Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Down-regulation of WW Domain-containing Oxidoreductase Induces Tau Phosphorylation in Vitro

2004; Elsevier BV; Volume: 279; Issue: 29 Linguagem: Inglês

10.1074/jbc.m401399200

ISSN

1083-351X

Autores

Chun‐I Sze, Meng Su, Subbiah Pugazhenthi, Purevsuren Jambal, Li‐Jin Hsu, John K. Heath, Lori Schultz, Nan‐Shan Chang,

Tópico(s)

Mitochondrial Function and Pathology

Resumo

Numerous enzymes hyperphosphorylate Tau in vivo, leading to the formation of neurofibrillary tangles (NFTs) in the neurons of Alzheimer's disease (AD). Compared with age-matched normal controls, we demonstrated here that the protein levels of WW domain-containing oxidoreductase WOX1 (also known as WWOX or FOR), its Tyr33-phosphorylated form, and WOX2 were significantly down-regulated in the neurons of AD hippocampi. Remarkably knock-down of WOX1 expression by small interfering RNA in neuroblastoma SK-N-SH cells spontaneously induced Tau phosphorylation at Thr212/Thr231 and Ser515/Ser516, enhanced phosphorylation of glycogen synthase kinase 3β (GSK-3β) and ERK, and enhanced NFT formation. Also an increased binding of phospho-GSK-3β with phospho-Tau was observed in these WOX1 knock-down cells. In comparison, increased phosphorylation of Tau, GSK-3β, and ERK, as well as NFT formation, was observed in the AD hippocampi. Activation of JNK1 by anisomycin further increased Tau phosphorylation, and SP600125 (a JNK inhibitor) and PD-98059 (an MEK1/2 inhibitor) blocked Tau phosphorylation and NFT formation in these WOX1 knock-down cells. Ectopic or endogenous WOX1 colocalized with Tau, JNK1, and GSK-3β in neurons and cultured cells. 17β-Estradiol, a neuronal protective hormone, increased the binding of WOX1 and GSK-3β with Tau. Mapping analysis showed that WOX1 bound Tau via its COOH-terminal short-chain alcohol dehydrogenase/reductase domain. Together WOX1 binds Tau via its short-chain alcohol dehydrogenase/reductase domain and is likely to play a critical role in regulating Tau hyperphosphorylation and NFT formation in vivo. Numerous enzymes hyperphosphorylate Tau in vivo, leading to the formation of neurofibrillary tangles (NFTs) in the neurons of Alzheimer's disease (AD). Compared with age-matched normal controls, we demonstrated here that the protein levels of WW domain-containing oxidoreductase WOX1 (also known as WWOX or FOR), its Tyr33-phosphorylated form, and WOX2 were significantly down-regulated in the neurons of AD hippocampi. Remarkably knock-down of WOX1 expression by small interfering RNA in neuroblastoma SK-N-SH cells spontaneously induced Tau phosphorylation at Thr212/Thr231 and Ser515/Ser516, enhanced phosphorylation of glycogen synthase kinase 3β (GSK-3β) and ERK, and enhanced NFT formation. Also an increased binding of phospho-GSK-3β with phospho-Tau was observed in these WOX1 knock-down cells. In comparison, increased phosphorylation of Tau, GSK-3β, and ERK, as well as NFT formation, was observed in the AD hippocampi. Activation of JNK1 by anisomycin further increased Tau phosphorylation, and SP600125 (a JNK inhibitor) and PD-98059 (an MEK1/2 inhibitor) blocked Tau phosphorylation and NFT formation in these WOX1 knock-down cells. Ectopic or endogenous WOX1 colocalized with Tau, JNK1, and GSK-3β in neurons and cultured cells. 