-copper as described by Kuwabara and Sigman (23Kuwabara M.D. Sigman D.S. Biochemistry. 1987; 26: 7234-7238Crossref PubMed Scopus (200) Google Scholar).Purification of the lonD Promoter-binding Protein, HsfA, from M. xanthusM. xanthus DZF1 cells were grown exponentially (up to Klett units of ≈80) in 1 liter of CYE liquid medium at 30 °C and heat-shocked at 42 °C for 20 min. Heat-shocked cells were prepared from total 10-liter cultures. AS fraction was prepared as described above except that precipitates obtained after ammonium sulfate precipitation were suspended in TGED buffer (10 mm Tris-HCl (pH 8.0), 10% glycerol, 0.1 mm EDTA, 0.1 mmdithiothreitol, protease inhibitors (Roche)). AS fraction was applied to a DEAE-Sepharose column (Amersham Bioscience, Inc.) equilibrated with TGED buffer. HsfA was eluted with TGED buffer containing 0.1m KCl (TGED0.1K). The activity of HsfA was detected by DNA binding assay. The eluate was applied to a heparin-agarose column (Amersham Biosciences, Inc.) equilibrated with TGED0.1K. The column was washed with TGED0.1K and eluted in the stepwise manner. HsfA was eluted with TGED0.5K. The eluate was diluted with 4 volumes of TGED and subjected to the lonD promoter-specific DNA affinity column chromatography. The DNA affinity column was prepared as described previously (24Kadonaga J.T. Tjian R. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 5889-5893Crossref PubMed Scopus (715) Google Scholar). Oligonucleotides containing the HsfA recognition sequences from −128 to −105, 5′GCTAGGGGGGCGATCATGCCCCAC3′ and 5′TAGCGTGGGGCATGATCGCCCCCC3′, were used for preparation of the column. The diluted eluate was mixed with poly(dI·dC) and incubated on ice for 10 min. The mixture was applied to the DNA affinity column equilibrated with TGED0.1K. The column was washed with TGED0.1K and eluted in a stepwise manner. HsfA was eluted with TGED0.3K. The eluate was diluted with 2 volumes of TGED, mixed with poly(dI·dC), and incubated on ice for 10 min. The mixture was applied again to the DNA affinity column equilibrated with TGED0.1K. Wash and elution were performed as described above. HsfA was nearly homogeneous as judged by SDS-PAGE analysis using silver staining (see Fig. 5).The N-terminal amino acid sequence of the purified protein was determined at the synthesizing/sequencing facility of Princeton University.Purification of RNAP Containing SigAAS fraction was applied to a DEAE-Sepharose column (Amersham Biosciences, Inc.) equilibrated with TGED0.1K. The column was washed with TGED0.1K and stepwise eluted. RNAP was eluted with TGED0.3K. This eluate was diluted with 2 volumes of TGED and applied to a heparin-agarose column equilibrated with TGED0.1K. The column was washed with TGED0.1K and stepwise eluted. RNAP was eluted with TGED0.5K. The eluate was diluted with 4 volumes of TGED and applied to a DNA-cellulose column (Amersham Biosciences, Inc.). The column was washed with TGED0.1K and stepwise eluted. RNAP containing SigA was eluted with TGED0.5K.Purification of Recombinant ProteinsHsfAThe hsfA gene was cloned in pET24b (Novagen) (designated pET24bhsfA). pET24bhsfA was transformed intoE. coli BL21(DE3), and the hsfA gene was overexpressed with 1 mmisopropyl-1-thio-β-d-galactopyranoside. Cells were harvested by centrifugation, suspended in TGED0.1K, and disrupted by sonication. The lysate was cleared by centrifugation. The lysate was applied to a DEAE-Sepharose column. The rest of procedure is same as described above.HsfBThe hsfB gene was overexpressed as described above. Because HsfB was produced as inclusion bodies, the precipitates from the lysate were obtained by centrifugation. The precipitates were then resuspended in TGED0.1K containing 8m urea. The sample was dialyzed against TGED0.1K containing 4 m urea, TGED0.1K containing 2 m urea, and TGED0.1K. The sample was cleared by centrifugation. The supernatant was applied to a DEAE-Sepharose column equilibrated with TGED0.1K. After washed with TGED0.1K, the column was eluted in the stepwise manner. HsfB was eluted with TGED0.3K.The HsfB kinase domain (Met174 to Pro527) and the HsfB receiver domain (initiation Met to Gln177) were purified as described for HsfB.In Vitro PhosphorylationAn in vitro phosphorylation reaction was performed in kination buffer (25 mm Tris-HCl (pH 7.4), 10 mmMgCl2, 5 mm 2-mercaptoethanol, 0.2 μCi [γ-32P]ATP). 