Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Ikaros Directly Represses the Notch Target Gene Hes1 in a Leukemia T Cell Line

2008; Elsevier BV; Volume: 283; Issue: 16 Linguagem: Inglês

10.1074/jbc.m709643200

ISSN

1083-351X

Autores

Katie L. Kathrein, Sheila Chari, Susan Winandy,

Tópico(s)

Epigenetics and DNA Methylation

Resumo

Ikaros and Notch1, two regulators of gene transcription, are critically important at many stages of T cell development. Deregulation of Ikaros and Notch activities cooperate to promote T cell leukemogenesis, providing evidence that they function in converging pathways in developing T cells. In this report, a mechanism for Ikaros:Notch cooperativity is described, revealing a non-redundant role for Ikaros in regulating expression of the Notch target gene Hes1 in a leukemia T cell line. We provide evidence that Ikaros directly represses Hes1 in concert with the transcriptional repressor, RBP-Jκ, allowing for cross-talk between Notch and Ikaros that impacts regulation of CD4 expression. Taken together, these data describe a potential mechanism for Ikaros' function during T cell development and define Ikaros as an obligate repressor of Hes1. Ikaros and Notch1, two regulators of gene transcription, are critically important at many stages of T cell development. Deregulation of Ikaros and Notch activities cooperate to promote T cell leukemogenesis, providing evidence that they function in converging pathways in developing T cells. In this report, a mechanism for Ikaros:Notch cooperativity is described, revealing a non-redundant role for Ikaros in regulating expression of the Notch target gene Hes1 in a leukemia T cell line. We provide evidence that Ikaros directly represses Hes1 in concert with the transcriptional repressor, RBP-Jκ, allowing for cross-talk between Notch and Ikaros that impacts regulation of CD4 expression. Taken together, these data describe a potential mechanism for Ikaros' function during T cell development and define Ikaros as an obligate repressor of Hes1. Ikaros is a nuclear protein whose function is essential for normal T cell development (1Georgopoulos K. Winandy S. Avitahl N. Annu. Rev. Immunol. 1997; 15: 155-176Crossref PubMed Scopus (213) Google Scholar, 2Winandy S. Wu L. Wang J.H. Georgopoulos K. J. Exp. Med. 1999; 190: 1039-1048Crossref PubMed Scopus (135) Google Scholar, 3Urban J.A. Winandy S. J. Immunol. 2004; 173: 4470-4478Crossref PubMed Scopus (36) Google Scholar). Ikaros also functions as a tumor suppressor in the T cell lineage as evidenced by the 100% penetrance of T cell leukemogenesis observed in genetically engineered Ikaros-deficient mice (4Winandy S. Wu P. Georgopoulos K. Cell. 1995; 83: 289-299Abstract Full Text PDF PubMed Scopus (367) Google Scholar, 5Wang J.H. Nichogiannopoulou A. Wu L. Sun L. Sharpe A.H. Bigby M. Georgopoulos K. Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (512) Google Scholar, 6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). The Notch receptor is also essential for T cell development and its constitutive activation also leads to T leukemogenesis in mice (7Radtke F. Wilson A. Stark G. Bauer M. van Meerwijk J. MacDonald H.R. Aguet M. Immunity. 1999; 10: 547-558Abstract Full Text Full Text PDF PubMed Scopus (1176) Google Scholar, 8Pui J.C. Allman D. Xu L. DeRocco S. Karnell F.G. Bakkour S. Lee J.Y. Kadesch T. Hardy R.R. Aster J.C. Pear W.S. Immunity. 1999; 11: 299-308Abstract Full Text Full Text PDF PubMed Scopus (807) Google Scholar, 9Aster J.C. Pear W.S. Curr. Opin. Hematol. 