17β-Estradiol, a neuronal protective hormone, increased the binding of WOX1 and GSK-3β with Tau. Mapping analysis showed that WOX1 bound Tau via its COOH-terminal short-chain alcohol dehydrogenase/reductase domain. Together WOX1 binds Tau via its short-chain alcohol dehydrogenase/reductase domain and is likely to play a critical role in regulating Tau hyperphosphorylation and NFT formation in vivo. Alzheimer's disease (AD) 1The abbreviations used are: AD, Alzheimer's disease; WOX1, WW domain-containing oxidoreductase; JNK, c-Jun NH2-terminal kinase; GSK-3β, glycogen synthase kinase 3β; siRNA, small interfering RNA; NFT, neurofibrillary tangle; p-WOX1, Tyr33-phosphorylated WOX1; WOX1si, siRNA-targeting WOX1; ADH/SDR, short-chain alcohol dehydrogenase/reductase; E2, 17β-estradiol; PHF-Tau, paired helical filaments of Tau; ERK, extracellular signal-regulated kinase; cdk5, cyclin-dependent kinase 5; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; p-, phospho-; GFP, green fluorescent protein. is a neurodegenerative disorder characterized by progressive cognitive impairment. AD is associated with cortical neuronal loss with gliosis, synaptic dysfunction, and widespread senile plaques consisting of amyloid β and neurofibrillary tangles (NFTs). Substantial evidence has demonstrated that cortical neurons and glial cells undergo apoptotic cell death in AD (1Kitamura Y. Shimohama S. Kamoshima W. Matsuoka Y. Nomura Y. Taniguchi T. Biochem. Biophys. Res. Commun. 1997; 232: 418-421Crossref PubMed Scopus (154) Google Scholar, 2De La Monte S.M. Sohn Y.K. Wands J.R. J. Neurol. Sci. 1997; 152: 73-83Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar, 3Rohn T.T. Head E. Nesse W.H. Cotman C.W. Cribbs D.H. Neurobiol. Dis. 2001; 8: 1006-1016Crossref PubMed Scopus (148) Google Scholar, 4Morishima Y. Gotoh Y. Zeig J. Barret T. Takano H. Flavell R. Davis R.J. Shirasaki Y. Greenberg M.E. J. Neurosci. 2001; 21: 7551-7560Crossref PubMed Google Scholar), and activation of the apoptotic pathways may contribute to the pathogenesis of AD and other neurological diseases (5Jellinger K.A. J. Cell. Mol. Med. 2001; 5: 1-17Crossref PubMed Scopus (156) Google Scholar, 6Mattson M.P. Nat. Rev. Mol. Cell. Biol. 2000; 1: 120-129Crossref PubMed Scopus (1276) Google Scholar). WW domain-containing oxidoreductase WWOX/FOR/WOX1 is a proapoptotic protein (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 8Richards R.I. Trends Genet. 2001; 17: 339-345Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 9Chang N.-S. Int. J. Mol. Med. 2002; 9: 19-24PubMed Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 11Chang N.-S. Doherty J. Ensign A. Lewis J. Heath J. Schultz L. Chen S.T. Oppermann U. Biochem. Pharmacol. 2003; 66: 1347-1354Crossref PubMed Scopus (69) Google Scholar). The wild type WOX1 (46 kDa) possesses two NH2-terminal WW domains (containing conserved tryptophan residues), a nuclear localization sequence, and a COOH-terminal short-chain alcohol dehydrogenase/reductase (ADH/SDR) domain. The WW domain sequence is conserved. A mitochondria-targeting region has been identified in the ADH/SDR domain of WOX1, and a portion of cytosolic WOX1 is present in the mitochondria (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). During apoptosis, mitochondrial WOX1, along with cytochrome c, is released and translocated to the nucleus (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). Stress stimuli such as anisomycin and UV light stimulate WOX1 phosphorylation at Tyr33, leading to the binding of WOX1 with p53 and JNK1 (c-Jun NH2-terminal kinase) (10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Overexpressed WOX1 induces apoptosis synergistically with p53 (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). p53 apoptosis is abolished by antisense WOX1 (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar) or by a dominant negative WOX1 (10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar), indicating a functional cooperation between p53 and WOX1. Human WWOX gene, encoding the WWOX/FOR/WOX1 family proteins, has been mapped to a fragile site on chromosome 16q23.2 (for reviews, see Refs. 8Richards R.I. Trends Genet. 