Genotyping Microarray for the Detection of More Than 200 CFTR Mutations in Ethnically Diverse Populations
2005; Elsevier BV; Volume: 7; Issue: 3 Linguagem: Inglês
10.1016/s1525-1578(10)60567-3
ISSN1943-7811
AutoresIris Schrijver, Eneli Oitmaa, Andres Metspalu, Phyllis Gardner,
Tópico(s)Congenital Ear and Nasal Anomalies
ResumoCystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection. Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection. Cystic fibrosis (CF) is a severe, common autosomal recessive disease due to mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene (OMIM number *602421; http://www.ncbi.nlm.nih.gov/Omim/). Asymptomatic carrier parents, who have no physiological or biochemical outcome that enables routine identification, typically have one CFTR mutation; whereas diseased progeny carry at least two mutations, one on each CFTR gene allele. CF has a high incidence in people of Northern European descent, occurring in approximately 1 in 2500 live births. Because of this, the American College of Medical Genetics and the American College of Obstetricians and Gynecologists (ACMG and ACOG) recently called for CF mutation carrier screening for expecting couples and for those contemplating pregnancy in high-risk groups (Northern European and Ashkenazi Jewish populations) as well as for proper counseling about diagnostic availability and limitations of screening in other groups with lower disease risk.1Grody WW Cutting GR Klinger KW Richards CS Watson MS Desnick RJ Subcommittee on Cystic Fibrosis Screening Accreditation of Genetic Services Committee ACMG American College of Medical Genetics Laboratory standards and guidelines for population-based cystic fibrosis carrier screening.Genet Med. 2001; 3: 149-154Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar By use of the inclusion criterion of mutations having a threshold of 0.1% frequency in the general U.S. population, a routine screening panel of 25 mutations was initially selected from the more than 1300 currently described CFTR sequence variants (http://www.genet.sickkids.on.ca/cftr/). This recommended panel was recently modified and currently includes 23 mutations.2Watson MS Cutting GR Desnick RJ Driscoll DA Klinger K Mennuti M Palomaki GE Popovich BW Pratt VM Rohlfs EM Strom CM Richards CS Witt DR Grody WW Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel.Genet Med. 2004; 6: 387-391Crossref PubMed Scopus (355) Google Scholar The selected panel chiefly reflects the mutations prevalent in the high-risk populations of Northern European and Askenazi Jewish descent. Mutations that are prevalent in other races and ethnicities are mostly not included in the routine CF 25 mutation panel because they do not reach inclusion criteria for the general population threshold. Although development of commercial versions of the recommended screening panel (usually augmented by one to six mutations) has led to on-site CFTR mutation carrier screening, there are serious limitations of the currently available tests for widespread use, chiefly the detection rate, which depends on ethnicity. The risk of CF mutation carrier status varies by ethnicity, with the highest risk in people of Northern European ancestry at 1 in 25 and in people of Ashkenazi Jewish descent at 1 in 29.1Grody WW Cutting GR Klinger KW Richards CS Watson MS Desnick RJ Subcommittee on Cystic Fibrosis Screening Accreditation of Genetic Services Committee ACMG American College of Medical Genetics Laboratory standards and guidelines for population-based cystic fibrosis carrier screening.Genet Med. 2001; 3: 149-154Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar, 2Watson MS Cutting GR Desnick RJ Driscoll DA Klinger K Mennuti M Palomaki GE Popovich BW Pratt VM Rohlfs EM Strom CM Richards CS Witt DR Grody WW Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel.Genet Med. 2004; 6: 387-391Crossref PubMed Scopus (355) Google Scholar Other populations have discernible risk, however, including Hispanic Americans (1 in 46), African Americans (1 in 65), and Asian Americans (∼1 in 90). The latter three estimates may be lower than the actual risk in these ethnicities because of ascertainment bias due to the misperception that CF is a "Caucasian disease." In addition, some ethnic groups (eg, Asians) have not, as yet, been studied at the molecular level as thoroughly as the Caucasian populations. Thus, whereas the current on-site tests can achieve a detection rate of 90% in Northern European Caucasians with CFTR carrier status, the ability to detect CF mutation carrier status in other populations falls off considerably, with the estimated detection rates of 69% in African Americans and 57% in Hispanic CF carriers.1Grody WW Cutting GR Klinger KW Richards CS Watson MS Desnick RJ Subcommittee on Cystic Fibrosis Screening Accreditation of Genetic Services Committee ACMG American College of Medical Genetics Laboratory standards and guidelines for population-based cystic fibrosis carrier screening.Genet Med. 2001; 3: 149-154Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar Currently, if the on-site carrier screening with the recommended panel of CFTR mutations is negative and if there is a family history or anxiety is high, DNA samples may be sent to reference laboratories for more comprehensive analysis that involves significantly higher costs. For non-Caucasians, carrier screening by a larger commercial panel is often preferentially chosen by counselors over the ACMG/ACOG recommended panel because of detection limitations. For diagnostic purposes in suspected CF patients, a carrier screening panel is sometimes used; but in those instances, second tier testing is frequently necessary. This second tier of more comprehensive testing generally involves either larger mutation panels or scanning methodologies, such as differential gradient gel electrophoresis, denaturing high-performance liquid chromatography, temporal temperature gradient gel electrophoresis, or single-strand conformation analysis, followed by direct DNA sequencing to characterize the mutations identified by scanning techniques.3Girondon-Boulandet E Cazeneuve C Goossens M Screening practices for mutations in the CFTR gene ABCC7.Hum Mutat. 2000; 15: 135-149Crossref PubMed Scopus (36) Google Scholar The gold standard of direct DNA gene sequencing is currently too costly for routine diagnostic use. In light of the ethnic diversity of the U.S. population and the frequency of ethnically mixed marriages (http://www.census.gov/), we believe that a significantly expanded CF mutation panel, suitable for on-site use, would be beneficial as an option for routine CF mutation carrier screening. This may especially be desirable in non-Caucasians and individuals of mixed ethnicity. We describe a molecular diagnostic assay, using a new use of the arrayed primer extension (APEX) technology4Kurg A Tonisson N Georgiou I Shumaker J Tollett J Metspalu A Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology.Genet Test. 2000; 4: 1-7Crossref PubMed Scopus (171) Google Scholar able to detect 204 different CFTR mutations that include a large number of mutations detected in non-Caucasians as well as those that are frequent in the Caucasian population and in the U.S. population as a whole. The assay is based on single-primer nucleotide extension, first described by Shumaker et al5Shumaker JM Metspalu A Caskey CT Mutation detection by solid phase primer extension.Hum Mutat. 