2001; 8: 237-244Crossref PubMed Scopus (67) Google Scholar). Interestingly, deregulation of Ikaros and Notch pathways cooperate in leukemogenesis in both mouse and humans (10Dumortier A. Jeannet R. Kirstetter P. Kleinmann E. Sellars M. dos Santos N.R. Thibault C. Barths J. Ghysdael J. Punt J.A. Kastner P. Chan S. Mol. Cell. Biol. 2006; 26: 209-220Crossref PubMed Scopus (134) Google Scholar, 11Beverly L.J. Capobianco A.J. Cancer Cell. 2003; 3: 551-564Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 12Beverly L.J. Capobianco A.J. Trends Mol. Med. 2004; 10: 591-598Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar, 13Lopez-Nieva P. Santos J. Fernandez-Piqueras J. Carcinogenesis. 2004; 25: 1299-1304Crossref PubMed Scopus (36) Google Scholar). However, the mechanism of cooperative function of Ikaros and Notch, which likely also contributes to the normal developmental process, is unknown. The Notch receptor is a transmembrane protein that undergoes two proteolytic cleavage events upon recognition of its extracellular ligand (members of the Delta or Serrate/Jagged family) (14Schweisguth F. Curr. Biol. 2004; 14: R129-R138Abstract Full Text Full Text PDF PubMed Google Scholar). These cleavages free the intracellular domain, which travels to the nucleus. In the nucleus, intracellular Notch regulates transcription of Notch target genes through its binding to and activation of the transcriptional repressor CSL (designated RBP-Jκ/CBF-1 in mammals). Ikaros and RBP-Jκ (RBP-J) are able to bind to the same DNA sequences in electrophoretic mobility shift assays, and it has been suggested that they may compete for binding (10Dumortier A. Jeannet R. Kirstetter P. Kleinmann E. Sellars M. dos Santos N.R. Thibault C. Barths J. Ghysdael J. Punt J.A. Kastner P. Chan S. Mol. Cell. Biol. 2006; 26: 209-220Crossref PubMed Scopus (134) Google Scholar). The mammalian Notch family consists of four receptors, Notch1, -2, -3, and -4 (15Baron M. Semin. Cell Dev. Biol. 2003; 14: 113-119Crossref PubMed Scopus (276) Google Scholar). Although thymocytes express Notch1, -2, and -3 (16Felli M.P. Maroder M. Mitsiadis T.A. Campese A.F. Bellavia D. Vacca A. Mann R.S. Frati L. Lendahl U. Gulino A. Screpanti I. Int. Immunol. 1999; 11: 1017-1025Crossref PubMed Scopus (164) Google Scholar), a non-redundant essential role in T cell development has only been established for Notch1 (7Radtke F. Wilson A. Stark G. Bauer M. van Meerwijk J. MacDonald H.R. Aguet M. Immunity. 1999; 10: 547-558Abstract Full Text Full Text PDF PubMed Scopus (1176) Google Scholar). However, constitutively active forms of Notch1, Notch2, or Notch3 expressed as a transgene in mouse bone marrow can lead to T cell leukemogenesis (9Aster J.C. Pear W.S. Curr. Opin. Hematol. 2001; 8: 237-244Crossref PubMed Scopus (67) Google Scholar). This suggests that whereas Notch1 may be the critical Notch receptor for T cell development, deregulation of any Notch is sufficient to induce leukemogenesis. Leukemogenesis induced by constitutively active Notch is similar in phenotype to that induced by Ikaros deficiency, suggesting that Ikaros and Notch lie in a linear pathway during T cell development. In both cases, leukemia is specific for the T cell lineage, arises within thymocyte population, and requires pre-TCR or TCR signaling (2Winandy S. Wu L. Wang J.H. Georgopoulos K. J. Exp. Med. 1999; 190: 1039-1048Crossref PubMed Scopus (135) Google Scholar, 5Wang J.H. Nichogiannopoulou A. Wu L. Sun L. Sharpe A.H. Bigby M. Georgopoulos K. Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (512) Google Scholar, 17Zweidler-McKay P.A. Pear W.S. Semin. Cancer Biol. 2004; 14: 329-340Crossref PubMed Scopus (43) Google Scholar). Despite the importance of Notch1 in leukemogenesis and T cell development, only a handful of direct Notch target genes have been identified in developing T cells (18Reizis B. Leder P. Genes Dev. 2002; 16: 295-300Crossref PubMed Scopus (174) Google Scholar, 19Anderson A.C. Robey E.A. Huang Y.H. Curr. Opin. Genet. Dev. 2001; 11: 554-560Crossref PubMed Scopus (48) Google Scholar). One of the first described target genes for Notch-induced transcriptional activation was the gene encoding the transcriptional repressor, Hairy Enhancer of Split-1 (Hes1) (20Jarriault S. Brou C. Logeat F. Schroeter E.H. Kopan R. Israel A. Nature. 1995; 377: 355-358Crossref PubMed Scopus (1223) Google Scholar). Hes1, like Notch1, is essential for T cell development (21Tomita K. Hattori M. Nakamura E. Nakanishi S. Minato N. Kageyama R. Genes Dev. 1999; 13: 1203-1210Crossref PubMed Scopus (182) Google Scholar). Although most Hes1 gene targets that are important in regulation of T cell development are unknown, two potential targets have been defined. CD4 was the first identified target for Hes1 repressive activity in T cells (22Kim H.K. Siu G. Mol. Cell. Biol. 1998; 18: 7166-7175Crossref PubMed Scopus (78) Google Scholar, 23Allen III, R.D. Kim H.K. Sarafova S.D. Siu G. Mol. Cell. Biol. 2001; 21: 3071-3082Crossref PubMed Scopus (51) Google Scholar). The cell cycle-dependent kinase inhibitor gene p27kip1 also has been identified as a potential Hes1 target (24Murata K. Hattori M. Hirai N. Shinozuka Y. Hirata H. Kageyama R. Sakai T. Minato N. Mol. Cell. Biol. 2005; 25: 4262-4271Crossref PubMed Scopus (177) Google Scholar). Interestingly, CD4 and p27kip1 are also potential Ikaros target genes because their expression is up-regulated upon re-introduction of Ikaros into the JE131 Ikaros null T leukemia cell line (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). Because of this potential connection, we began to investigate the role of Ikaros in regulation of Hes1. In this report, we demonstrate that Ikaros is an obligate repressor of Hes1. We show that Ikaros-mediated repression is accomplished through direct binding within regulatory elements of Hes1 and provide evidence that Ikaros binds these sequences in a cooperative fashion with RBP-J. Therefore, we propose a novel mechanism of Notch target gene repression whereby RBP-J is an inefficient repressor in the absence of Ikaros. In addition, we show that the role of Ikaros in Hes1 repression contributes to the mechanism underlying Ikaros-induced expression of CD4 in JE131 cells. Cell Lines and Cell Culture—JE131 cells were derived from the thymus of an Ikaros null mouse with spontaneous T cell leukemia as previously described (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). Cells were maintained in RPMI medium (Invitrogen) supplemented with 10% bovine growth serum, 50 μm β-mercaptoethanol, and 100 units/ml of penicillin-streptomycin (RPMI complete). For inhibitor assays, equal volumes of the γ-secretase inhibitor N,N-(3,5-difluorophenacetyl)-l -alanyl-(S)-phenylglycine t-butyl ester (DAPT) 3The abbreviations used are: DAPT, N,N-(3,5-difluorophenacetyl)-l-alanyl-(S)-phenylglycine t-butyl ester; ICN, intracellular Notch1; GFP, green fluorescent protein; RT, reverse transcriptase; ChIP, chromatin immunoprecipitation; qRT-PCR, quantitative real-time PCR; IRES, internal ribosomal entry site; GSI, γ-secretase inhibitor. (Calbiochem) resuspended in Me2SO or the carrier (Me2SO) were added to cultures. Protein Preparation and Immunoblotting—Protein extracts were prepared by cell lysis with 420 mm NaCl Lysis Buffer (20 mm Tris pH 7.5, 0.1% bovine serum albumin, 1 mm EDTA, 1% Nonidet P-40) supplemented with leupeptin (4 μg/ml), aprotonin (2 μg/ml), and phenylmethylsulfonyl fluoride (5 μg/ml). Cells were lysed for 30 min on ice followed by centrifugation. 