2001; 17: 339-345Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 9Chang N.-S. Int. J. Mol. Med. 2002; 9: 19-24PubMed Google Scholar, and 11Chang N.-S. Doherty J. Ensign A. Lewis J. Heath J. Schultz L. Chen S.T. Oppermann U. Biochem. Pharmacol. 2003; 66: 1347-1354Crossref PubMed Scopus (69) Google Scholar). Approximately 50% of loss of heterozygosity of this gene is found in breast, prostate, lung, and esophageal squamous carcinomas. Additionally at least eight aberrant mRNA transcripts have been found in cancer cells (11Chang N.-S. Doherty J. Ensign A. Lewis J. Heath J. Schultz L. Chen S.T. Oppermann U. Biochem. Pharmacol. 2003; 66: 1347-1354Crossref PubMed Scopus (69) Google Scholar). WOX1 is considered to be a candidate tumor suppressor (11Chang N.-S. Doherty J. Ensign A. Lewis J. Heath J. Schultz L. Chen S.T. Oppermann U. Biochem. Pharmacol. 2003; 66: 1347-1354Crossref PubMed Scopus (69) Google Scholar, 12Driouch K. Prydz H. Monese R. Johansen H. Lidereau R. Frengen E. Oncogene. 2002; 21: 1832-1840Crossref PubMed Scopus (92) Google Scholar, 13Bednarek A.K. Keck-Waggoner C.L. Daniel R.L. Laflin K.J. Bergsagel P.L. Kiguchi K. Brenner A.J. Aldaz C.M. Cancer Res. 2001; 61: 8068-8073PubMed Google Scholar, 14Paige A.J. Taylor K.J. Taylor C. Hillier S.G. Farrington S. Scott D. Porteous D.J. Smyth J.F. Gabra H. Watson J.E. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11417-11422Crossref PubMed Scopus (196) Google Scholar). Nonetheless the protein level of WOX1 is significantly increased in several cancers, raising the question whether WOX1 can act as a tumor suppressor (15Watanabe A. Hippo Y. Taniguchi H. Iwanari H. Yashiro M. Hirakawa K. Kodama T. Aburatani H. Cancer Res. 2003; 63: 8629-8633PubMed Google Scholar). The role of WOX1 in regulating the development and function of neural cells is largely unknown. Our recent study demonstrated that WOX1 is likely to play a role in the developing nervous system (16Chen S.T. Chuang J.I. Wang J.P. Tsai M.S. Li H. Chang N.-S. Neuroscience. 2004; 124: 831-839Crossref PubMed Scopus (52) Google Scholar). WOX1 is differentially expressed during various stages of brain development in mice. Most interestingly, high levels of WOX1 expression are observed in the neural crest-derived structures such as cranial and spinal ganglia, skin pigment cells, and mesenchyme in the head, indicating a potential role of WOX1 in promoting neuronal differentiation and maturation. Compared with cognitive normal age-matched controls, we demonstrated here that the protein levels of WOX1, its isoform WOX2 (17Ried K. Finnis M. Hobson L. Mangelsdorf M. Dayan S. Nancarrow J.K. Woollatt E. Kremmidiotis G. Gardner A. Venter D. Baker E. Richards R.I. Hum. Mol. Genet. 2000; 9: 1651-1663Crossref PubMed Scopus (246) Google Scholar), and Tyr33 phosphorylation in WOX1 (p-WOX1) (10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) were significantly down-regulated in the hippocampi of AD patients. In contrast, phosphorylation of Tau, ERK, and GSK-3β and NFT formation were significantly up-regulated in the AD hippocampi. Specifically we determined that Tau phosphorylation at Thr205/Thr212/Thr231 and Ser202/Ser422/Ser515/Ser516 was significantly increased. These phosphorylation sites are regulated by GSK-3β, cdk5, and ERK (or mitogen-activated protein kinase) (18Ferrer I. Blanco R. Carmona M. Puig B. J. Neural Transm. 2001; 108: 1397-1415Crossref PubMed Scopus (168) Google Scholar, 19Pei J.J. Braak E. Braak H. Grundke-Iqbal I. Iqbal K. Winblad B. Cowburn R.F. J. Alzheimer's Dis. 2001; 3: 41-48Crossref PubMed Scopus (156) Google Scholar, 20Zhu X. Raina A.K. Rottkamp C.A. Aliev G. Perry G. Boux H. Smith M.A. J. Neurochem. 2001; 76: 435-441Crossref PubMed Scopus (375) Google Scholar, 21Kaytor M.D. Orr H.T. Curr. Opin. Neurobiol. 