10 μm HsfA and 10 μm HsfB were incubated in 20 μl of the kination buffer at 30 °C. The reaction was stopped by adding 5 μl of stop solution (10% SDS, 0.4 m Tris-HCl (pH 6.8), 50% glycerol, 0.1m 2-mercaptoethanol, 0.02% bromphenol blue). The samples were subjected to 15% SDS-PAGE and analyzed by autoradiography.DISCUSSIONWe have identified a new two-component His-Asp phosphorelay system that regulates expression of a heat-shock gene, lonD, inM. xanthus. This system consists of a response regulator, HsfA, and a hybrid histidine kinase, HsfB. HsfA also belongs to the NtrC family or enhancer-binding proteins. HsfB has a rather unusual domain organization and consists of a receiver domain at the N-terminal end and a kinase domain at the C-terminal end (Fig.8).Enhancer-binding proteins activate RNAP containing RpoN by binding promoter regions that are localized in tandem at >100 bp upstream with respect to the transcription initiation site (33Morett E. Segovia L. J. Bacteriol. 1993; 175: 6067-6074Crossref PubMed Google Scholar, 34North A.K. Klose K.E. Stedman K.M. Kustu S. J. Bacteriol. 1993; 175: 4267-4273Crossref PubMed Scopus (123) Google Scholar, 35Shingler V. Mol. Microbiol. 1996; 19: 409-416Crossref PubMed Scopus (169) Google Scholar). Enhancer-binding proteins have ATPase activity that is required for transcriptional activation. A subgroup of enhancer-binding proteins including NtrC belongs to response regulators of the two-component His-Asp phosphorelay signal transduction system. Therefore, it is regulated by a cognate sensor kinase, NtrB, in the case of NtrC. Although DNA binding of NtrC can be achieved in the absence of phosphorylation, only the phosphorylated form of NtrC is able to promote transcription. Phosphorylation is necessary for ATPase activity, oligomerization, and formation of an open transcriptional complex.We have demonstrated that extracts from both non-heat-shocked cells and heat-shocked cells possess DNA binding activity to the upstream promoter region of lonD, but that only the extract from heat-shocked cells is able to activate transcription in a manner dependent on the upstream promoter region of lonD. It was also found that transcriptional activity in the extract from non-heat-shocked cells is restored by in vitro heat treatment at 42 °C before transcription reaction, suggesting that a factor(s) in the extract can sense temperature shift and activate transcription of lonD.Furthermore, we showed that HsfA is phosphorylated in vitroby HsfB and that transcription of lonD is activated in the presence of HsfA and HsfB. Although the extract prepared from non-heat-shocked cells can become transcriptionally active afterin vitro heat-shock, purified HsfB was not activated by elevated temperature (data not shown). This suggests that HsfB is not the sensor kinase directly sensing heat-shock (this will be discussed later in detail). As mentioned above, two binding sites are usually found in the upstream promoter region of genes regulated by enhancer-binding proteins, whereas only one region (−122 to −107) was identified in the lonD promoter by DNA binding assay. When this region was mutated, no DNA binding activity was observed, and transcriptional activation was abolished both in vivo andin vitro. However, footprinting analysis exhibited another protected region. The latter region may be bound by HsfA only when it and the former region exist together. It is known that the enhancer-binding proteins typically activate transcription with RNAP containing RpoN. However, we performed in vitrotranscription with the major sigma factor, SigA, because thelonD promoter regions show higher similarity to ς70 consensus sequences than ς54 (Figs.1 C and 7 B). It was found that HsfA promoted transcription of lonD in vitro with RNAP/SigA. It has been reported that Rhodobacter capsulatus NtrC activates RNAP containing RpoD or ς70, the housekeeping sigma factor (39Bowman W.C. Kranz R.G. Genes Dev. 1998; 12: 1884-1893Crossref PubMed Scopus (37) Google Scholar).Although the upstream promoter