30 μg/lane of protein extracts were electrophoresed on a SDS-polyacrylamide gel and transferred to a polyvinylidene difluoride membrane overnight at 4 °C. Membranes were blocked for 1 h in Tris-buffered saline, 5% milk. Antibodies against cleaved Notch1-Val-1744 (Cell Signaling Technology) were diluted 1:500 in Tris-buffered saline, 5% bovine serum albumin and incubated with the membrane overnight at 4 °C. Blots were washed with Tris-buffered saline 3 times for 5 min and incubated with horseradish peroxidase-conjugated antibody for 1 h at room temperature. Proteins were visualized by incubation with enhanced chemiluminescence reagent and exposure to film. Retroviral Constructs—MSCV IRES H-2Kk and MSCV IRES Ik-1 H-2Kk constructs were described previously (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). Ikaros mutants were generated by site-directed PCR mutagenesis (25Horton R.M. Cai Z.L. Ho S.N. Pease L.R. BioTechniques. 1990; 8: 528-535PubMed Google Scholar). 5′ and 3′ end primers used to insert restriction enzyme sites for cloning were (5′ to 3′): 5′ extension (BglII), GCCGACCGTCAGATCTATGGACTACAAGGACGACGATGACAAG; 3′ extension (XhoI), GCTGTAGGAATTCGCTGTAGCTCGAGTTAGCTCAGGTGGTAACGATGCTCC. Mutation introducing primers: F2 DBD forward, GCCTCCTTTACCCGGAAAGGCAACCTCC; F2 DBD reverse, GGAGGTTGCCTTTCCGGGTAAAGGAGGC; F3 DBD forward, TGCCTGCCGCCAGAGGGACGCCCT; and F3 DBD reverse, AGGGCGTCCCTCTGGCGGCAGGCA. Following BglII-XhoI restriction enzyme digest of PCR products, mutant Ik-1 sequences were subcloned into MSCV IRES H-2Kk. All constructs were sequenced at the University of Chicago Cancer Research DNA Sequencing Facility. MSCV IRES Hes1 GFP was a gift of Dr. Warren Pear (University of Pennsylvania, Philadelphia, PA). Retroviral Transduction and Magnetic Cell Sorting—Retroviral plasmid constructs were transfected into Phoenix ecotropic packaging cells using Lipofectamine reagent (Invitrogen). Viral supernatants were harvested at 48 and 72 h postinfection, passed through a 0.22-μm filter, and stored at –80 °C. JE131 cells were infected using 1 ml of supernatant per 2 × 106 cells supplemented with 8 μg/ml of Polybrene in a 24-well tissue culture plate. Plates were centrifuged at 500 × g for 2 h at 32 °C. Supernatants were removed and cells were cultured with RPMI complete medium. Successfully transduced cells were sorted with the MiniMacs system (Miltenyi) using the H-2Kk expression marker as previously described (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). Purity was assessed using the MACSelect control fluorescein isothiocyanate antibody and was consistently >90%. Flow Cytometry—For flow cytometric analyses, the following antibodies were used: anti-CD4 (GK1.5, eBiosciences), anti-CD8 (53-6.7, eBiosciences), MACSelect control fluorescein isothiocyanate antibody (Miltenyi Biotech), and anti-H-2Kk (H100-27.R55, Miltenyi Biotech). Antibodies were allophycocyanin, fluorescein isothiocyanate, or phycoerythrin conjugates. For staining, cells were plated in microwell staining plates at 5 × 105 to 1 × 106 cells per well. Fluorochrome-conjugated antibodies were added to cells and incubated on ice for 15 min. Stained cells were analyzed by flow cytometry on a FACScalibur (BD Biosciences) flow cytometer using CellQuest Pro software. RT-PCR—mRNA was prepared with TRIzol reagent (Invitrogen) from H-2Kk positive retrovirally transduced JE131 cells sorted 24 h postinfection or JE131 cells treated with DAPT for 36 h. cDNA was generated using a Superscript II kit (Invitrogen). Quantitative real-time RT-PCR (qRT-PCR) was performed using a Bio-Rad iQ5 Real Time PCR machine and