STAT3 Activation Regulates Growth, Inflammation, and Vascularization in a Mouse Model of Gastric Tumorigenesis
2006; Elsevier BV; Volume: 131; Issue: 4 Linguagem: Inglês
10.1053/j.gastro.2006.07.018
ISSN1528-0012
AutoresLouise M. Judd, Karin Bredin, Anastasia Kalantzis, Brendan J. Jenkins, Matthias Ernst, Andrew S. Giraud,
Tópico(s)Cancer Mechanisms and Therapy
ResumoBackground & Aims: The gp130757F/F mouse is a well-characterized and robust model of distal gastric tumorigenesis displaying many of the characteristics of human intestinal type gastric cancer. Key to the development of tumors in this model, and in many examples of human tumor development, is hyperactivation of the transcription factor STAT3. This study addressed the requirement for STAT3 activation in tumor initiation and characterized some of the genes downstream of STAT3 required for tumor development. Furthermore, the interaction among STAT3, the microbial environment, and tumorigenesis was evaluated. Methods: The role of STAT3 in gastric tumor development was assessed in detail in gp130757F/Y757F:STAT3+/− mice displaying reduced STAT3 activity. Tumor size was quantified morphologically, and the effects on endocrine cell populations, neovascularization, and inflammatory cell infiltration as well as the outcome of STAT3 activation on transcription of a number of genes relevant in growth and inflammation were quantified. Results: Loss of one STAT3 allele in gp130757F/F mice reduced the frequency and rate of tumor development because of inhibition of proliferation-induced glandular hyperplasia. There was also a concomitant reduction in the degree of inflammatory infiltration and cytokine and chemokine expression, angiogenesis, and expression of metalloproteinases and growth factors. Antimicrobial treatment of gp130757F/F mice slowed tumor growth coincident with reduced macrophage and neutrophil infiltration. Conclusions: Activation of STAT3 and the microbial environment are pivotal for gastric tumor initiation and development in the gp130757F/F mouse, thus supporting the notion that STAT3 activation may play a role in human gastric cancer development. Background & Aims: The gp130757F/F mouse is a well-characterized and robust model of distal gastric tumorigenesis displaying many of the characteristics of human intestinal type gastric cancer. Key to the development of tumors in this model, and in many examples of human tumor development, is hyperactivation of the transcription factor STAT3. This study addressed the requirement for STAT3 activation in tumor initiation and characterized some of the genes downstream of STAT3 required for tumor development. Furthermore, the interaction among STAT3, the microbial environment, and tumorigenesis was evaluated. Methods: The role of STAT3 in gastric tumor development was assessed in detail in gp130757F/Y757F:STAT3+/− mice displaying reduced STAT3 activity. Tumor size was quantified morphologically, and the effects on endocrine cell populations, neovascularization, and inflammatory cell infiltration as well as the outcome of STAT3 activation on transcription of a number of genes relevant in growth and inflammation were quantified. Results: Loss of one STAT3 allele in gp130757F/F mice reduced the frequency and rate of tumor development because of inhibition of proliferation-induced glandular hyperplasia. There was also a concomitant reduction in the degree of inflammatory infiltration and cytokine and chemokine expression, angiogenesis, and expression of metalloproteinases and growth factors. Antimicrobial treatment of gp130757F/F mice slowed tumor growth coincident with reduced macrophage and neutrophil infiltration. Conclusions: Activation of STAT3 and the microbial environment are pivotal for gastric tumor initiation and development in the gp130757F/F mouse, thus supporting the notion that STAT3 activation may play a role in human gastric cancer development. See Editorial on page 1342. See Editorial on page 1342. The 7-member STAT family of proteins are transcription factors known for their role as integrators of cytokine and growth factor receptor signaling and are required for cell growth, survival, differentiation, and motility.1Clevenger C.V. Roles and regulation of stat family transcription factors in human breast cancer.Am J Pathol. 