1996; 7: 346-354Crossref PubMed Scopus (140) Google Scholar in 1996 and subsequently converted to an array format.4Kurg A Tonisson N Georgiou I Shumaker J Tollett J Metspalu A Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology.Genet Test. 2000; 4: 1-7Crossref PubMed Scopus (171) Google Scholar It is a methodology that enables accurate mutation detection in a microarray format. Our CF APEX microarray described herein is suitable for carrier screening as well as molecular diagnosis of affected individuals. The 204 mutations on the APEX microarray were selected from the CF Genetic Analysis Consortium (1994) (http://www.genet.sickkids.on.ca) and the literature,6Highsmith WE Burch LH Zhou Z Olsen JC Boat TE Spock A Gorvoy JD Quittel L Friedman KJ Silverman LM et al.A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations.N Engl J Med. 1994; 331: 974-980Crossref PubMed Scopus (348) Google Scholar, 7Wong LJ Wang J Zhang YH Hsu E Heim RA Bowman CM Woo MS Improved detection of CFTR mutations in Southern California Hispanic CF patients.Hum Mutat. 2001; 18: 296-307Crossref PubMed Scopus (40) Google Scholar, 8Mercier B Raguenes O Estivill X Morral N Kaplan GC McClure M Grebe TA Kessler D Pignatti PF Marigo C et al.Complete detection of mutations in cystic fibrosis patients of Native American origin.Hum Genet. 1994; 94: 629-632Crossref PubMed Scopus (35) Google Scholar, 9Zielenski J Rozmahel R Bozon D Kerem B Grzelczak Z Riordan JR Rommens J Tsui LC Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.Genomics. 1991; 10: 214-228Crossref PubMed Scopus (495) Google Scholar representing the most frequently screened mutations in Caucasians and those identified as recurring in specific Caucasian and non-Caucasian populations. The full set of mutations is listed in Table 1. The sequence numbering in this manuscript is according to the CFTR GenBank reference sequence NM_000492 (http://www.ncbi.nlm.nih.gov/GenBank/).9Zielenski J Rozmahel R Bozon D Kerem B Grzelczak Z Riordan JR Rommens J Tsui LC Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.Genomics. 1991; 10: 214-228Crossref PubMed Scopus (495) Google ScholarTable 1Complete List of Mutations Detectable with the CF APEX AssayCFTR locationAmino acid changeNucleotide change1E 1Frameshift175delC2E 2,3Frameshiftdel E2, E33E 2W19C189 G>T4E 2Q39X247 C>T5IVS 2Possible splicing defect296 + 12 T>C6E 3Frameshift359insT7E 3Frameshift394delTT8E 3W57X (TAG)302G>A9E 3W57X (TGA)303G>A10E 3E60X310G>T11E 3P67L332C>T12E 3R74Q353G>A13E 3R75X355C>T14E 3G85E386G>A15E 3G91R403G>A16IVS 3Splicing defect405 + 1G>A17IVS 3Possible splicing defect405 + 3A>C18IVS 3Splicing defect406 − 1G>A19E 4E92X406G>T20E 4E92K406G>A21E 4Q98R425A>G22E 4Q98P425A>C23E 4Frameshift444delA24E 4Frameshift457TAT>G25E 4R117C481C>T26E 4R117H482G>A27E 4R117P482G>C28E 4R117L482G>T29E 4Y122X498T>A30E 4Frameshift574delA31E 4I148T575T>C32E 4Splicing defect621G>A33IVS 4Splicing defect621 + 1G>T34IVS 4Splicing defect621 + 3A>G35E 5Frameshift624delT36E 5Frameshift663delT37E 5G178R664G>A38E 5Q179K667C>A39IVS 5Splicing defect711 + 1G>T40IVS 5Splicing defect711 + 1G>A41IVS 5Splicing defect712 − 1G>T42E 6aH199Y727C>T43E 6aP205S745C>T44E 6aL206W749T>G45E 6aQ220X790C>T46E 6bFrameshift935delA47E 6bFrameshift936delTA48E 6bN287Y991A>T49IVS 6bSplicing defect1002 − 3T>G50E 7ΔF3113-bp del between nucleotides 1059 and 106951E 7Frameshift1078delT52E 7Frameshift1119delA53E 7G330X1120G>T54E 7R334W1132C>T55E 7I336K1139T>A56E 7T338I1145C>T57E 7Frameshift1154insTC58E 7Frameshift1161delC59E 7L346P1169T>C60E 7R347H1172G>A61E 7R347P1172G>C62E 7R347L1172G>T63E 7R352Q1187G>A64E 7Q359K/T360K1207C>A and 1211C>A65E 7S364P1222T>C66E 8Frameshift1259insA67E 8W401X (TAG)1334G>A68E 8W401X (TGA)1335G>A69IVS 8Splicing changes1342 − 6 poly(T) variants 5T/7T/9T70IVS 8Splicing defect1342 − 2A>C71E 9A455E1496C>A72E 9Frameshift1504delG73E 10G480C1570G>T74E 10Q493X1609C>T75E 10Frameshift1609delCA76E 10ΔI5073-bp del between nucleotides 1648 and 165377E 10ΔF5083-bp del between nucleotides 1652 and 165578E 10Frameshift1677delTA79E 10V520F1690G>T80E 10C524X1704C>A81IVS 10Possible splicing defect1717 − 8G>A82IVS 10Splicing defect1717 − 1G>A83E 11G542X1756G>T84E 11G551D1784G>A85E 11Frameshift1784delG86E 11S549R (A>C)1777A>C87E 