iQ SYBR Green Supermix (Bio-Rad). Analyses of qRT-PCR were performed using the Pfaffl method. Primers were designed using Beacon Design software and synthesized by IDT DNA Technologies. Primer sequences are available upon request. Chromatin Immunoprecipitation—Chromatin immunoprecipitation (ChIP) was performed using chromatin prepared from H-2Kk positive JE131 cells infected with MSCV IRES H-2Kk or MSCV IRES Ik-1 H-2Kk retroviruses at 24 h postinfection using the ChIP Assay Kit (Upstate). Briefly, 106 cells were used per sample. Proteins bound to DNA were cross-linked by treating cells with 1% formaldehyde for 10 min at room temperature. Cells were washed, lysed, and sonicated (Fisher Scientific Sonic Dismembrator Model 100) to shear DNA. Samples were precleared with Protein G or Protein A-agarose/salmon sperm beads (Upstate). Protein-DNA complexes were immunoprecipitated using the ChIP Assay Kit (Millipore; catalog number 17-295) and antibodies against Ikaros, RBP-J (Santa Cruz and Chemicon), anti-acetylated histone H3 (Upstate), or a control IgG (Santa Cruz). Complexes were collected with Protein G or Protein A-agarose/salmon sperm beads and washed. Protein-DNA complexes were eluted off the beads and cross-links were reversed by heating at 65 °C overnight. DNA was recovered by phenol:chloroform extraction and precipitated by ethanol. qPCR analyses were performed on immunoprecipitated DNA and normalized to total chromatin input using the Pfaffl method. Primers were used with iQ SYBR Green Supermix (Bio-Rad) and were as follows (5′ to 3′): Hes1 forward, CTGTGGGAAAGAAAGTTTGGGAAG; Hes1 reverse, GCTCCAGATCCTGTGTGATCC; upstream 1 kb forward, CTCCCTTGTCCGCCGTCTATCC; upstream 1 kb reverse, CGCTCGTTCCTCCGCCACTCTC; upstream 7 kb forward, GAGAGGCAACCACGGACTTG; upstream 7 kb reverse, ACAGGCTCCAGGCACCAC; downstream 1 kb forward, GCGTGCGTCCCCTCTCTG; downstream 1 kb reverse, GCTGAATGCCTCTCACAACCG; downstream 2.5 kb forward, GCGGCTCCCAACTCACTCC; downstream 2.5 kb reverse, ACAGACAAATGAAGGTCCCAATGC; Deltex 1 forward, TCAGCCAGATTACATCCATTAGTC; Deltex1 reverse, CAGAGAGGTTACTCAGTTTGTCC. For ChIP-Western blot, ChIP was performed with anti-Ikaros monoclonal antibodies or control IgG. Chromatin utilized was derived from 5 × 106 magnetically sorted H-2Kk positive JE131 cells infected with MSCV IRES H-2Kk or MSCV IRES Ik-1 H-2Kk retroviruses. Immunoprecipitated complexes were eluted from beads by incubation in Laemmli buffer at 95 °C for 10 min and subjected to Western blot analyses using antibodies against RBP-J (Chemicon) or Ikaros. Restoration of Ikaros Results in Down-regulation of Hes1 Expression in an Ikaros Null T Leukemia Cell Line with Activated Notch—The basic helix-loop-helix transcription factor, Hes1, has previously been shown to repress expression of the T cell differentiation marker, CD4, and the cell cycle regulator, p27kip1 (22Kim H.K. Siu G. Mol. Cell. Biol. 1998; 18: 7166-7175Crossref PubMed Scopus (78) Google Scholar, 23Allen III, R.D. Kim H.K. Sarafova S.D. Siu G. Mol. Cell. Biol. 2001; 21: 3071-3082Crossref PubMed Scopus (51) Google Scholar, 24Murata K. Hattori M. Hirai N. Shinozuka Y. Hirata H. Kageyama R. Sakai T. Minato N. Mol. Cell. Biol. 2005; 25: 4262-4271Crossref PubMed Scopus (177) Google Scholar). Interestingly, reintroduction of Ikaros to the JE131 Ikaros null T leukemia cell line has been shown to up-regulate both CD4 and p27kip1 (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). Therefore, we postulated that up-regulation of CD4 and p27kip1 in JE131 cells transduced with Ikaros may be the result of reduced expression of Hes1. This reduction would relieve Hes1-induced repression of CD4 and p27kip1. To