2004; 165: 1449-1460Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar, 2Yu H. Jove R. The STATs of cancer—new molecular targets come of age.Nat Rev Cancer. 2004; 4: 97-105Crossref PubMed Scopus (2014) Google Scholar STAT3 and 5 are the most widely expressed members of the family and are activated by the largest range of ligands.3Akira S. Functional roles of STAT family proteins: lessons from knockout mice.Stem Cells. 1999; 17: 138-146Crossref PubMed Scopus (283) Google Scholar STATs are recruited to specific receptor phosphotyrosines at which they are phosphorylated by Jak kinases, then dissociate from the receptor, homo- or heterodimerise; translocate to the nucleus; and initiate transcription in a sequence-specific manner.3Akira S. Functional roles of STAT family proteins: lessons from knockout mice.Stem Cells. 1999; 17: 138-146Crossref PubMed Scopus (283) Google Scholar STAT3 is critically involved in signaling through gp130, the common receptor subunit for the interleukin (IL)-6 family of cytokines, and as such is involved in a wide variety of both embryologic and adult tissue regulatory processes.4Levy D.E. Lee C.K. What does Stat3 do?.J Clin Invest. 2002; 109: 1143-1148Crossref PubMed Scopus (778) Google Scholar Recent evidence supports a role for STAT3 as an oncogene because it is aberrantly hyperactivated in many human cancers. This was initially described in head and neck cancer5Leong P.L. Andrews G.A. Johnson D.E. Dyer K.F. Xi S. Mai J.C. Robbins P.D. Gadiparthi S. Burke N.A. Watkins S.F. Grandis J.R. Targeted inhibition of Stat3 with a decoy oligonucleotide abrogates head and neck cancer cell growth.Proc Natl Acad Sci U S A. 2003; 100: 4138-4143Crossref PubMed Scopus (311) Google Scholar and multiple myeloma6Kortylewski M. Jove R. Yu H. Targeting STAT3 affects melanoma on multiple fronts.Cancer Metastasis Rev. 2005; 24: 315-327Crossref PubMed Scopus (245) Google Scholar and subsequently in lymphoma7Chiarle R. Simmons W.J. Cai H. Dhall G. Zamo A. Raz R. Karras J.G. Levy D.E. Inghirami G. Stat3 is required for ALK-mediated lymphomagenesis and provides a possible therapeutic target.Nat Med. 2005; 11: 623-629Crossref PubMed Scopus (385) Google Scholar and epithelial cancers of the breast,1Clevenger C.V. Roles and regulation of stat family transcription factors in human breast cancer.Am J Pathol. 2004; 165: 1449-1460Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar lung,8Seki Y. Suzuki N. Imaizumi M. Iwamoto T. Usami N. Ueda Y. Hamaguchi M. STAT3 and MAPK in human lung cancer tissues and suppression of oncogenic growth by JAB and dominant negative STAT3.Int J Oncol. 2004; 24: 931-934PubMed Google Scholar prostate, pancreas,9Bromberg J. Stat proteins and oncogenesis.J Clin Invest. 2002; 109: 1139-1142Crossref PubMed Scopus (769) Google Scholar and stomach.10Kanai M. Konda Y. Nakajima T. Izumi Y. Kanda N. Nanakin A. Kubohara Y. Chiba T. Differentiation-inducing factor-1 (DIF-1) inhibits STAT3 activity involved in gastric cancer cell proliferation via MEK-ERK-dependent pathway.Oncogene. 