11S549I1778G>T88E 11S549N1778G>A89E 11S549R (T>G)1779T>G90E 11Q552X1786C>T91E 11R553X1789C>T92E 11R553G1789C>G93E 11R553Q1790G>A94E 11L558S1805T>C95E 11A559T1807G>A96E 11R560T1811G>C97E 11R560K1811G>A98IVS 11Splicing defect1811 + 1.6 kb A>G99IVS 11Splicing defect1812 − 1G>A100E 12Y563D1819T>G101E 12Y563N1819T>A102E 12Frameshift1833delT103E 12D572N1846G>A104E 12P574H1853C>A105E 12T582R1877C>G106E 12E585X1885G>T107IVS 12Splicing defect1898 + 5G>T108IVS 12Splicing defect1898 + 1G>A109IVS 12Splicing defect1898 + 1G>C110IVS 12Splicing defect1898 + 1G>T111E 13Frameshift1924del7112E 13del of 28 amino acids1949del84113E 13I618T1985T>C114E 13Frameshift2183AA>G115E 13Frameshift2043delG116E 13Frameshift2055del9>A117E 13D648V2075T>A118E 13Frameshift2105–2117 del13insAGAA119E 13Frameshift2108delA120E 13R668C2134C>T121E 13Frameshift2143delT122E 13Frameshift2176insC123E 13Frameshift2184delA124E 13Frameshift2184insA125E 13Q685X2185C>T126E 13R709X2257C>T127E 13K710X2260A>T128E 13Frameshift2307insA129E 13V754M2392G>A130E 13R764X2422C>T131E 14aW846X2670G>A132E 14aFrameshift2734delGinsAT133E 14bFrameshift2766del8134IVS 14bSplicing defect2789 + 5G>A135IVS 14bSplicing defect2790 − 2A>G136E 15Q890X2800C>T137E 15Frameshift2869insG138E 15S945L2966C>T139E 15Frameshift2991del32140E 16Splicing defect3120G>A141IVS 16Splicing defect3120 + 1G>A142IVS 16Splicing defect3121 − 2A>G143IVS 16Splicing defect3121 − 2A>T144E 17aFrameshift3132delTG145E 17aI1005R3146T>G146E 17aFrameshift3171delC147E 17aFrameshift3171insC148E 17adel V1022 and I10233199del6149E 17aSplicing defect3271delGG150IVS 17aPossible splicing defect3272 − 26A>G151E 17bG1061R3313G>C152E 17bR1066C3328C>T153E 17bR1066S3328C>A154E 17bR1066H3329G>A155E 17bR1066L3329G>T156E 17bG1069R3337G>A157E 17bR1070Q3341G>A158E 17bR1070P3341G>C159E 17bL1077P3362T>C160E 17bW1089X3398G>A161E 17bY1092X (TAA)3408C>A162E 17bY1092X (TAG)3408C>G163E 17bL1093P3410T>C164E 17bW1098R3424T>C165E 17bQ1100P3431A>C166E 17bM1101K3434T>A167E 17bM1101R3434T>G168IVS 17b3500 − 2A>T3500 − 2A>T169IVS 17bSplicing defect3500 − 2A>G170E 18D1152H3586G>C171E 19R1158X3604C>T172E 19R1162X3616C>T173E 19Frameshift3659delC174E 19S1196X3719C>G175E 19S1196T3719T>C176E 19Frameshift and K1200E3732delA and 3730A>G177E 19Frameshift3791delC178E 19Frameshift3821delT179E 19S1235R3837T>G180E 19Q1238X3844C>T181IVS 19Possible splicing defect3849 + 4A>G182IVS 19Splicing defect3849 + 10 kb C>T183IVS 19Splicing defect3850 − 1G>A184E 20G1244E3863G>A185E 20G1244V3863G>T186E 20Frameshift3876delA187E 20G1249E3878G>A188E 20S1251N3884G>A189E 20T1252P3886A>C190E 20S1255X3896C>A and 3739A>G in E19191E 20S1255L3896C>T192E 20Frameshift3905insT193E 20D1270N3940G>A194E 20W1282R3976T>C195E 20W1282X3978G>A196E 20W1282C3978G>T197E 20R1283M3980G>T198E 20R1283K3980G>A199IVS 20Splicing defect4005 + 1G>A200E 21Frameshift4010del4201E 21Frameshift4016insT202E 22Inframe del E21del E21203E 21N1303K4041C>G204E 24Frameshift4382delA Open table in a new tab Oligonucleotide primers were designed according to the wild-type CFTR gene sequence for both the sense and antisense directions. The 25-bp oligonucleotides with 6-carbon amino linkers at their 5′ end were obtained from MWG (Munich, Germany). Most scanning oligonucleotides were designed to scan 1 bp in the wild-type sequence, except in the case of deletions and insertions that have the same nucleotide in the 1-bp direction. In this case, we designed the oligo to extend further into the deletion or insertion to enable discrimination of the nucleotide change. For example: 5′-AGCCTGGCACCATTAAAGAAAATATCAT-3′ ΔF508 S; 5′-TTTCCTGGATTAT-GCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTT-TCCTATGATGAATATAGATACAGA-3′; ΔF508 AS 3′-AA-CCACAAAGGATACTACTTATATC-5′ in which A repre-sents a deliberate mismatch to avoid strong secondary structure and CTT represents a deletion of three nucleotides. In case of the normal allele, we expect signals for the sense oligo