Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Upstream Stimulatory Factor Binding to the E-box at −65 Is Required for Insulin Regulation of the Fatty Acid Synthase Promoter

1997; Elsevier BV; Volume: 272; Issue: 42 Linguagem: Inglês

10.1074/jbc.272.42.26367

ISSN

1083-351X

Autores

Dong Wang, Hei Sook Sul,

Tópico(s)

Lipid metabolism and biosynthesis

Resumo

Fatty acid synthase (FAS) plays a central role inde novo lipogenesis in mammals. We have shown that FAS transcription rate is induced dramatically when fasted animals are refed with a high carbohydrate diet or when streptozotocin-diabetic mice are given insulin. We also reported that FAS gene transcription was up-regulated by insulin through the proximal promoter region from −71 to −50 and that upstream stimulatory factors (USFs), including USF1 and USF2, interact with this region in vitro. In the present study, by using site-directed mutagenesis of the −71/−50 region and correlating functional assays of the mutated promoter with USF binding activities, we demonstrate that the −65/−60 E-box motif (5′-CATGTG-3′) is functionally required for insulin regulation and that USFs are in vivo components of the insulin response complex. Mutation of the −65/−60 E-box sequence abolished insulin response in both transiently and stably transfected 3T3-L1 adipocytes in the −2.1 kb promoter context, which contains all the necessary regulatory elements of the promoter based on our previous transgenic mice studies, and in the minimal −67 promoter context. Gel mobility shift assays demonstrated that USFs can no longer bind to the −71/−50 promoter region when the E-box is mutated. Cotransfection of USF1 and USF2 expression vectors with the FAS promoter-luciferase reporter constructs increased insulin-stimulated FAS promoter activity. Moreover, cotransfection of dominant negative USF1 and USF2 mutants lacking the DNA binding domain inhibited the insulin stimulation of the FAS promoter activity. On the other hand, site-directed mutagenesis of the −65/−60 E-box surrounding sequences within the overlapped tandem copies of sterol regulatory element-binding protein (SREBP) binding sites prevented SREBP from binding to −71/−50 promoter regionin vitro but had no effect on insulin regulation of the FAS promoter in vivo. When rat liver nuclear extracts were used in gel mobility shift assays, only USF-containing protein-DNA complexes that can be supershifted by specific USF antibodies were observed. These results demonstrate that upstream stimulatory factor binding to the E-box at −65 is required for insulin regulation of the fatty acid synthase promoter. Fatty acid synthase (FAS) plays a central role inde novo lipogenesis in mammals. We have shown that FAS transcription rate is induced dramatically when fasted animals are refed with a high carbohydrate diet or when streptozotocin-diabetic mice are given insulin. We also reported that FAS gene transcription was up-regulated by insulin through the proximal promoter region from −71 to −50 and that upstream stimulatory factors (USFs), including USF1 and USF2, interact with this region in vitro. In the present study, by using site-directed mutagenesis of the −71/−50 region and correlating functional assays of the mutated promoter with USF binding activities, we demonstrate that the −65/−60 E-box motif (5′-CATGTG-3′) is functionally required for insulin regulation and that USFs are in vivo components of the insulin response complex. Mutation of the −65/−60 E-box sequence abolished insulin response in both transiently and stably transfected 3T3-L1 adipocytes in the −2.1 kb promoter context, which contains all the necessary regulatory elements of the promoter based on our previous transgenic mice studies, and in the minimal −67 promoter context. Gel mobility shift assays demonstrated that USFs can no longer bind to the −71/−50 promoter region when the E-box is mutated. Cotransfection of USF1 and USF2 expression vectors with the FAS promoter-luciferase reporter constructs increased insulin-stimulated FAS promoter activity. Moreover, cotransfection of dominant negative USF1 and USF2 mutants lacking the DNA binding domain inhibited the insulin stimulation of the FAS promoter