2003; 22: 548-554Crossref PubMed Scopus (81) Google Scholar Despite its involvement in such a large range of human tumors, naturally occurring mutations in STAT3 that result in its constitutive activation have not yet been identified.9Bromberg J. Stat proteins and oncogenesis.J Clin Invest. 2002; 109: 1139-1142Crossref PubMed Scopus (769) Google Scholar Development of any tumor is a result of complex interactions between the tumor cells and the local microenvironment, and many now believe that a chronic inflammatory insult is a precursor to the development of cancer.11Vakkila J. Lotze M.T. Inflammation and necrosis promote tumour growth.Nat Rev Immunol. 2004; 4: 641-648Crossref PubMed Scopus (562) Google Scholar As such, the role of STAT3 in inflammation is crucial and has been documented in extragastric tissues. In acute inflammation of the murine lung for example, activation of STAT3 is associated with tissue injury, and depletion of alveolar macrophages and neutrophils results in diminished STAT3 activation.12Gao H. Guo R.F. Speyer C.L. Reuben J. Neff T.A. Hoesel L.M. Riedemann N.C. McClintock S.D. Sarma J.V. Van Rooijen N. Zetoune F.S. Ward P.A. Stat3 activation in acute lung injury.J Immunol. 2004; 172: 7703-7712PubMed Google Scholar Inhibition of STAT3 by curcumin treatment alleviates experimentally induced pancreatitis13Gukovsky I. Reyes C.N. Vaquero E.C. Gukovskaya A.S. Pandol S.J. Curcumin ameliorates ethanol and nonethanol experimental pancreatitis.Am J Physiol Gastrointest Liver Physiol. 2003; 284: G85-G95Crossref PubMed Scopus (29) Google Scholar and experimental allergic encephalomyelitis.14Natarajan C. Bright J.J. Curcumin inhibits experimental allergic encephalomyelitis by blocking IL-12 signaling through Janus kinase-STAT pathway in T lymphocytes.J Immunol. 2002; 168: 6506-6513PubMed Google Scholar Specific disruption of STAT3 in T cells leads to impaired IL-6-induced proliferation because IL-6 normally prevents T-cell apoptosis and thus is conducive to proliferation15Takeda K. Kaisho T. Yoshida N. Takeda J. Kishimoto T. Akira S. Stat3 activation is responsible for IL-6-dependent T-cell proliferation through preventing apoptosis: generation and characterization of T-cell-specific Stat3-deficient mice.J Immunol. 1998; 161: 4652-4660Crossref PubMed Google Scholar; additionally, STAT3 activation plays a role in IL-6-mediated T-cell migration.16McLoughlin R.M. Jenkins B.J. Grail D. Williams A.S. Fielding C.A. Parker C.R. Ernst M. Topley N. Jones S.A. IL-6 trans-signaling via STAT3 directs T-cell infiltration in acute inflammation.Proc Natl Acad Sci U S A. 2005; 102: 9589-9594Crossref PubMed Scopus (254) Google Scholar These examples demonstrate the requirement for STAT3 in inflammatory responses driven by proinflammatory cytokines. In contrast, specific disruption of STAT3 in bone marrow cells results in the death of mice because of a dysregulation of the innate immune system, resulting in a Crohn's colitis-like disease throughout the intestine.17Welte T. Zhang S.S. Wang T. Zhang Z. Hesslein D.G. Yin Z. Kano A. Iwamoto Y. Li E. Craft J.E. Bothwell A.L. Fikrig E. Koni P.A. Flavell R.A. Fu X.Y. STAT3 deletion during hematopoiesis causes Crohn's disease-like pathogenesis and lethality: a critical role of STAT3 in innate immunity.Proc Natl Acad Sci U S A. 2003; 100: 1879-1884Crossref PubMed Scopus (344) Google Scholar Likewise, mice with a genetically induced depletion of STAT3 in macrophages and neutrophils also exhibit an overactive innate immune response and are susceptible to endotoxin shock.18Takeda K. Clausen B.E. Kaisho T. Tsujimura T. Terada N. Forster I. Akira S. Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils.Immunity. 