2002; 12: 275-278Crossref PubMed Scopus (185) Google Scholar, 22Liu F. Iqbal K. Grundke-Iqbal I. Gong C.X. FEBS Lett. 2002; 530: 209-214Crossref PubMed Scopus (175) Google Scholar, 23Morishima-Kawashima M. Ihara Y. J. Neurosci. Res. 2002; 70: 392-401Crossref PubMed Scopus (86) Google Scholar, 24Noble W. Olm V. Takata K. Casey E. Mary O. Meyerson J. Gaynor K. LaFrancois J. Wang L. Kondo T. Davies P. Burns M. Veeranna Nixon R. Dickson D. Matsuoka Y. Ahlijanian M. Lau L.F. Duff K. Neuron. 2003; 38: 555-565Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar). In AD brains, activated GSK-3β, cdk5, JNK, p38, ERK, and other kinases are known to hyperphosphorylate Tau, leading to the formation of NFTs in degenerative neurons (18Ferrer I. Blanco R. Carmona M. Puig B. J. Neural Transm. 2001; 108: 1397-1415Crossref PubMed Scopus (168) Google Scholar, 19Pei J.J. Braak E. Braak H. Grundke-Iqbal I. Iqbal K. Winblad B. Cowburn R.F. J. Alzheimer's Dis. 2001; 3: 41-48Crossref PubMed Scopus (156) Google Scholar, 20Zhu X. Raina A.K. Rottkamp C.A. Aliev G. Perry G. Boux H. Smith M.A. J. Neurochem. 2001; 76: 435-441Crossref PubMed Scopus (375) Google Scholar, 21Kaytor M.D. Orr H.T. Curr. Opin. Neurobiol. 2002; 12: 275-278Crossref PubMed Scopus (185) Google Scholar, 22Liu F. Iqbal K. Grundke-Iqbal I. Gong C.X. FEBS Lett. 2002; 530: 209-214Crossref PubMed Scopus (175) Google Scholar, 23Morishima-Kawashima M. Ihara Y. J. Neurosci. Res. 2002; 70: 392-401Crossref PubMed Scopus (86) Google Scholar, 24Noble W. Olm V. Takata K. Casey E. Mary O. Meyerson J. Gaynor K. LaFrancois J. Wang L. Kondo T. Davies P. Burns M. Veeranna Nixon R. Dickson D. Matsuoka Y. Ahlijanian M. Lau L.F. Duff K. Neuron. 2003; 38: 555-565Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar). To examine whether down-regulation of WOX1 is essential for Tau phosphorylation in AD, we determined that suppression of WOX1 expression by small interfering RNA (siRNA) spontaneously induced phosphorylation of Tau at Thr212/Thr231 and Ser515/Ser516, phosphorylation of GSK-3β and ERK, and NFT formation in neuroblastoma SK-N-SH cells and L929 fibroblasts. Anisomycin, an activator of JNK1, also induced Tau phosphorylation at Thr212/Thr231 and Ser515/Ser516. SP600125 (a JNK inhibitor) and PD-98059 (an MEK1/2 inhibitor) blocked the Tau phosphorylation and NFT formation, indicating that JNK1 and ERK induce Tau phosphorylation and NFT formation in the WOX1 knock-down cells. To further establish the underlying mechanism, we showed that WOX1 colocalized with JNK1, GSK-3β, and Tau in the hippocampal neurons. 17β-Estradiol (E2), an estrogen, enhanced the binding of WOX1 with phosphorylated Tau. Estrogen protects neuronal cells from apoptosis (25Ba F. Pang P.K. Davidge S.T. Benishin C.G. Neurochem. Int. 2004; 44: 401-411Crossref PubMed Scopus (27) Google Scholar, 26Belcredito S. Vegeto E. Brusadelli A. Ghisletti S. Mussi P. Ciana P. Maggi A. Brain Res. Brain Res. Rev. 2001; 37: 335-342Crossref PubMed Scopus (38) Google Scholar, 27Greenfield J.P. Leung L.W. Cai D. Kaasik K. Gross R.S. Rodriguez-Boulan E. Greengard P. Xu H. J. Biol. Chem. 2002; 277: 12128-12136Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar, 28Bonnefont A.B. Munoz F.J. Inestrosa N.C. FEBS Lett. 1998; 441: 220-224Crossref PubMed Scopus (81) Google Scholar). As mapped by yeast two-hybrid analysis (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar), we determined that the ADH/SDR domain of WOX1 interacted with Tau. How WOX1 regulates Tau phosphorylation and the functional significance of WOX1 down-regulation in AD are discussed. Cell Lines and Chemicals—Cell lines used in these studies were human neuroblastoma SK-N-SH cells, murine L929 fibroblasts, and monkey kidney COS7 fibroblasts. These cells have been routinely grown in our laboratories according to the instructions of ATCC. E2 and anisomycin, an activator of JNK1 (10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar), were from Sigma. SP600125, an inhibitor of JNK1 (29Bennett B.L. Sasaki D.T. Murray B.W. O'Leary E.C. Sakata S.T. Xu W. Leisten J.C. Motiwala A. Pierce S. Satoh Y. Bhagwat S.S. Manning A.M. Anderson D.