activity. On the other hand, site-directed mutagenesis of the −65/−60 E-box surrounding sequences within the overlapped tandem copies of sterol regulatory element-binding protein (SREBP) binding sites prevented SREBP from binding to −71/−50 promoter regionin vitro but had no effect on insulin regulation of the FAS promoter in vivo. When rat liver nuclear extracts were used in gel mobility shift assays, only USF-containing protein-DNA complexes that can be supershifted by specific USF antibodies were observed. These results demonstrate that upstream stimulatory factor binding to the E-box at −65 is required for insulin regulation of the fatty acid synthase promoter. Fatty acid synthase (FAS) 1The abbreviations used are: FAS, fatty acid synthase; bHLH, basic helix-loop-helix; IRS, insulin response sequence; L-PK, L-type pyruvate kinase; PCR, polymerase chain reaction; PEPCK, phosphoneolpyruvate carboxykinase; SREBP, sterol response element-binding protein; USF, upstream stimulatory factor. plays a central role in de novo lipogenesis in mammals and birds. By action of its seven active sites, FAS catalyzes all the reaction steps in the conversion of acetyl-CoA and malonyl-CoA to palmitate. FAS activity is not known to be regulated by allosteric effectors or covalent modification. However, FAS concentration is exquisitely sensitive to nutritional, hormonal, and developmental status (1Wakil S.J. Stoops J.K. Joshi V.C. Annu. Rev. Biochem. 1983; 52: 537-579Crossref PubMed Google Scholar, 2Volpe J.J. Vagelos P.R. Physiol. Rev. 1976; 56: 339-417Crossref PubMed Scopus (214) Google Scholar). The concentration or activity of FAS in liver and adipose tissue changes dramatically when animals are subject to certain nutritional and hormonal manipulations. We reported previously that due to changes in the rate of FAS transcription, FAS synthesis declines and increases in an insulin-dependent manner during fasting and refeeding, respectively (3Paulauskis J.D. Sul H.S. J. Biol. Chem. 1988; 263: 7049-7054Abstract Full Text PDF PubMed Google Scholar, 4Paulauskis J.D. Sul H.S. J. Biol. Chem. 1989; 264: 574-577Abstract Full Text PDF PubMed Google Scholar). Administration of insulin to streptozotocin-diabetic mice stimulated the level of FAS mRNA and FAS transcription rates (4Paulauskis J.D. Sul H.S. J. Biol. Chem. 1989; 264: 574-577Abstract Full Text PDF PubMed Google Scholar). We also reported that insulin increased levels of FAS mRNA in 3T3-L1 adipocytes (3Paulauskis J.D. Sul H.S. J. Biol. Chem. 1988; 263: 7049-7054Abstract Full Text PDF PubMed Google Scholar). DNA sequences mediating insulin induction of the FAS gene were first located within the first 332 bases of the FAS promoter and further mapped to the proximal promoter region from −71 to −50 by chimeric constructions of serial 5′-deletions of the rat FAS promoter-reporter constructs and transfection into H4IIE hepatoma cells and 3T3-L1 adipocytes (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). Moreover, three tandem copies of the −68/−52 FAS promoter region linked to heterologous SV40 promoter were responsive to insulin (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). Using competition gel mobility shift assays and specific upstream stimulatory factor (USF) antibodies, we identified USF1 and USF2 as major components of complexes that bind to this region of the FAS promoter in vitro (6Wang D. Sul H.S. J. Biol. Chem. 1995; 270: 28716-28722Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Within the −71/−50 region of the FAS promoter that we defined as the insulin response sequence, two tandem binding sites for sterol regulatory element-binding proteins (SREBPs) were recently reported to be present at position −68/−63 and −62/−57 (7Magana M.M. Osborne T.F. J. Biol. Chem. 1996; 271: 32689-32694Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar). Interestingly, the two SREBP binding sites overlap with a core E-box (5′-CATGTG-3′) present in the insulin response sequence at position −65/−60. It was postulated that SREBP proteins bind their binding sites, rather than the E-box, to participate in sterol regulation of FAS promoter (7Magana M.M. Osborne T.F. J. Biol. Chem. 1996; 271: 