1999; 10: 39-49Abstract Full Text Full Text PDF PubMed Scopus (1063) Google Scholar In both of these mice, the exaggerated immune activation is thought to be due to the inability of IL-10 to signal through STAT3 as part of an anti-inflammatory response. Thus, STAT3 may positively or negatively regulate inflammation, depending on the cell and tissue involved. Some mouse models of tumorigenesis, particularly those of the breast and skin, require activation of STAT3 for tumor induction or growth. For instance, expression of a constitutively activated mutant form of STAT3 can transform fibroblasts in culture and render them tumorigenic in mice,2Yu H. Jove R. The STATs of cancer—new molecular targets come of age.Nat Rev Cancer. 2004; 4: 97-105Crossref PubMed Scopus (2014) Google Scholar and inhibitory manipulation of STAT3 in these models has demonstrated that targeting of STAT3 activation inhibits tumor growth.7Chiarle R. Simmons W.J. Cai H. Dhall G. Zamo A. Raz R. Karras J.G. Levy D.E. Inghirami G. Stat3 is required for ALK-mediated lymphomagenesis and provides a possible therapeutic target.Nat Med. 2005; 11: 623-629Crossref PubMed Scopus (385) Google Scholar, 19Ling X. Arlinghaus R.B. Knockdown of STAT3 expression by RNA interference inhibits the induction of breast tumors in immunocompetent mice.Cancer Res. 2005; 65: 2532-2536Crossref PubMed Scopus (190) Google Scholar, 20Schlessinger K. Levy D.E. Malignant transformation but not normal cell growth depends on signal transducer and activator of transcription 3.Cancer Res. 2005; 65: 5828-5834Crossref PubMed Scopus (100) Google Scholar, 21Chan K.S. Sano S. Kiguchi K. Anders J. Komazawa N. Takeda J. DiGiovanni J. Disruption of Stat3 reveals a critical role in both the initiation and the promotion stages of epithelial carcinogenesis.J Clin Invest. 2004; 114: 720-728Crossref PubMed Scopus (315) Google Scholar The oncogenic activity of STAT3 is believed to rest on its ability to stimulate proliferation, metastasis, immune evasion, and angiogenesis.2Yu H. Jove R. The STATs of cancer—new molecular targets come of age.Nat Rev Cancer. 2004; 4: 97-105Crossref PubMed Scopus (2014) Google Scholar, 6Kortylewski M. Jove R. Yu H. Targeting STAT3 affects melanoma on multiple fronts.Cancer Metastasis Rev. 2005; 24: 315-327Crossref PubMed Scopus (245) Google Scholar, 22Wang T. Niu G. Kortylewski M. Burdelya L. Shain K. Zhang S. Bhattacharya R. Gabrilovich D. Heller R. Coppola D. Dalton W. Jove R. Pardoll D. Yu H. Regulation of the innate and adaptive immune responses by Stat-3 signaling in tumor cells.Nat Med. 2004; 10: 48-54Crossref PubMed Scopus (982) Google Scholar, 23Niu G. Wright K.L. Huang M. Song L. Haura E. Turkson J. Zhang S. Wang T. Sinibaldi D. Coppola D. Heller R. Ellis L.M. Karras J. Bromberg J. Pardoll D. Jove R. Yu H. Constitutive Stat3 activity up-regulates VEGF expression and tumor angiogenesis.Oncogene. 2002; 21: 2000-2008Crossref PubMed Scopus (1053) Google Scholar, 24Xi S. Gooding W.E. Grandis J.R. In vivo antitumor efficacy of STAT3 blockade using a transcription factor decoy approach: implications for cancer therapy.Oncogene. 2005; 24: 970-979Crossref PubMed Scopus (154) Google Scholar We have previously described a mouse model of gastric tumorigenesis, characterized by excessive phosphorylation of STAT3 and loss of the stomach-specific tumor suppressor gene trefoil factor 1.25Tebbutt N.C. Giraud A.S. Inglese M. Jenkins B. Waring P. Clay F.J. Malki S. Alderman B.M. Grail D. Hollande F. Heath J.K. Ernst M. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and STAT-mediated trefoil gene activation in gp130 mutant mice.Nat Med. 2002; 8: 1089-1097Crossref PubMed Scopus (420) Google Scholar, 26Judd L.M. Alderman B.M. Howlett M. Shulkes A. Dow C. Moverley J. Grail D. Jenkins B.J. Ernst M. Giraud A.S. Gastric cancer development in mice lacking the SHP2 binding site on the IL-6 family co-receptor gp130.Gastroenterology. 