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 13681-13686Crossref PubMed Scopus (2243) Google Scholar), was from Biomol. PD-98059, an inhibitor of MEK1/2, was from Calbiochem. Antibodies—Generation of rabbit antibody against a synthetic peptide, corresponding to amino acids 89–107 of the NH2-terminal murine WOX1, was performed as described previously (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). It is a pan antibody that interacts with the wild type murine, rat, and human WOX1 and other WOX family proteins possessing an intact NH2-terminal WW domain. Antibodies were also generated against the unique COOH termini of human WOX1 (amino acids 397–414, NH2-LWALSERLIQERLGSQSG-COOH) and human WOX2 (also known as FOR1, amino acids 353–363, NH2-VSDCLVEGGHF-COOH). Additionally antibody production against a synthetic peptide, NH-CKDGWVYPYANHTEEKT-COOH (where PY is phosphotyrosine), was performed as described previously (10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Additional antibodies used were against the following: 1) human p53, JNK1, Tau, phosphorylated Tau (Ser515/Ser516), GSK-3β, and phosphorylated GSK-3β (Tyr216) (Santa Cruz Biotechnologies); 2) human PHF-Tau with Alzheimer-specific epitope of AT100 (Thr212/Ser214) (Pierce); 3) β-tubulin (used in the Sze laboratory, Roche Applied Science); 4) β-actin (used in the Pugazhenthi laboratory, Roche Applied Science); and 4) α-tubulin (used in the Chang laboratory, Accurate Chemicals). A sampler pack of antibodies against Tau was from BIOSOURCE that included a Tau pan antibody, an NFT antibody, and 11 antibodies for site-specific phosphorylation in the human Tau (Thr(P)181, Ser(P)202, Thr(P)205, Thr(P)212, Ser(P)214, Thr(P)231, Ser(P)262, Ser(P)396, Ser(P)404, Ser(P)409, and Ser(P)422). Autopsy Brain Samples—Eight frozen hippocampi of postmortem brains were from clinically and pathologically confirmed AD patients (mean age, 79 years; postmortem delay: range, 6–16 h; mean, 11 h). Control samples were eight age-matched subjects (mean age, 74 years; postmortem delay: range, 3–16 h; mean, 8 h) without evidence of clinical or brain pathology. These materials were from the Brain Bank at the Department of Pathology, University of Colorado Health Sciences Center. The diagnoses of AD were formulated based on the criteria from the Consortium to Establish a Registry for Alzheimer's Disease (30Mirra S.S. Heyman A. McKeel D. Sumi S.M. Brownlee L.M. Vogel F.S. Hughes J.P. Van Belle G. Berg L. Neurology. 1991; 41: 479-486Crossref PubMed Google Scholar). Immunohistochemistry—The above mentioned hippocampal tissues were formalin-fixed and paraffin-imbedded. The blocks were sectioned (5 μm) and mounted on plus slides. The tissues were deparaffinized and hydrated through serial ethanol solutions and finally in distilled water. The hydrated tissue sections were steamed in 10 mm sodium citrate buffer (pH 6.0) for 30 min for antigen retrieval followed by treatment with 1% hydrogen peroxide (10 min) and blocking with 5% horse serum (1 h) at room temperature. The tissue sections were incubated with aliquots of antibodies (1:200 final dilution) against WOX1, WOX2, and p-WOX1, respectively, in Tris-buffered saline (pH 7.4) at 4 °C overnight. Aliquots of biotinylated secondary antibodies were then added. Color development was performed using a labeled streptavidin biotin plus