32689-32694Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar). USF proteins are members of the basic-helix-loop-helix (bHLH) family of transcription factors. First identified for their involvement in transcription from the adenovirus major late promoter (8Sawadogo M. Roeder R.G. Cell. 1985; 43: 165-175Abstract Full Text PDF PubMed Scopus (718) Google Scholar, 9Carthew R.W. Chodosh L.A. Sharp P.A. Cell. 1985; 43: 439-448Abstract Full Text PDF PubMed Scopus (404) Google Scholar, 10Miyamoto N.G. Moncollin V. Egly J.M. Chambon P. EMBO J. 1985; 4: 3563-3570Crossref PubMed Scopus (110) Google Scholar), USF proteins were purified as the 43-kDa USF1 and 44-kDa USF2 (11Sawadogo M. Van Dyke M.W. Gregor P.D. Roeder R.G. J. Biol. Chem. 1988; 263: 11985-11993Abstract Full Text PDF PubMed Google Scholar). USF1 and USF2 cDNAs, including their alternative spliced forms, have been isolated and characterized from various species (12Gregor P.D. Sawadogo M. Roeder R.G. Genes Dev. 1990; 4: 1730-1740Crossref PubMed Scopus (435) Google Scholar, 13Sirito M. Walker S. Lin Q. Kozlowski M.T. Klein W.H. Sawadogo M. Gene Exp. 1992; 2: 231-240PubMed Google Scholar, 14Sirito M. Lin Q. Maity T. Sawadogo M. Nucleic Acids Res. 1994; 22: 427-433Crossref PubMed Scopus (292) Google Scholar, 15Kozlowski M.T. Gan L. Venuti J.M. Sawadogo M. Klein W.H. Dev. Biol. 1991; 148: 625-630Crossref PubMed Scopus (28) Google Scholar, 16Kaulen H. Pognonec P. Gregor P.D. Roeder R.G. Mol. Cell. Biol. 1991; 11: 412-424Crossref PubMed Scopus (45) Google Scholar, 17Blanar M.A. Rutter W.J. Science. 1992; 256: 1014-1018Crossref PubMed Scopus (276) Google Scholar). The two USF proteins bind to the 5′-CANNTG-3′ E-box motif with identical DNA binding specificity (11Sawadogo M. Van Dyke M.W. Gregor P.D. Roeder R.G. J. Biol. Chem. 1988; 263: 11985-11993Abstract Full Text PDF PubMed Google Scholar). In addition to the bHLH structure, a leucine zipper is immediately adjacent and is also important for USF dimerization and DNA binding (12Gregor P.D. Sawadogo M. Roeder R.G. Genes Dev. 1990; 4: 1730-1740Crossref PubMed Scopus (435) Google Scholar). The basic region is critical for DNA binding, and deletion of this region results in a dominant negative USF, which still dimerizes but lacks DNA binding capacity (18Luo X. Sawadogo M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1308-1313Crossref PubMed Scopus (111) Google Scholar). Introduction of a dominant negative USF into cells can block the function of endogenous wild-type USF proteins (18Luo X. Sawadogo M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1308-1313Crossref PubMed Scopus (111) Google Scholar, 19Lefrancois-Martinez A.-M. Martinez A. Antoine B. Raymondjean M. Kahn A. J. Biol. Chem. 1995; 270: 2640-2643Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 20Kaytor E.N. Shih H. Towle H.C. J. Biol. Chem. 1997; 272: 7525-7531Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). Although USF proteins were found to be ubiquitously expressed among various tissue and cell types, they can be involved in transcriptional regulation of specific genes. USF binding sites have been found, and the involvement of USF in transcriptional regulation have been studied in a number of cellular and viral genes (19Lefrancois-Martinez A.-M. Martinez A. Antoine B. Raymondjean M. Kahn A. J. Biol. Chem. 1995; 270: 2640-2643Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 20Kaytor E.N. Shih H. Towle H.C. J. Biol. Chem. 1997; 272: 7525-7531Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 21Diaz Guerra M.J. Bergot M.O. Martinez A. Cuif M.H. Kahn A. Raymondjean M. Mol. Cell. Biol. 1993; 13: 7725-7733Crossref PubMed Scopus (97) Google Scholar, 22Liu Z. Thompson K.S. Towle H.C. J. Biol. Chem. 1993; 268: 12787-12795Abstract Full Text PDF PubMed Google Scholar, 23Meier J.L. Luo X. Sawadogo M. Straus S.E. Mol. Cell. Biol. 1994; 14: 6896-6906Crossref PubMed Scopus (103) Google Scholar, 24Datta P.K. Ghosh A.K. Jacob S.T. J. Biol. Chem. 1995; 270: 8637-8641Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). For example, USFs were shown to bind the glucose response element of the L-type pyruvate kinase (L-PK) and S14 gene promoters in vitro (21Diaz Guerra M.J. Bergot M.O. Martinez A. Cuif M.H. Kahn A. Raymondjean M. Mol. Cell. Biol. 1993; 13: 7725-7733Crossref PubMed Scopus (97) Google Scholar, 22Liu Z. Thompson K.S. Towle H.C. J. Biol. Chem. 1993; 268: 12787-12795Abstract Full Text PDF PubMed Google Scholar). However, the role USFs play in mediating glucose response in vivo is yet to be clarified. Evidence supporting (19Lefrancois-Martinez A.