2004; 126: 196-207Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar This model is based on the introduction of an amino acid substitution in the signaling domain of the IL-6/IL-11 cytokine family coreceptor gp130. A tyrosine for phenylalanine substitution at position 757 (757 Y-F) of gp130 prevents docking of SHP2 to the receptor and its subsequent phosphorylation, eventuating in reduced Ras/MAP kinase and suppressor of cytokine signalling 3 drive and augmented STAT3 signaling.25Tebbutt N.C. Giraud A.S. Inglese M. Jenkins B. Waring P. Clay F.J. Malki S. Alderman B.M. Grail D. Hollande F. Heath J.K. Ernst M. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and STAT-mediated trefoil gene activation in gp130 mutant mice.Nat Med. 2002; 8: 1089-1097Crossref PubMed Scopus (420) Google Scholar As a consequence, homozygous mutant mice (gp130Y757F/Y757F or gp130757F/F) develop several phenotypes including splenomegaly and tumors of the distal gastric mucosa. These tumors are evident from 4 weeks of age and develop with 100% penetrance.26Judd L.M. Alderman B.M. Howlett M. Shulkes A. Dow C. Moverley J. Grail D. Jenkins B.J. Ernst M. Giraud A.S. Gastric cancer development in mice lacking the SHP2 binding site on the IL-6 family co-receptor gp130.Gastroenterology. 2004; 126: 196-207Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar Generation of gp130757F/F mice with a haplo-insufficiency in STAT3 (gp130757F/F: STAT3+/−) has shown that a requirement for complete phenotypic penetrance in gp130757F/F mice is the presence of hyperactivated STAT327Jenkins B.J. Grail D. Nheu T. Najdovska M. Wang B. Waring P. Inglese M. McLoughlin R.M. Jones S.A. Topley N. Baumann H. Judd L.M. Giraud A.S. Boussioutas A. Zhu H.J. Ernst M. Hyperactivation of Stat3 in gp130 mutant mice promotes gastric hyperproliferation and desensitizes TGF-β signaling.Nat Med. 2005; 11: 845-852Crossref PubMed Scopus (265) Google Scholar, 28Jenkins B.J. Roberts A.W. Najdovska M. Grail D. Ernst M. The threshold of gp130-dependent STAT3 signaling is critical for normal regulation of hematopoiesis.Blood. 2005; 105: 3512-3520Crossref PubMed Scopus (72) Google Scholar; however, the gastric consequences of this constitutive activation have not been fully explored and may have direct application in our understanding of gastric tumor development in humans. Here, we detail the effect of haplo-insufficiency of STAT3 on the tumor phenotype of gp130757F/F mice and evaluate the effect of antimicrobial treatment on tumor progression. We show that STAT3 regulates tumor development directly through control of cell proliferation and is also crucial for the recruitment of inflammatory cells to the tumor site. Unexpectedly, STAT3 loss results in a pronounced inhibition of gastric endocrine cell differentiation. Furthermore, STAT3 can regulate tumor progression indirectly by regulating the transcription of genes controlling growth, angiogenesis, and invasion including numerous proinflammatory cytokines, the Reg family of growth factors and several key metalloproteinases (MMPs). Finally, antimicrobial treatment of gp130757F/F mice slowed tumor growth independently of tumor epithelial STAT3 activation but coincident with reduced macrophage and neutrophil infiltration. gp130757F/F,25Tebbutt N.C. Giraud A.S. Inglese M. Jenkins B. Waring P. Clay F.J. Malki S. Alderman B.M. Grail D. Hollande F. Heath J.K. Ernst M. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and STAT-mediated trefoil gene activation in gp130 mutant mice.Nat Med. 2002; 8: 1089-1097Crossref PubMed Scopus (420) Google Scholar STAT3+/−,29Takeda K. Noguchi K. Shi W. Tanaka T. Matsumoto M. Yoshida N. Kishimoto T. Akira S. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality.Proc Natl Acad Sci U S A. 1997; 94: 3801-3804Crossref PubMed Scopus (1127) Google Scholar and compound gp130757F/F:STAT3+/−27Jenkins B.J. Grail D. Nheu T. Najdovska M. Wang B. Waring P. Inglese M. McLoughlin R.M. Jones S.A. Topley N. Baumann H. Judd L.M. Giraud A.S. Boussioutas A. Zhu H.J. Ernst M. Hyperactivation of Stat3 in gp130 mutant mice promotes gastric hyperproliferation and desensitizes TGF-β signaling.Nat Med. 2005; 11: 845-852Crossref PubMed Scopus (265) Google Scholar mice were generated as previously described. All mice were kept on a 129 Sv-J/C57BL/6 background, and control mice were age-matched littermates. Mice were genotyped by multiplex polymerase chain reaction (PCR) as previously described.25Tebbutt N.C. Giraud A.S. Inglese M. Jenkins B. Waring P. Clay F.J. Malki S. Alderman B.M. Grail D. Hollande F. Heath J.K. Ernst M. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and STAT-mediated trefoil gene activation in gp130 mutant mice.Nat Med. 2002; 8: 1089-1097Crossref PubMed Scopus (420) Google Scholar, 29Takeda K. Noguchi K. Shi W. Tanaka T. Matsumoto M. Yoshida N. Kishimoto T. Akira S. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality.Proc Natl Acad Sci U S A. 1997; 94: 3801-3804Crossref PubMed Scopus (1127) Google Scholar Mice were housed under standard conditions and free of Helicobacter pylori. Both wild-type and gp130757F/F mutant mouse tissues were assessed by an independent mouse pathology service (Cerberus Sciences Australia) to analyze for helicobacter and parasitic infection. The mice are parasite free, but, as is the case for most non-hepafiltered pathogen-free animal houses, both wild-type and mutant mice were equally infected with Bacteroides species, Lactobacillus species, anaerobic Streptococci, and Helicobacter hepaticus but not Helicobacter bilis or other Helicobacter species. All animal experiments were performed with approval from the appropriate animal ethics committees. Antibiotic treatment started at 3 weeks of age just after weaning and continued until the age of 12 weeks. Mice were given drinking water containing 0.68 mg/mL metronidazole and 0.34 mg/mL ciprofloxacin,30Madsen K.L. Doyle J.S. Tavernini M.M. Jewell L.D. Rennie R.P. Fedorak R.N. Antibiotic therapy attenuates colitis in interleukin 10 gene-deficient mice.Gastroenterology. 2000; 118: 1094-1105Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar which was changed every 3–4 days. Mice given normal drinking water housed in adjacent cages were used as controls. The mouse weights were assessed each week to monitor the well-being of the animals. Immunoblotting was carried out as previously described using Coomassie blue-stained gels to ensure equal loading.31Howlett M. Judd L.M. Jenkins B. La Gruta N.L. Grail D. Ernst M. Giraud A.S. Differential regulation of gastric tumor growth by cytokines that signal exclusively through the coreceptor gp130.Gastroenterology. 2005; 129: 1005-1018Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar Briefly, protein extracts were prepared with Trizol reagent (Life Technologies, Vic, Australia) according to manufacturer's instructions. Protein pellets were resuspended in 1% SDS containing 2 mmol/L sodium orthovanadate (NaVO4), and 20-μg aliquots were subjected to SDS-PAGE. Membranes were blocked and incubated at 4°C overnight with antibodies specific for either STAT3 (No. 9132; Cell Signaling Technology, Danvers, MA), phosphorylated STAT3 (pYSTAT3) (Tyr-705) (No. 9133; Cell Signaling Technology, Danvers, MA), IgA (No. 610-4606; Rockland, Immunochemicals, Gilbertsville, PA), or IgG (No. 610-4602; Rockland, Immunochemicals, Gilbertsville, PA). Membranes were incubated with appropriate peroxide-conjugated secondary antibody. Immunoreactive proteins were visualized using the enhanced chemiluminescence system (Amersham, Buckinghamshire, United Kingdom). Immunohistochemical analysis was performed as previously described31Howlett M. Judd L.M. Jenkins B. La Gruta N.L. Grail D. Ernst M. Giraud A.S. Differential regulation of gastric tumor growth by cytokines that signal exclusively through the coreceptor gp130.Gastroenterology. 