horseradish peroxidase kit (Dako). In negative controls, tissue sections were stained with aliquots of prebled rabbit sera. Where indicated, synthetic peptides (100 μm) were premixed with the above mentioned antisera (5 min at room temperature) prior to immunostaining. Immunofluorescence Microscopy—In some experiments, the hippocampal tissues were stained with antibodies against JNK1 (rabbit antibody) and/or Tau (goat antibody) followed by addition of secondary fluorescein isothiocyanate-conjugated anti-rabbit IgG and Texas Red-conjugated anti-goat IgG (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). The nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Calbiochem). The slides were examined by fluorescence microscopy as described previously (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). Where indicated, other antibodies were used in dual immunostaining. Western Blotting—A 2- or 4-mm Acu-Punch (Acuderm) was used to obtain hippocampal tissues (100–200 mg) from frozen postmortem brain slabs. The tissues had been stored at -80 °C and then warmed to -20 °C overnight prior to sampling. These samples were Dounce-extracted in the presence of a mixture of protease inhibitors (Sigma) and then centrifuged at 10,000 rpm for 10 min to remove debris as described previously (31Pugazhenthi S. Nesterova A. Sables C. Heidenreich K.A. Boxer L.M. Heasley L.E. Reusch J.E.B. J. Biol. Chem. 2000; 275: 10761-10766Abstract Full Text Full Text PDF PubMed Scopus (700) Google Scholar). The samples (50 μg/lane) were quantified by the Bradford method (Bio-Rad) and subjected to SDS-PAGE, electroblotting, and Western blotting as described previously (31Pugazhenthi S. Nesterova A. Sables C. Heidenreich K.A. Boxer L.M. Heasley L.E. Reusch J.E.B. J. Biol. Chem. 2000; 275: 10761-10766Abstract Full Text Full Text PDF PubMed Scopus (700) Google Scholar). Scanning and quantification were performed using BioRad Fluor-S™ MultiImager and Quantity One software. The extent of protein expression was expressed as relative OD as determined by comparing the density and area of an immunoreactive band in each lane with those of control lanes in the same blot. The data were assessed by Student's t test and Spearman correlation procedure. Co-immunoprecipitation—Where indicated, L929 or other cells treated with or without E2 were extracted using a cytoplasmic and nuclear extraction kit (Pierce) (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). These protein preparations (∼1 mg of protein) were quantified and co-immunoprecipitated (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) using specific antibodies against p-WOX1 or GSK-3β. Mammalian Expression Constructs—Murine GFP-WOX1 (in pEGFP-C1, Clontech) was made as described previously (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). The coding sequence of the ADH/SDR domain in WOX1, designated GFP-WOX1adh, was also constructed in pEGFP-C1. COS7 or the indicated cells were electroporated with these cDNA constructs or the "empty" pEGFP-C1 vector as controls. Protein expression was examined by fluorescence microscopy and Western blotting (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Alternatively liposome-based Fu-GENE 6 (Roche Applied Science) or GeneFector (Venn Nova) was used for transferring cDNA constructs into cells (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Cytoplasmic Yeast Two-hybrid Analysis—Ras rescue-based yeast two-hybrid analysis (CytoTrap, Stratagene) was performed as described previously (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Briefly binding of a cytosolic Sos-tagged bait protein to a cell membrane-anchored target protein (tagged with a myristoylation signal) activates the Ras signaling pathway in yeast. This activation