region was shown to be necessary forin vivo heat-shock induction of lonD, in vitro transcription analysis showed an increase of transcripts by H-AS without the upstream promoter region of lonD. Because the −35/−10 promoter regions are recognized by RNAP/SigA, this increase may result from stabilization and/or modification of SigA in H-AS. RNAP/SigA in H-AS may be more active for the lonDpromoter because no difference by heat-shock was observed for in vitro transcription with the vegA promoter. Furthermore, it is possible that the 5′-TG-3′ sequence element located 1 base upstream from the −10 hexamer element of the lonDpromoter (indicated by a square in Fig. 1 C) provides a motif necessary for transcription initiation as found in some promoters of E. coli (44Barne K.A. Bown J.A. Busby S.J.W. Minchin S.D. EMBO J. 1997; 16: 4034-4040Crossref PubMed Scopus (231) Google Scholar). This 5′-TG-3′ element is not found in the vegA promoter. Therefore, this element may contribute to the increase of transcripts for lonD by heat-shock in vitro in the absence of the upstream promoter region and the HsfA/HsfB system. It has been demonstrated that some ofE. coli promoters are recognized in vitro by both RNAP containing RpoD and RpoS, the stationary phase sigma factor (ςS, ς38) (45Jishage M. Ishihama A. J. Bacteriol. 1995; 177: 6832-6835Crossref PubMed Scopus (183) Google Scholar). In addition, the increase in RpoS level is observed in E. coli when cells are exposed to heat-shock (46Tanaka K. Takayanagi Y. Fujita N. Ishihama A. Takahashi H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3511-3515Crossref PubMed Scopus (190) Google Scholar). Therefore, it is possible that the M. xanthus stationary phase sigma factor, SigD (11Ueki T. Inouye S. Genes Cells. 1998; 3: 371-385Crossref PubMed Scopus (27) Google Scholar), may be increased by heat-shock, and SigD may be able to recognize the lonDpromoter in vitro, resulting in the increase of transcripts with H-AS in the absence of the upstream promoter and the HsfA/HsfB system.The His-Asp phosphorelay signal transduction system consists of two basic components, a sensor kinase and a response regulator. However, recent studies have demonstrated that three or four components (or domains) are utilized in one phosphorelay signal transduction event in which a phosphate group is transferred from histidine → aspartate → histidine → aspartate (His-Asp-His-Asp phosphorelay) (47Appleby J.L. Parkinson J.S. Bourret R.B. Cell. 1996; 86: 845-848Abstract Full Text Full Text PDF PubMed Scopus (345) Google Scholar). The first known phosphorelay was reported for regulation of initiation of sporulation in B. subtilis (48Perego M. Trends Microbiol. 1998; 6: 366-370Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). This relay begins with autophosphorylation of one of three sensor kinases, KinA, KinB, or KinC. The phosphate group is then transferred to a response regulator, Spo0F. Spo0F serves as a phosphodonor for Spo0B. Finally, the phosphate group is passed from Spo0B to Spo0A, which regulates a number of genes involved in sporulation.Hybrid kinases with transmitter domains of sensor kinases and receiver domains of response regulators are usually found in His-Asp-His-Asp phosphorelay. A receiver domain is typically fused to a transmitter domain at the C terminus in hybrid kinases, but it also can be found at the N terminus as found in M. xanthus HsfB (this study), AsgA (37Plamann L., Li, Y. Cantwell B. Mayor J. J. Bacteriol. 1995; 177: 2014-2020Crossref PubMed Google Scholar), and AsgD (38Cho K. Zusman D.R. Mol. Microbiol. 1999; 34: 268-281Crossref PubMed Scopus (51) Google Scholar). In Saccharomyces cerevisiaeosmoregulation is controlled by the Sln1p-Ypd1p-Ssk1p system (49Posas F. Wurgler-Murphy S.M. Maeda T. Witten E.A. Thai T.C. Saito H. Cell. 1996; 86: 865-875Abstract Full Text Full Text PDF PubMed Scopus (737) Google Scholar). The first two phosphorylation sites are located in the transmembrane hybrid kinase Sln1p. From Sln1p the phosphate group is transferred to Ypd1p, then to Ssk1p. Ssk1p modulates the downstream MAP kinase cascade. The BvgS-BvgA two-component system modulates regulation of virulence factors in Bordetella pertussis (50Uhl M.A. Miller J.F. EMBO J. 1996; 15: 1028-1036Crossref PubMed Scopus (187) Google Scholar). In this system the first three steps of the four-step phosphorelay occur within the single protein BvgS. This pathway represents another organizational design. Furthermore, Ralstonia solanacearum utilizes in control of expression of virulence factors the PhcS-PhcR-OrfQ system in which the second and third phosphorylation sites appear to be located in the hybrid kinase PhcR (51Clough S.J. Lee K.