begin to address this possibility, Hes1 expression was analyzed in JE131 cells transduced with the Ikaros isoform, Ik-1 (Ik-1) or the negative control retrovirus (Ik–). Semi-quantitative RT-PCR of cDNA prepared from JE131 cells without Ikaros revealed high levels of Hes1 expression. JE131 cells transduced with Ik-1, however, displayed a dramatic down-regulation of Hes1 expression (Fig. 1A). Notch signaling up-regulates Hes1 expression, suggesting that high Hes1 expression in JE131 cells may result from activated Notch in these cells. In support of this, it was reported that T leukemia cell lines arising from mice with greatly diminished Ikaros expression (Ik L/L mice) (10Dumortier A. Jeannet R. Kirstetter P. Kleinmann E. Sellars M. dos Santos N.R. Thibault C. Barths J. Ghysdael J. Punt J.A. Kastner P. Chan S. Mol. Cell. Biol. 2006; 26: 209-220Crossref PubMed Scopus (134) Google Scholar) constitutively express intracellular Notch (ICN), the active form of Notch. Therefore, JE131 cells were examined for the presence of ICN. Whole cell extracts from JE131 cells prepared and analyzed by Western blot with an anti-ICN specific antibody showed that ICN was constitutively generated in JE131 cells (Fig. 1B). It is important to note that although the generation of ICN in JE131 cells is likely to contribute to deregulation of Hes1 expression in JE131 cells, reintroduction of Ikaros alone is sufficient to down-regulate expression of Hes1. Treatment with γ-Secretase Inhibitor Has Minimal Effect on Proliferation of JE131 Cells—Notch signaling is required to maintain proliferation and viability of many murine and human T leukemia cell lines (26Weng A.P. Ferrando A.A. Lee W. Morris J.P. Silverman L.B. Sanchez-Irizarry C. Blacklow S.C. Look A.T. Aster J.C. Science. 2004; 306: 269-271Crossref PubMed Scopus (2304) Google Scholar, 27Pear W.S. Aster J.C. Curr. Opin. Hematol. 2004; 16: 426-433Crossref Scopus (89) Google Scholar). The presence of ICN and a high level of Hes1 expression in JE131 cells suggests that ICN may function to promote the leukemic phenotype of these cells through the constitutive activation of Notch signaling. Given these data, we next determined if generation of ICN was essential for viability and/or proliferation of JE131 cells. For these studies, the pharmacological γ-secretase inhibitor (GSI), DAPT was utilized. DAPT blocks cleavage of Notch, preventing formation of ICN and its translocation to the nucleus. Previous data have shown that addition of GSI to rapidly growing mouse leukemia cell lines that express ICN frequently results in G0/G1 arrest and apoptosis (10Dumortier A. Jeannet R. Kirstetter P. Kleinmann E. Sellars M. dos Santos N.R. Thibault C. Barths J. Ghysdael J. Punt J.A. Kastner P. Chan S. Mol. Cell. Biol. 2006; 26: 209-220Crossref PubMed Scopus (134) Google Scholar, 28O'Neil J. Calvo J. McKenna K. Krishnamoorthy V. Aster J.C. Bassing C.H. Alt F.W. Kelliher M. Look A.T. Blood. 2006; 107: 781-785Crossref PubMed Scopus (200) Google Scholar). In particular, 5 μm DAPT has been shown to be sufficient to induce cell cycle arrest and apoptosis in murine T-acute lymphoblastic leukemia cell lines with activating Notch1 mutations (28O'Neil J. Calvo J. McKenna K. Krishnamoorthy V. Aster J.C. Bassing C.H. Alt F.W. Kelliher M. Look A.T. Blood. 