in the cytosine (C) channel and for the antisense oligo in the adenine (A) channel (C/A). In case of the mutant allele, we will detect signals for the sense oligo in the thymine (T) channel. The signal corresponding to the antisense oligo will also appear in the T channel (T/T). The microarray slides used for spotting the oligonu-cleotides have a dimension of 24 × 60 mm and are coated with 3-aminopropyl-trimethoxysilane plus 1,4-phenylenedi-isothiocyanate (Asper Biotech, Ltd., Tartu, Estonia). Primers were diluted to 50 μmol/L in 100 mmol/L carbonate buffer, pH 9.0, and spotted onto the activated surface with BioRad VersArray (BioRad Laboratories, Hercules, CA). The slides were blocked with 1% ammonia solution and stored at 4°C until needed. Washing steps with 95°C distilled water (TKA, Toshvin Analytical, Germany) and 100 mmol/L NaOH were performed before the APEX reactions to reduce the background fluorescence and to avoid rehybridization of unbound oligonucleotides to the APEX slide. Each selected CFTR sequence variant is identified by two unique 25-mer oligonucleotides, one for the sense and one for the antisense strand, although for some mutations, three oligonucleotides are used. On the other hand, fewer than expected oligonucleotides are used in some cases. For example, when different nucleotide substitutions (with a maximum of three) occur at the same nucleotide position, the accurate sequence can be determined using the same pair of detection oligos (sense and antisense). The APEX primers for mutations 3121-2A>G and 3121-2A>T, as an example, are the same, where A represents the location of the mutation under interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A→G,T S; 5′-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3′; CAACAA-TAATTAACACTAACCTCGA 3121-2A→G,T AS. These variables result in a total of 379 oligonucleotides annealed to the microarray slide. Where possible, native genomic DNA was collected. Thus, 51 patient or cell line samples with known mutations were evaluated on the chip (Table 2). The presence of mutations in commercially available samples (Coriell Cell repositories; http://locus.umdnj.edu/ccr/) was verified in the Molecular Pathology laboratory at Stanford Hospitals and Clinics. Additional samples were obtained from the Molecular Diagnostics Centre of United Laboratories at Tartu University Clinics. Some DNA samples were a generous gift from Dr. Milan Macek, Jr., at Charles University. This set of samples was anonymized. When it was not readily possible to obtain native genomic DNA samples containing the screened mutations, synthetic approximately 50-bp templates were designed according to the mutated CFTR sequence for both the sense and antisense directions and optimized for melting temperature (MWG). In this case, poly(T) tracts were designed at the 5′ end to minimize the possibility of the self-extensions and/or self-annealing of the synthetic templates.Table 2Genomic DNA Samples Used for Mutation Evaluation on the APEX ArrayMutations validated with native DNACFTRdel 2,3 (21 kb)394delTTG85ER75X574delAY122XR117CR117H621 + 1G>T621 + 3A>G711 + 1G>TI336KR334WR347PIVS8-5TIVS8-7TIVS8-9TA455EΔF508ΔI5071677delTA1717 − 1G>AG542XG551DR553XR560TS549N1898 + 1G>A1898 + 1G>C2183AA>G2043delGR668C2143delT2184delA2184insA2789 + 5G>AS945L3120 + 1G>AI1005R3272 − 26A>GR1066CG1069RY1092X (C>A)3500 − 2A>TR1158XR1162X3659delCS1235R3849 + 10 kb C>TW1282X Open table in a new tab The CFTR gene was amplified from genomic DNA in 30 amplicons. The PCR reaction mixture (50 μl) was optimized with the following: 10× TaqDNA polymerase buffer; 2.5 mmol/L MgCl2 (Naxo, Estonia); 0.25 mmol/L dNTP (MBI Fermentas, Vilnius, Lithuania) (20% fraction of dTTP was substituted with dUTP); and 10 pmol of primer stock, genomic DNA (approximately 80 ng), SMART-Taq Hot DNA polymerase (3 U) (Naxo, Estonia), and sterile deionized water. After