-M. Martinez A. Antoine B. Raymondjean M. Kahn A. J. Biol. Chem. 1995; 270: 2640-2643Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar) as well as against (20Kaytor E.N. Shih H. Towle H.C. J. Biol. Chem. 1997; 272: 7525-7531Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar) the direct involvement of USF proteins in glucose response of the L-PK and S14 genes was reported. Based on our previous reports that sequences responsible for insulin regulation of the FAS gene is present in the promoter region at −71/−50 and USFs bind to this region in vitro, this report provides evidence to further define the −65/−60 E-box as a critical requirement for insulin regulation and demonstrate that USF proteins are in vivo components mediating insulin regulation of the FAS promoter activity. Using site-directed mutagenesis, we showed that mutations of the −65/−60 E-box, but not the surrounding sequences within the SREBP binding sites, could effectively abolish the USF binding to FAS −71/−50 region in vitro and disrupt the insulin regulation of the FAS promoter-luciferase reporter constructs in transfection assays. When cotransfected with the FAS promoter constructs, USF1 and USF2 could further activate and dominant negative USF1 and USF2 could inhibit the insulin-stimulated FAS promoter activity. Using gel mobility shift assays, we demonstrated that USF and SREBP proteins independently bind to their exclusive binding sites and that USF interaction with the −65/−60 E-box, but not SREBP, is required for insulin regulation of the FAS transcription. The reporter gene constructs of p2.1kb-LUC and p67-LUC, which contain, respectively, the −2.1 kb and −67 bp of wild-type rat FAS promoter fused with luciferase sequence have been described previously (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). p2.1kbM-LUC and p67M-LUC constructs were made to mutate the FAS −65/−60 E-box sequence 5′-CATGTG-3′ to 5′-GAATTC-3′ by site-directed mutagenesis methods (25Deng W.P. Nickoloff J.A. Anal. Biochem. 1992; 200: 81-88Crossref PubMed Scopus (1079) Google Scholar, 26Wang D. Sul H.S. Biotechniques. 1997; 22: 70-72Crossref Scopus (5) Google Scholar). p2.1kbS1-LUC, p2.1kbS2-LUC, and p2.1kbS3-LUC plasmids, which contain the −2.1 kb FAS promoter with mutations disrupting the SREBP binding sites or SREBP and SP1 interaction (7Magana M.M. Osborne T.F. J. Biol. Chem. 1996; 271: 32689-32694Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar), were also made by site-directed mutagenesis methods (25Deng W.P. Nickoloff J.A. Anal. Biochem. 1992; 200: 81-88Crossref PubMed Scopus (1079) Google Scholar, 26Wang D. Sul H.S. Biotechniques. 1997; 22: 70-72Crossref Scopus (5) Google Scholar). In p2.1kbS1-LUC, wild-type FAS promoter sequence 5′-TCA-3′ from position −71 to −69 and 5′-TGG-3′ from position −56 to −54 were changed to 5′-TCA-3′ and 5′-CAA-3′, respectively. In p2.1kbS2-LUC and p2.1kbS3-LUC, a 4-bp (5′-CTAG-3′) and a 10-bp (5′-CTAGTCTAGA-3′) sequence were inserted between position −73 and −72. Expression vectors pFLAG-USF1 and pFLAG-USF2, which contain full-length human USF1 and mouse USF2 cDNA sequences, were made by PCR amplifying the USF plasmid DNA (kindly provided by Dr. M. Sawadogo, M. D. Anderson Medical Center, University of Texas) with the high fidelity Pfu DNA polymerase (Stratagene) and inserting the products into mammalian expression vector pcDNA3.0 (Invitrogen). PCR primers were designed to introduce a N-terminal FLAG peptide tag (N-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-C) to the expressed USF1 and USF2 proteins and incorporate a consensus Kozak sequence upstream of the ATG start codon for efficient translation. Dominant negative forms of USF1 and USF2, i.e. pFLAG-USFΔb and pFLAG-USF2Δb, were made by site-directed mutagenesis (25Deng W.P. Nickoloff J.A. Anal. Biochem. 