2006; 107: 781-785Crossref PubMed Scopus (200) Google Scholar). However, addition of 5 or 1 μm DAPT to JE131 cells had a minimal effect on their ability to proliferate (Fig. 2A). To confirm the efficiency of DAPT treatment, ICN levels were measured by Western blot analyses using protein extracts prepared after 5 days of culture. In DAPT-treated cells, a decrease in levels of ICN was observed compared with Me2SO-treated controls (Fig. 2B). Therefore, high levels of ICN are not required for viability and proliferation of JE131 cells. This is in contrast to JE131 cells transduced with Ikaros, which undergo rapid cell cycle arrest (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar), suggesting that the proliferative capacity of JE131 cells is primarily dependent upon lack of Ikaros rather than generation of ICN. Reduction of ICN Levels Leads to Reduced Expression of Hes1 and Up-regulation of the T Cell Differentiation Marker, CD4—To verify that the reduction observed in levels of ICN was sufficient to effect Notch target gene expression, Hes1 expression was analyzed. qRT-PCR was performed on cDNA generated from JE131 cells treated with DAPT or Me2SO (negative control). Treatment of JE131 cells with DAPT led to a decrease in Hes1 expression compared with that observed in cells treated with Me2SO (Fig. 2C). Therefore, the reduction in ICN levels that occurred as a result of DAPT treatment was sufficient to reduce Hes1 expression in JE131 cells, even though proliferation was unaffected. The phenotype of the JE131 cells, CD4-CD8-TCR-CD44-CD25+, places them at the DN3 stage of T cell development. Reintroduction of Ikaros in these cells induces a T cell-specific program of gene expression in which expression of T cell differentiation markers such as CD4 and CD8 are up-regulated (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). Because Hes1 has been implicated in repression of CD4 (22Kim H.K. Siu G. Mol. Cell. Biol. 1998; 18: 7166-7175Crossref PubMed Scopus (78) Google Scholar, 23Allen III, R.D. Kim H.K. Sarafova S.D. Siu G. Mol. Cell. Biol. 2001; 21: 3071-3082Crossref PubMed Scopus (51) Google Scholar) and DAPT reduces Hes1 expression levels, we hypothesized that JE131 cells grown in the presence of DAPT may up-regulate CD4 as do those transduced with Ikaros. Indeed, JE131 cells treated with DAPT up-regulate CD4 (Fig. 2D). These data suggest that inactivation of Notch signaling is sufficient to induce CD4 expression in JE131 cells, even in the absence of Ikaros. Note that this is not the case for CD8 (Fig. 2D). Forced Expression of Hes1 in the Presence of Ikaros Interferes with High Level CD4 Expression—In JE131 cells, reintroduction of Ikaros and treatment with DAPT both result in up-regulation of CD4 and down-regulation of Hes1, indicating that in Ikaros-transduced JE131 cells, CD4 up-regulation may result from repression of Hes1 by Ikaros. To test this, JE131 cells were co-transduced with Hes1 and Ikaros (Ik-1) to force continued high-level expression of Hes1 in the presence of Ikaros, where it would normally be down-regulated. In co-transduced JE131 cells, expression levels of CD4 differed from those observed in JE131 cells transduced with Ikaros alone. More specifically, co-transduction with Hes1 decreased Ikaros' ability to induce high-level expression of CD4 (Fig. 3A). These data provide evidence that up-regulation of CD4 observed in Ikaros-transduced JE131 cells is partially induced by Ikaros-driven repression of Hes1. Hes1 has been implicated as a repressor of p27kip1, and p27kip1 levels increase upon expression of Ikaros in the Ikaros null JE131 cells (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). Therefore, Ikaros-induced down-regulation of Hes1 may be the mechanism behind up-regulation of p27kip1 in Ikaros-transduced JE131 cells. To examine this possibility, expression levels of p27kip1 were analyzed in JE131 cells transduced with Ikaros and Hes1 retroviruses by semi-quantitative RT-PCR. p27kip1 expression levels were unaffected in the presence of Ikaros and Hes1 compared with Ikaros alone (Fig. 3B). Thus, Hes1 repression by Ikaros does not contribute to the up-regulation of p27kip1 in JE131 cells transduced with Ikaros. A role for Hes1 in regulating cell survival and proliferation has been documented (21Tomita K. Hattori M. Nakamura E. Nakanishi S. Minato N. Kageyama R. Genes Dev. 1999; 13: 1203-1210Crossref PubMed Scopus (182) Google Scholar, 29Tomita K. Ishibashi M. Nakahara K. Ang S.L. Nakanishi S. Guillemot F. Kageyama R. Neuron. 