allows mutant yeast cdc25H to grow in 37 °C using a selective agarose plate containing galactose. Without binding, yeast cells fail to grow at 37 °C. Constructs (in pSos vector) used as baits were as follows: 1) a murine full-length WOX1, 2) an NH2-terminal WW domain area of WOX1, 3) a COOH-terminal ADH/SDR domain area of WOX1, and 4) a Y33R mutant in the WW domain area (for the above constructs as baits) (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). For target, a construct for human Tau, with three repeats of a microtubule-binding domain (GenBank™ accession number BC000558), was made in pMyr vector. Additional constructs for the binding experiments were human p53 (in pMyr) and MafB (in both pMyr and pSos) (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar). siRNA-targeting WOX1—A retroviral siRNA expression construct for targeting human WOX1 was made (in pSupressorRetro) using a Gene-Suppressor construction kit from Imgenex. The synthetic primers (MWG Biotech) for making the expression construct were as follows: 1) forward, 5′-TCGAGCCAAGTCCATGCAACAGGGGAGTACTGCCCTGTTGCATGGACTTT, and 2) reverse, 5′-CTAGAAAAACCAAGTCCATGCACAGGGCAGTACTCCCCTGTTGCATGGACTTGGC. The resulting siRNA targets a sequence at the 3′ end of WOX1 mRNA. An empty vector was used as a control. Production of retrovirus and transfection to target cells were performed according to the manufacturer's instructions. A similar construct was made using a mammalian expression plasmid, pSuppressorNeo, from Imgenex. Also, a negative control vector with a scrambled sequence was from Imgenex. In addition, we selected a conserved sequence region at the WW domain of WOX1 for siRNA targeting. This sequence is identical in human, mouse, and zebrafish. Synthetic primers for making the WOX1si construct (in pSuppressorNeo) were as follows: forward, 5′-TCGAGCCAAGTCCATGCACAGGGGAGTACTGCCCTGTTGCATGGACTTGGTTTTT, and reverse, 5′-CTAGAAAAACCAAGTCCATGCACAGGGCAGTACTCCCCTGTTGCATGGACTTGGC. Where indicated, L929 and SK-N-SH cells were transfected with these constructs by electroporation. Stable transfectants were selected using G418 (300 μg/ml) during 2–3 weeks in culture (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 10Chang N.-S. Doherty J. Ensign A. J. Biol. Chem. 2003; 278: 9195-9202Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Down-regulation of WOX1, p-WOX1, and WOX2 in the Hippocampal Neurons and Extracts of AD Brains—As determined by immunohistochemistry, WOX1 is present mainly in the perinuclear areas of both healthy and degenerative neurons from an AD hippocampus (Fig. 1A). Degenerative neurons possess cytoplasmic NFTs and/or granulovacuolar degeneration (Fig. 1A). Compared with healthy neurons, these degenerative neurons have reduced levels of WOX1. Similarly dystrophic neuritic plaques, an important diagnostic feature for AD, were weakly immunoreactive to WOX1 antibodies (Fig. 1A). Compared with normal controls, down-regulation of WOX1 was observed in the hippocampal neurons in AD (Fig. 1B). The results were observed using antibodies against the unique COOH terminus of human WOX1 (Fig. 1B). The full-length WOX1 (46 kDa) is the major species found in tissues and cultured cells compared with other members of the WWOX/FOR/WOX1 protein family (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 11Chang N.-S. Doherty J. Ensign A. Lewis J. Heath J. Schultz L. Chen S.T. Oppermann U. Biochem. Pharmacol. 2003; 66: 1347-1354Crossref PubMed Scopus (69) Google Scholar). Similar results were also obtained using our previously developed antibodies against the NH2 terminus of WOX1 (7Chang N.-S. Pratt N. Heath J. Schultz L. Sleve D. Carey G.B. Zevotek N. J. Biol. Chem. 2001; 276: 3361-3370Abstract Full Text Full Text PDF

Referência(s)