1992; 200: 81-88Crossref PubMed Scopus (1079) Google Scholar, 26Wang D. Sul H.S. Biotechniques. 1997; 22: 70-72Crossref Scopus (5) Google Scholar) of pFLAG-USF1 and pFLAG-USF2 to delete the basic regions of USF1 (amino acids 193–211) and USF2 (amino acids 228–247). SREBP expression vectors, pcDNA-SREBP1 and pcDNA-SREBP2, for active forms of SREBP1a (amino acids 1–490) and SREBP2 (amino acids 1–484) were constructed by inserting the corresponding Pfu DNA polymerase-amplified cDNA sequences into pcDNA3.1 expression vector (Invitrogen). A consensus Kozak sequence was also introduced immediately upstream of the ATG start codon of SREBP1a and SREBP2 by PCR primers. 3T3-L1 preadipocytes were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and induced to differentiate to adipocytes by 0.5 mm 1-methyl-3-isobutylxanthine and 0.25 μmdexamethasone as described previously (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). For stable transfection of 3T3-L1 cells, 10 μg of the experimental reporter plasmid DNA and 1 μg of pcDNA3.0 plasmid DNA, which provides the neomycin resistance, were cotransfected into preadipocytes using the calcium phosphate-DNA coprecipitation method (27Kingston R.E. Chen C.A. Okayama H. Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, New York1989: 9.1.1-9.1.3Google Scholar) and selected with Dulbecco's modified Eagle's medium + 10% fetal bovine serum and 300 μg/ml G418 for 2 weeks. G418-resistant colonies were pooled for later differentiation and luciferase activity assay. For transient transfection of 3T3-L1 cells, 10 μg of the experimental reporter plasmid with the indicated amount of expression vectors (when used) were cotransfected into differentiated 3T3-L1 adipocytes using the calcium phosphate-DNA coprecipitation method. Insulin treatment of the cells and luciferase activity assay were carried out as described previously (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). Triplicate plates were used for each sample group and average luciferase activities were used to calculate -fold changes induced by insulin and -fold stimulation caused by USF cotransfection. Plasmid DNA containing USF1, USF2, SREBP1, and SREBP2 cDNA sequences cloned in pcDNA3.0 and pcDNA3.1 (as described above) was first linearized and then in vitro transcribed with T7 RNA polymerase using a mRNA capping kit (Stratagene). The mRNAs were then in vitro translated to USF and SREBP proteins by programming rabbit reticulocyte lysates (Promega). Manufacturer's instructions were followed. The in vitro translation reaction with no mRNA added to the rabbit reticulocyte lysate was used as a negative control. Parallel experiments were set up to allow one set of reactions to produce [35S]Met-labeled proteins to monitor the translation products and the other set of reactions to produce unlabeled proteins for gel mobility shift assays. The following single-stranded oligonucleotides were synthesized by Operon, Inc. (Alameda, CA). IRS­WT:5′­AGCTGTCAGCCCATGTGGCGTGGCCGC­3′ 3′­AGTCGGGTACACCGCACCGGCGTCGAC­5′ IRS­M:5′­AGCTGTCAGCCGAATTC¯GCGTGGCCGC­3′ 3′­AGTCGGCTTAAG¯CGCACCGGCGTCGAC­5′ IRS­S1:5′­AGCTGCAG¯GCCCATGTGGCGCAA¯CCGC­3′ 3′­GTC¯CGGGTACACCGCGTT¯GGCGTCGAC­5′ Underlined sequences are the mutations from the wild-type insulin response sequence (IRS-WT). IRS-M contains the mutation of the −65/−60 E-box sequence, and IRS-S1 contains the mutation same as described in p2.1kbS1-LUC. Double-stranded oligonucleotides were formed as described previously (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). All probes for gel mobility shift assays were made by labeling with [α-32P]dCTP, in the presence of dATP, dGTP, and dTTP, and Klenow fragment of the Escherichia coli DNA polymerase. Cold dCTP was added at the end of the labeling reaction to make full-length probes. Reactions (20 μl) containing the indicated amount of in vitro translated USF and SREBP proteins and 5 × 105 cpm oligonucleotide probes were carried out and applied onto a 6% non-denaturing polyacrylamide gel, and autoradiography was performed as described previously (6Wang D. Sul H.S. J. Biol. Chem. 1995; 270: 28716-28722Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Specific USF1 and SREBP1 antibodies (2 μl each; Santa Cruz Biotech, Inc.) were