1996; 16: 723-734Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 30Ishibashi M. Moriyoshi K. Sasai Y. Shiota K. Nakanishi S. Kageyama R. EMBO J. 1994; 13: 1799-1805Crossref PubMed Scopus (344) Google Scholar). Therefore, we next wanted to test if down-regulation of Hes1 by Ikaros underlies the reduction in proliferative capacity observed in Ikaros-transduced JE131 cells (6Kathrein K.L. Lorenz R. Minniti Innes A. Griffiths E. Winandy S. Mol. Cell. Biol. 2005; 25: 1645-1654Crossref PubMed Scopus (53) Google Scholar). However, this was not the case because Ikaros/Hes1-expressing JE131 cells exhibited dramatically slowed growth, similar to that observed in cells transduced with Ikaros alone (Fig. 3C). Interestingly, this correlates with the inability of forced Hes1 expression to block Ikaros-induced up-regulation of p27kip1 expression (Fig. 3B). Repression of Hes1 Expression Requires Ikaros' Sequence-specific DNA Binding Ability—Two mechanisms by which Ikaros could repress Hes1 are: 1) through direct binding to Hes1 regulatory regions, or 2) through interaction with and sequestration of factors required for Hes1 expression. To begin to distinguish between these mechanisms, point mutations were introduced separately into two of Ikaros' DNA binding zinc fingers (F2 and F3) that would not disrupt zinc finger formation, but would abrogate Ikaros' ability to bind at its sequence-specific DNA binding site (31Koipally J. Heller E.J. Seavitt J.R. Georgopoulos K. J. Biol. Chem. 2002; 277: 13007-13015Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). These subtle mutations preserve Ikaros' tertiary structure and, therefore, would be highly unlikely to affect its ability to interact with other proteins (31Koipally J. Heller E.J. Seavitt J.R. Georgopoulos K. J. Biol. Chem. 2002; 277: 13007-13015Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar) (Fig. 4A). Both mutations prevented Ikaros-induced up-regulation of CD4 and CD8 in JE131 cells (Fig. 4B). Furthermore, both rendered Ikaros completely unable to repress Hes1 expression, as shown by qRT-PCR (Fig. 4C). These data indicate that down-regulation of Hes1 expression in JE131 cells transduced with Ikaros occurs through sequence-specific DNA binding of Ikaros. Hes1 Promoter Region Is Deacetylated in the Presence of Ikaros—Ikaros participates in chromatin remodeling as a component of both activating and repressing chromatin remodeling complexes. These complexes facilitate chromatin modification, thereby altering accessibility of DNA to transcription factors. Some of these complexes are associated with enzymes, histone acetyltransferases and histone deacetyltransferases, which alter chromatin formation by addition or removal of acetyl groups, respectively. Ikaros is believed to target these complexes to specific gene loci. Repression of Hes1 expression in JE131 cells transduced with Ikaros may occur though Ikaros' ability to target chromatin remodeling complexes to the Hes1 promoter. To determine the chromatin state of the Hes1 promoter, ChIP assays were performed on chromatin prepared from JE131 cells transduced with the control retrovirus (Ik–) or Ikaros (Ik-1)

Referência(s)