2005; 129: 1005-1018Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar using the following antibodies:STAT3 (No. 9132; Cell Signaling Technology, Danvers, MA), pYSTAT3 (Tyr-705) (No. 9133; Cell Signaling Technology, Danvers, MA), von Willebrand factor (No. A0082; DAKO A/S, Glostrup, Denmark), MMP-9 (ab16306; Abcam, Cambridge, United Kingdom), and proliferating cell nuclear antigen (PCNA) (No. M0879; DAKO A/S, Glostrup, Denmark). Staining was completed with appropriate species-specific biotinylated secondary antibodies (DAKO, Glostrup, Denmark), avidin and biotinylated horseradish peroxidase macromolecular complex (Vector Laboratories, Burlingame, CA) and 3,3′-diaminobenzidine (Sigma Chemical Co, St Louis, MO) and counterstained with hematoxylin. For all antibodies, antigen retrieval was performed by boiling sections for 30 minutes in 10 mmol/L citric acid (pH 6.0). Blood vessels positively stained for von Willebrand factor were point counted by light microscopy. The number of blood vessels was tallied to give total number per stomach and expressed/mm of total muscularis mucosa. Stomachs were removed, dissected along the lesser curvature, pinned out, photographed with a Coolpix 4500 digital camera (Nikon Instruments, Melville, NY) and subsequently fixed in 4% buffered paraformaldehyde before processing. Paraffin sections (4 μm) were stained with H&E or Alcian blue/periodic acid/Schiff. Morphometric analysis was performed using ImageJ software for Windows v1.3 (http://rsb.info.nih.gov/ij/index.html). Between 6 and 9 mice, 16–20 weeks of age, were assessed in each group. For area measurements, images of tumor tissue in the gastric mucosa were manually outlined with the software drawing tool, and the quantitation program was used to generate measurements. Similarly, the software was used to generate linear measurements of the mucosa by outlining the image of the muscularis mucosa. For gland length and cell proliferation measurements, between 2 and 10 full-length, longditudinal glands were measured and a mean taken for each mouse. Total RNA from antral tissue was extracted with Trizol reagent (Life Technologies, Victoria, Australia) according to manufacturer's instructions. Primer sequences for reverse-transcriptase polymerase chain reaction (RT-PCR) analysis are shown in Table 1. RT-PCR was carried out as previously described, and optimal annealing temperatures and numbers of cycles were carefully predetermined for each primer pair (Table 1) to ensure that the intensities of the amplification products increased proportionally with increasing amounts of complementary DNA (cDNA) template.32Alderman B.M. Ulaganathan M. Judd L.M. Howlett M. Parker L.M. Yeomans N.D. Giraud A.S. Insights into the mechanisms of gastric adaptation to aspirin-induced injury: a role for regenerating protein but not trefoil peptides.Lab Invest. 