added to the binding reactions for supershift experiments. Previously, we mapped the insulin response sequence (IRS) at the proximal FAS promoter region from −71 to −50. Based on the results of gel mobility shift assays, we identified both USF1 and USF2 as major components of complexes in rat liver nuclear extracts that bind the FAS IRS in vitro (6Wang D. Sul H.S. J. Biol. Chem. 1995; 270: 28716-28722Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Within this region, there is an E-box sequence (5′-CATGTG-3′) located at −65 to −60. We hypothesized that USF interacts with the E-box in vivo and this interaction is involved in the insulin regulation of the FAS gene transcription. As the first step, we tested the functional importance of the E-box sequence using transfection assays. Based on the studies in transgenic mice, the −2.1 kb promoter region contains all the necessary regulatory DNA elements and is sufficient to confer insulin responsiveness in vivo (28Soncini M. Yet S.-F. Moon Y. Chun J.-Y. Sul H.S. J. Biol. Chem. 1995; 270: 30339-30343Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Therefore, we mutated the E-box 5′-CATGTG-3′ sequence to 5′-GAATTC-3′ within the −2.1 kb FAS promoter context and tested the effect of this mutation on the insulin responsiveness of FAS promoter first in transiently transfected 3T3-L1 adipocytes. Insulin response was calculated as the ratio of luciferase activities in the presence of 10 nm insulinversus in the absence of insulin. As shown in Fig.1 A, mutation of the E-box sequence decreased the insulin response from 2.7-fold in p2.1kb-LUC to 1.4-fold in p2.1kbM-LUC in transient transfection assays. Then we tested the insulin response of these two reporter gene constructs using stable transfection assays. Pooled stable 3T3-L1 adipocyte transfectants were assayed by measuring the luciferase activities of the cells maintained in the presence 10 nm and absence of insulin. Similar to the results of transient transfection experiments, insulin response was decreased from 2.7-fold in p2.1kb-LUC to 1.2-fold in p2.1kbM-LUC (Fig. 1 A). These results suggested that the 5′-CATGTG-3′ E-box sequence within the previously identified −71/−50 region is required for insulin regulation of the FAS promoter, not only when transiently expressed as naked DNA templates but also when stably incorporated into the chromosomes. Next, we examined changes in the insulin response caused by the same mutation in the FAS −67 promoter context, which is the minimal region that we have shown to confer insulin responsiveness in transient transfection assays (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). Mutation of the 5′-CATGTG-3′ E-box sequence within this minimal promoter context will further demonstrate the functional importance of the −65/−60 E-box. As shown in Fig. 1 A, insulin treatment caused a 2-fold response in luciferase activities of p67-LUC, consistent with our previous reports using the same construct (5Moustaid N. Beyer R.S. Sul H.S. J. Biol. Chem. 1994; 269: 5629-5634Abstract Full Text PDF PubMed Google Scholar). However, when the E-box is mutated, adding insulin to the culturing medium did not induce a insulin response of the FAS promoter. Taken together, these results provide evidence that the 5′-CATGTG-3′ E-box sequence is critical for mediating the insulin response of the FAS promoter. We also found that E-box mutation within the −2.1 kb promoter context decreased the basal promoter activity by 75%, suggesting that, in addition to its involvement in the insulin regulation of the FAS promoter, the E-box sequence is also important for the basal promoter activity. Similar decrease of basal promoter activity was observed by Osborne and co-workers (32Bennett M.K. Lopez J.M. Sanchez H.B. Osborne T.F. J. Biol. Chem. 1995; 270: 25578-25583Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar), using deletion of −43 to −73 containing the E-box at −65 in the context of −150. Interestingly, we did not observe a decrease of the basal promoter activity by the E-box mutation in the −67 bp promoter context. Since basal promoter activity of p67-LUC is only 5% of the p2.1kb-LUC, it would have been difficult to see the further decrease