-E. Schell M.A. Denny T.P. J. Bacteriol. 1997; 179: 3639-3648Crossref PubMed Google Scholar). It should be noted that PhcR has the same domain organization as HsfB. With these instances, it is tempting to speculate that there may exist a presently unidentified kinase (HsfX in Fig. 8) which functions as a temperature sensor and activates HsfB by phosphorylation of the receiver domain upon heat-shock because purified HsfB is not able to be activated by temperature shift in vitro and contains a receiver domain at the N terminus. However, we cannot exclude possibility that a factor(s) other than a sensor kinase may sense heat-shock and transduce signals to HsfB. For example, in control of nitrogen assimilation by the NtrB/NtrC system, protein II or PII functions as a sensory component responsible for sensing 2-ketoglutarate whose concentration reflects changes in the nitrogen status of the cell (52Rhee S.G. Park S.C. Koo J.H. Curr. Top. Cell Regul. 1985; 27: 221-232Crossref PubMed Scopus (33) Google Scholar).The present HsfA/HsfB system is the two-component His-Asp phosphorelay signal transduction system required for activation of a heat-shock gene and is also necessary for vegetative growth. Because lonD is dispensable for vegetative growth in M. xanthus (16Gill R.E. Karlok M. Benton D. J. Bacteriol. 1993; 175: 4538-4544Crossref PubMed Google Scholar, 17Tojo N. Inouye S. Komano T. J. Bacteriol. 1993; 175: 4545-4549Crossref PubMed Google Scholar), the HsfA/HsfB system appears to regulate genes required for vegetative growth in addition to developmental genes such as lonD, an essential gene for fruiting body development (16Gill R.E. Karlok M. Benton D. J. Bacteriol. 1993; 175: 4538-4544Crossref PubMed Google Scholar, 17Tojo N. Inouye S. Komano T. J. Bacteriol. 1993; 175: 4545-4549Crossref PubMed Google Scholar). The major pathway of signal transduction required for response and adaptation to environmental changes in prokaryotes consists of the two-component His-Asp phosphorelay system (1Hoch J.A. Silhavy T.J. Two-component Signal Transduction. American Society for Microbiology, Washington, D. C.1995Crossref Google Scholar). This system basically utilizes two protein components, a sensor histidine kinase and a response regulator. Sensors typically contain a C-terminal transmitter module or a histidine kinase domain coupled to an N-terminal input domain. Response regulators typically contain an N-terminal receiver domain coupled to a C-terminal output domain. The mechanisms of transmitter-receiver communication involve phosphorylation and dephosphorylation reactions. Transmitters or histidine kinases have an autokinase activity that phosphorylates a specific histidine residue in the presence of ATP. The product phosphohistidine serves as a high energy intermediate for subsequent transfer of the phosphate group to a specific aspartate residue in the receiver domain. Response regulators become active upon receiving the phosphate group and generally function as transcription factors for cognate gene expression. Among various stress responses, the heat-shock response is the most extensively studied. Transcription of heat-shock genes is regulated in different fashions in bacteria (2Gross C.A. Neidhardt F.C. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 1382-1399Google Scholar, 3Hecker M. Schumann W. Volker U. Mol. Microbiol. 1996; 19: 417-428Crossref PubMed Scopus (493) Google Scholar, 4Narberhaus F. Mol. Microbiol. 1999; 31: 1-8Crossref PubMed Scopus (200) Google Scholar, 5Yura T. Kanemori M. Morita M.T. Storz G. Hengge-Aronis R. Bacterial Stress Responses. American Society for Microbiology, Washington, D. C.2000: 3-18Google Scholar). In Esche