2003; 83: 1415-1425Crossref PubMed Scopus (12) Google Scholar PCR products were visualized by agarose/ethidium bromide gel electrophoresis and quantified using the KODAK 1D Image Analysis Software (Eastman Kodak, Hartford, CT).Table 1Primer Sequences for RT-PCRGeneForward primerReverse primerTemp.CyclesGAPDH5′GGAGAAACCTGCCAAGTATG3′5′TGGGAGTTGCTGTTGAAGTC3′59°C20IL-65′CCTTCCCTACTTCACAAGTCC3′5′GAATGTCCACAAACTGATATGC3′56°C33IL-115′GGGGCCTGCTGTTGTTAAAG3′5′TCCTGGAACTCACGAACTCAC3′59°C28–30IL-45′ACTTAATTGTCTCTCGTCACTG3′5′GATGTGGACTTGGACTCATTC3′60°C35IL-1α5′GACAAACACTATCTCAGCACC3′5′TCCCAAGTGAATAGACTCCC3′58°C33IL-1β5′GAACCAAGCAACGACAAAATAC3′5′AGAGGCAAGGAGGAAAACAC3′58°C33TNF-α5′AAGTCAACCTCCTCTCTGCC3′5′GTCCCAGCATCTTGTGTTTC3′58°C33IFN-γ5′GCTCTGAGACAATGAACGCTAC3′5′GACTCCTTTTCCGCTTCCTG3′58°C38MMP-135′CTTGTTTATTGTTGCTGCCC3′5′CATCTACTTTGTTGCCAATTCC3′58°C26–30MMP-35′CGATGATGAACGATGGACAGAG3′5′TCCACCCTTGAGTCAACACC3′60°C25–30MMP-95′ACCACCACCACACACAAACC3′5′GCCCGACACACAGTAAGCATTC3′60°C27–30 Open table in a new tab For Northern blot analysis, 10 μg total RNA was mixed with Glyoxal sample buffer (BioWhittaker Molecular Applications, Rockland, MA), electrophoresed through a MOPS buffered agarose gel, and transferred onto Hybond-XL nylon membrane (Amersham, Buckinghamshire, UK). RNA was cross-linked onto the membrane by UV irradiation, and specific messenger RNA (mRNA) was detected by hybridization with a 32P-labeled cDNA probe. Hybridization was performed in Rapid-hyb buffer (Amersham) according to manufacturer's instructions. The probes used for the hybridizations were the products from the RT-PCR described previously. All tissues were examined in a blinded fashion by 2 observers on AB/PAS and H&E-stained sections. Tissues were analyzed in the region between the forestomach-fundic junction and the gastroduodenal junction. Strips of stomach tissue per mouse were given separate histologic scores from 0 to 4 according to the degree of infiltration (0, normal; 1, minimal; 2, moderate; 3, marked; and 4, severe) for the following inflammatory criteria: lymphoplasmocytic infiltration, polymorphonuclear (PMN) infiltration, submucosal lymphoid follicle development, and subserosal leukocyte aggregation, as previously described.33Fox J.G. Sheppard B.J. Dangler C.A. Whary M.T. Ihrig M. Wang T.C. Germ-line p53-targeted disruption inhibits helicobacter-induced premalignant lesions and invasive gastric carcinoma through down-regulation of Th1 proinflammatory responses.Cancer Res. 2002; 62: 696-702PubMed Google Scholar, 34Franic T.V. van Driel I.R. Gleeson P.A. Giraud A.S. Judd L.M. Reciprocal changes in trefoil 1 and 2 expression in stomachs of mice with gastric unit hypertrophy and inflammation.J Pathol. 2005; 207: 43-52Crossref PubMed Scopus (17) Google Scholar The mean of the score for each criterion from each strip of mucosa was taken to give a final score for each animal. Values obtained from quantitative analysis of gene expression or number of stained components were compared between mice by ANOVA, and at points at which a statistically significant difference was found, individual groups were further analyzed with the appropriate parametric or nonparametric statistics using Sigmastat 2.0 (Jandel Scientific, San Rafael, CA). Basal STAT3 and pYSTAT3 were assessed in extracts of gastric mucosa from wild-type, STAT3+/−, gp130757F/F, and gp130757F/F: STAT3+/− mice. STAT3 expression was detected at normal levels in mice with mutation in gp130, and expression was approximately halved in mice heterozygous for the STAT3 mutation (Figure 1A and E). The amount of pYSTAT3 was also reduced in the STAT3+/− and gp130757F/F: STAT3+/− mice as was the amount of pYSTAT3 as a proportion of total STAT3 (Figure 1B). This result was confirmed by immunohistochemistry. The amount of STAT3 in stomachs of gp130+/+STAT3+/+ and gp130757F/F mice was roughly equivalent (Figure 1C and D) but significantly reduced in gp130757F/F: STAT3+/− mice (Figure 1E). As previously described,25Tebbutt N.C. Giraud A.S. Inglese M. Jenkins B. Waring P. Clay F.J. Malki S. Alderman B.M. Grail D. Hollande F. Heath J.K. Ernst M. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and STAT-mediated trefoil gene activation in gp130 mutant mice.Nat Med. 2002; 8: 1089-1097Crossref P
Referência(s)