amplification (MJ Research DNA Thermal Cycler; MJ Research, Inc., Waltham, MA), the amplification products were concentrated and purified using Jetquick spin columns (Genomed GmbH, Lohne, Germany). In a one-step reaction, the functional inactivation of the traces of unincorporated dNTPs was achieved by addition of shrimp alkaline phosphatase (Amersham Pharmacia Biotech, Inc., Milwaukee, WI), and fragmentation of the PCR product was achieved by the addition of thermolabile uracil N-glycosylase (Epicenter Technologies, Madison, WI) followed by heat treatment.4Kurg A Tonisson N Georgiou I Shumaker J Tollett J Metspalu A Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology.Genet Test. 2000; 4: 1-7Crossref PubMed Scopus (171) Google Scholar The APEX mixture consisted of 32 μl of fragmented product, 5 U of Thermo Sequenase DNA polymerase (Amersham Pharmacia Biotech), 4 μl of Thermo Sequenase reaction buffer (260 mmol/L Tris-HCl, pH 9.5, and 65 mmol/L MgCl2) (Amersham Pharmacia Biotech) and 1 μmol/L final concentration of each fluorescently labeled ddNTPs: Cy5-ddUTP, Cy3-ddCTP, Texas Red-ddATP, Fluorescein-ddGTP, (PerkinElmer Life Sciences, Wellesley, MA). The DNA was first denatured at 95°C for 10 minutes. The enzyme and the dyes were immediately added to the DNA mixture, and the whole mixture was applied to prewarmed slides (58°C). The reaction was allowed to proceed for 10 minutes at 58°C, followed by washing once with 0.3% Alconox (Alconox, Inc.) and twice for 90 seconds at 95°C with distilled water (TKA, Germany). A droplet of antibleaching reagent (AntiFade SlowFade; Molecular Probes Europe BV, Leiden, The Netherlands) was applied to the slides before imaging. This process is depicted schematically in Figure 1. During assay development, a few of the oligonucleotides designed from the wild-type CFTR sequence failed to perform the APEX reaction. The chief reason for APEX primer failure is the formation of self-annealing secondary structures that fail to hybridize or facilitate self-priming and extension. To obviate this problem, we designed new versions of such primers by incorporating a mismatch or a modified nucleotide at the 5′ or internal part of the primer. Such changes can reduce primer self-complementarity without compromising hybridization and primer extension. In the case of secondary structures at the 3′ end, which is essential for template annealing and extension, some alternative versions with internal base substitutions can be attempted, but not all work. After our final design of the APEX primers, 184 sequence variants (out of 204 variants at 181 sites) were detected in both of the sense and antisense directions, 7 from only the sense strand (the antisense strand does not work reliably), and 13 from only the antisense strand (the sense strand does not work reliably). The APEX array had four points of data analysis: both the forward and reverse primers are spotted in duplicate. This vastly reduced the possibility of false-positive signal interpretation due to dust particles or other nonspecific reactions and allowed distinction between homo- and heterozygosity. The array images were captured by means of detector Genorama QuattroImager 003 (Asper Biotech) at 20-μm resolution. The device combines a total internal reflection fluorescence-based excitation mechanism with a charge-coupled device camera.4Kurg A Tonisson N Georgiou I Shumaker J Tollett J Metspalu A Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology.Genet Test. 2000; 4: 1-7Crossref PubMed Scopus (171) Google Scholar Sequence variants were identified using Genorama 3.0 genotyping software. We selected 204 CFTR sequence variants for a comprehensive diagnostic panel to increase CF carrier and disease detection across all racial and ethnic groups (Table 1). Sequence variants selected were obtained from the CF Genetic Analysis Consortium (1994) that compiled information