caused by the mutation. It is also possible that interaction of USF with other transcription factors binding to sequences upstream to −67 may be necessary for the basal promoter activity. To see if the USF binding to the −65/−60 E-box correlates with the functional data presented above, we carried out gel mobility shift assays using the FAS −71/−50 region as the wild-type probe (IRS-WT) and the same region carrying the 5′-CATGTG-3′ to 5′-GAATTC-3′ E-box mutation as the mutated probe (IRS-M). In this experiment, in vitro translated USF1 and USF2 proteins were used to bind the32P-labeled probes. As shown in Fig. 1 B, when USF1 and USF2 were added together to form USF heterodimers, they interacted with the IRS-WT probe to form protein-DNA complexes (lane 6) in a migration pattern similar to our previously reported patterns when nuclear extracts were used (6Wang D. Sul H.S. J. Biol. Chem. 1995; 270: 28716-28722Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). However, when the IRS-M probes were used, USF proteins could no longer bind (lane 3), and the IRS-M sequence could not compete for the binding of USF to the IRS-WT probe (data not shown). Two additional bands (indicated by the asterisk in Fig. 1 B) were also observed and appeared to be nonspecific protein-DNA complexes because they formed with the unprogrammed rabbit reticulocyte lysate, and their patterns did not change when the −65/−60 E-box sequence was mutated (lanes 5 and 2), nor did addition of specific USF antibodies affect these two bands (see Fig. 4 A). Combined with the transfection data, in vitro binding analysis demonstrated that when USF can not bind to the FAS −65/−60 E-box, insulin response is abolished. These studies, therefore, demonstrate that mediation of insulin response is through the −65/−60 E-box and probably through its interaction with USF. In the case of several genes whose transcription regulation involves USF, cotransfection of USF expression vectors with the reporter genes stimulate the reporter gene activity (19Lefrancois-Martinez A.-M. Martinez A. Antoine B. Raymondjean M. Kahn A. J. Biol. Chem. 1995; 270: 2640-2643Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 29Mezey E. Potter J.J. Yang V.W. Alcohol. Alcohol. Suppl. 1993; 2: 57-62Google Scholar, 30Ghosh A.K. Datta P.K. Jacob S.T. Oncogene. 1997; 14: 589-594Crossref PubMed Scopus (32) Google Scholar). To further investigate the effect of USF on insulin regulation of the FAS promoter activity, we cotransfected USF1 and USF2 expression vectors, i.e. pFLAG-USF1 and pFLAG-USF2 (Fig. 2 A), with the FAS-luciferase reporter construct. To directly demonstrate the interaction between USF and the −65/−60 E-box, we used the p67-LUC because this construct represents the minimal insulin-responsive promoter and has the −65/−60 E-box as the only E-box in the promoter region that USF could bind to. Fig. 2 B shows the insulin-stimulated luciferase activities from cotransfection of expression vectors relative to the luciferase activity of p67-LUC under minus insulin conditions. Cotransfection of the control expression vector pcDNA3.0 at all concentrations resulted in the insulin-stimulated luciferase activities at about 2-fold level and thus had little effect on the insulin-stimulated p67-LUC activity. However, cotransfection of USF1 and USF2 significantly increased the insulin-stimulated luciferase activities up to 8- (USF1) and 11-fold (USF2) levels. Maximal activation was seen at concentrations of 200 ng of USF expression vector/culture plate, similar to the concentrations previously reported for maximal stimulation of the L-PK gene promoter by USF in transfection assays (19Lefrancois-Martinez A.-M. Martinez A. Antoine B. Raymondjean M. Kahn A. J. Biol. Chem. 1995; 270: 2640-2643Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). When the amounts of USF1 and USF2 were further increased to 1 and 2.5 μg/culture plate, the stimulation was reduced, probably due to the interference of the cellular transcription processes by overproduction of the ectopic USF proteins. When equal amounts of USF1 and USF2 were cotransfected together, further increase of insulin-stimulated FAS promoter activity was observed as USF1 and

Referência(s)