from the screening of 43,849 chromosomes and from studies of relatively small-size samples or those isolated to specific ethnic populations (http://www.genet.sickkids.on.ca/cgi-bin/WebObjects/MUTATION). The population frequencies of the included mutations vary considerably according to ethnicity and number of samples screened, but they represent the most common reported mutations across population groups to date. Mutations include several prominent in non-Caucasian backgrounds, including N1303K, 3849 + 10 kb, 2789 + 5G>A, 3876delA, 406-1G>A, R75X, 2055delG>A, and S549N, which are each prevalent in the Hispanic population (personal observation);7Wong LJ Wang J Zhang YH Hsu E Heim RA Bowman CM Woo MS Improved detection of CFTR mutations in Southern California Hispanic CF patients.Hum Mutat. 2001; 18: 296-307Crossref PubMed Scopus (40) Google Scholar, 10Wong LJ Wang J Woo M Hsu E Bowman CM A novel mutation detected by temporal temperature gradient gel electrophoresis led to the confirmative prenatal diagnosis of a Hispanic CF family.Prenat Diagn. 2000; 20: 807-810Crossref PubMed Scopus (10) Google Scholar, 11Wang J Bowman MC Hsu E Wertz K Wong LJ A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients.J Med Genet. 2000; 37: 215-218Crossref PubMed Scopus (12) Google Scholar, 12Wang J Bowman CM Wong LJ A novel CFTR frame-shift mutation, 935delA, in two Hispanic cystic fibrosis patients.Mol Genet Metab. 2000; 70: 316-321Crossref PubMed Scopus (10) Google Scholar, 13Orozco L Velazquez R Zielenski J Tsui LC Chavez M Lezana JL Saldana Y Hernandez E Carnevale A Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 297–1G→A).Hum Genet. 2000; 106: 360-365Crossref PubMed Scopus (35) Google Scholar 3120 + 1G>A, which is prevalent in the African-American population; and 1898 + 5G>T, which is prevalent in the Chinese population (http://www.genet.sickkids.on.ca/cftr/). The mutations originate from 26 exons (exons 1 to 22, including exons 6a and 6b, 14a and 14b, and 17a and 17b, and exon 24) and from 15 introns (2, 3, 4, 5, 6b, 8, 10, 11, 12, 14b, 16, 17a, 17b, 19, and 20). They include single-nucleotide substitutions, technically the most easy to detect with the APEX reaction, as well as insertions, deletions, including the large 21-kb deletion, which removes exons 2 and 3, and even repeats, such as the 5T/7T/9T repeats important in congenital bilateral absence of the vas deferens (CBAVD). Sample DNA is amplified in 30 amplicons with 29 pairs of PCR primers (Table 3) encompassing the mutations, with PCR mixtures that include 20% substitution of dUTPs for dTTPs, allowing for later fragmentation with uracil N-glycosylase as described previously.4Kurg A Tonisson N Georgiou I Shumaker J Tollett J Metspalu A Arrayed primer extension: solid-phase four-color DNA resequencing and mutation detection technology.Genet Test. 2000; 4: 1-7Crossref PubMed Scopus (171) Google ScholarTable 3PCR Primers Used for Amplification of the Coding Sequence and Splice Sites in the CFTR GenePrimer nameSequence 5′ → 3′Reference no.1 FTCTTTGGCATTAGGAGCTTG1 RCAAACCCAACCCATACACACIVS 1 FGTTGTAAATCCTGGACCTGCAGAAGIVS 1 RCCCTCCTCTGATTCCACAAGGTAT2 FTCCATATGCCAGAAAAGTTG2 RACAAGCATGCACTACCATTC3 FCTTGGGTTAATCTCCTTGGAT3 RCACCTATTCACCAGATTTCGIVS 3 FCCTTAGCAATTTGTATGAGCCCAAIVS 3 RCCATCATAGGATACAATGAATGCTGG4 FCCACTGTTGCTATAACAAATCCCAA4 RTTCAGCATTTATCCCTTACTTGTACC5 FATTTCTGCCTAGATGCTGGG9Zielenski J Rozmahel R Bozon D Kerem B Grzelczak Z Riordan JR Rommens J Tsui LC Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.Genomics. 1991; 10: 214-228Crossref PubMed Scopus (495) Google Scholar5 RAACTCCGCCTTTCCAGTTGT9Zielenski J Rozmahel R Bozon D Kerem B Grzelczak Z Riordan JR Rommens J Tsui LC Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.Genomics. 1991; 10: 214-228Crossref PubMed Scopus (495) Google Scholar6a FGCTCAGAACCACGAAGTGTT6a RCATCATCATTCTCCCTAGCC6b FGGCACATAGGAGGCATT
Referência(s)